WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 


Pages:     | 1 || 3 | 4 |

«Психофизиологические детерминанты развития утомления при когнитивной нагрузке ...»

-- [ Страница 2 ] --

Рисунок 2. Дофаминергические пути в мозге человека (Николлс и др., Из представленного литературного обзора мы можем сделать несколько выводов, касающихся современного состояния научных исследований по утомлению, а также еще нерешенных задач в данной области. Из представленной картины мы видим, что в настоящее время данная проблема является весьма актуальной и требующей использования хорошего методологического аппарата, включающего в себя комплексную оценку данного состояния. Мы видим, что общее направление исследования утомления движется в сторону использования комплексного подхода, учитывающего разноуровневые показатели: субъективные, поведенческие, электрофизиологические, генетические. Однако в настоящее время еще не существует работ, учитывающих все эти уровни. В нашей работе впервые делается попытка обширного исследования утомления, включающего все перечисленные уровни. В настоящее время проведено достаточно большое количество экспериментов и накоплен значительный материал в области психологии и психофизиологии утомления, биохимии утомления и др.

Также одной из проблем, существующих в области исследования утомления, как мы видим из литературного обзора, является неоднозначность и разнонаправленность некоторых электрофизиологических показателей, к примеру, динамики альфа, бета и тета ритмов. Как правило, это связано с тем, что различные исследователи используют различные схемы экспериментов, которые не всегда приводят к развитию состояний утомления, так как пороги его развития у каждого человека индивидуальны и зависят от различных факторов. В соответствии с чем, в нашем исследовании мы попытались сделать схему и длительность эксперимента, наиболее подходящие для диагностики состояний утомления. В нашем исследовании мы пытаемся решить эту проблему, во-первых, за счет длительности эксперимента. Общая длительность одного эксперимента в нашем исследовании составила около четырех часов. Показано, что одни люди могут долго не утомляться при выполнении когнитивных заданий, другие же – утомляются почти сразу. Но в течение длительного выполнения заданий процессы утомления, в большей или меньшей степени, начинают проявляться у всех испытуемых. Во-вторых, мы используем в исследовании различные методы подсчета и анализа данных ЭЭГ, а также разные методы статистической обработки, за счет чего достигается достаточно высокая достоверность полученных данных. Это позволяет сравнить наши данные с уже полученными и описанными ранее в литературе, а также выявить наиболее информативные из них.

результатов генетического анализа, который в сочетании с психологическими и психофизиологическими параметрами помогает выявить наиболее объективные параметры утомления у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ. Таким образом, наше исследование направлено на комплексное и обширное исследование динамики процессов утомления при длительном выполнении когнитивной деятельности, а также отбор наиболее объективных и информативных из них.

ГЛАВА 2. МЕТОДИКА ИССЛЕДОВАНИЯ

В экспериментальном исследовании приняли участие 44 испытуемых мужского пола без каких-либо психических и неврологических заболеваний.

Все испытуемые были правшами. Средний возраст составил 24 6 лет.

Схема эксперимента состояла из трех блоков (рисунок 3). Первый и последний блоки были идентичными и включали в себя заполнение опросника САН (самочувствие, активность, настроение), запись ЭЭГ и выполнение заданий на время реакции (простую зрительно-моторную реакцию, реакцию выбора, теппинг-тест). Второй блок состоял из комплекса когнитивных заданий, направленных в основном на внимание и рабочую память. На этапе анализа данных проводилось статистическое сравнение результатов первого и последнего блоков, то есть проводился анализ влияния когнитивной нагрузки на психологические, электрофизиологические и поведенческие показатели. Общая длительность эксперимента составляла около 4 часов без предоставления испытуемому отдыха.

Рисунок 3. Схема эксперимента (*ПЗМР – простая зрительномоторная реакция; **РВ – реакция выбора) Выбор данных методик обосновывается целями и задачами исследования. Утомление, как комплексное явление, отражается на всех системах организма и проявляется на психологических и на физиологических параметрах. Выбранные методики позволяют оценить и динамику субъективных ощущений человека; параметры его поведенческих реакций, отражающие как моторные, так и когнитивные компоненты, и их изменения при утомлении; а также динамику электрофизиологических показателей, служащих хорошими индикаторами функционального состояния человека.

Таким образом, использование данных методов и методик позволит комплексно изучить влияние утомления на человека.

2.2. Экспериментальные задания и стимульный материал.

В экспериментальном исследовании для анализа поведенческих реакций использовалось два типа заданий на время реакции (рисунок 4): 1) простая зрительно-моторная реакция (ПЗМР) и 2) реакция выбора (РВ). При выполнении данных заданий испытуемому требовалось, как можно быстрее реагировать на появление определенных крестиков в центре экрана.

В заданиях с ПЗМР от испытуемого требовалось как можно быстрее нажимать на «кнопку 1» при появлении красного крестика в центре экрана. В серии с РВ испытуемый должен был, при появлении красного крестика в центре экрана, нажимать также на «кнопку 1», а при предъявлении зеленого крестика - «кнопку 2».

ПЗМР, простая зрительно-моторная реакция РВ, реакция выбора Для анализа поведенческих реакций в данном исследовании, помимо заданий на время реакции, также использовалось 2 типа теппинг-тестов: 1) комфортный теппинг-тест, 2) максимальный теппинг-тест.

При выполнении заданий с комфортным теппингом испытуемые должны были нажимать кнопку «Пробел» в любом удобном для них темпе. В заданиях с максимальным теппингом испытуемые должны были нажимать на кнопку «Пробел» с максимально возможной скоростью.

Испытуемые также заполняли компьютерный вариант теста САН (самочувствие, активность, настроение).

Стимульный материал. Для предъявления стимульного материала использовалась программа E-prime (версия 1.2). Стимулы предъявлялись на мониторе фирмы Dell с разрешением экрана 12801024 пикселей. Все стимулы предъявлялись на черном фоне. Фиксационная точка находилась в центре экрана в виде белого крестика (Courier New, размер 18).

Простая зрительно-моторная реакция (ПЗМР) и реакция выбора (РВ). Для ПЗМР и РВ заданий длительность фиксационной точки и стимула находилась в промежутке между 500-1500 мс. В ПЗМР стимулом служил красный крестик в центре экрана (Courier New, размер 72). В РВ стимулом был красный крестик (Courier New, размер 72) и зеленый крестик (Courier New, размер 72), которые предъявлялись в случайной последовательности. В обоих заданиях перед выполнением основной серии, испытуемые выполняли тренировочную серию из 10 стимулов. Основная серия же состояла из стимулов. При анализе данных учитывались стимулы только из основной серии.

Теппинг-тесты. В серии с комфортным теппингом испытуемый нажимал кнопку «Пробел» 90 раз. После 90 нажатий выполнение задания автоматически останавливалось. В максимальном теппинге испытуемые нажимали на кнопку «Пробел» в течение 60 секунд. Через 60 секунд выполнение задачи автоматически останавливалось.

Перед выполнением экспериментальных заданий и записью ЭЭГ, испытуемые заполняли психологические опросники. После этого начиналась запись ЭЭГ и выполнение экспериментальных заданий. Вначале проводилась фоновая запись ЭЭГ – одна минута с закрытыми глазами и одна минута с открытыми. После чего испытуемые выполняли блок различных когнитивных заданий в течение 2,5 часов, направленных преимущественно на внимание и рабочую память. После этого испытуемые выполняли такой же блок заданий, как и в начале эксперимента: методика САН, запись фоновой ЭЭГ, задания на время реакции и теппинг-тесты.

Запись ЭЭГ проводилась с помощью 256-канального энцефалографа фирмы EGI Electrical Geodesics с частотой оцифровки 500 Гц и референтом в вертексе. Фоновая ЭЭГ состояла из двух периодов записи – 1 минуты с закрытыми глазами и 1 минуты с открытыми глазами. После записи ЭЭГ проводился ремонтаж и фильтрация в полосе от 1 до 150 Гц и удалением Гц наводки от сети. Каждая запись ЭЭГ была автоматически просканирована на наличие артефактов. Участки ЭЭГ с амплитудой более 200 мкВ в пределах окна в 640 мс отмечались, как плохой канал; участки с амплитудой более мкВ рассматривались как двигательный артефакт (Net Station software).

Для статистического анализа данных использовались пакет Statistica (для Windows, V 8.0, StatSoft), а также пакет MatLab (версия R2007b).

экспериментальных заданий (ПЗМР, РВ, теппинг-тесты) и психологического опросника САН были посчитаны средние значения и стандартные отклонения. Для реакции выбора также было посчитано количество ошибок.

Статистические методы ANOVA и Т-тест для зависимых выборок были использованы для анализа влияния длительной когнитивной нагрузки на время реакции и субъективное состояние.

Рисунок 5. Области мозга для спектрального анализа ЭЭГ.

Анализ данных ЭЭГ. Для анализа ЭЭГ использовались отрезки фоновой ЭЭГ длительностью по 20 секунд с наименьшим содержанием артефактов в состояниях с закрытыми и открытыми глазами. На основе данных ЭЭГ были рассчитаны следующие показатели: спектр мощности, частота индивидуального альфа ритма (ИАР), индекс утомления (ИУ) и фронтальная асимметрия (ФА).

Индивидуальный альфа ритм рассчитывался как частота, на которой наблюдается максимальная мощность альфа ритма в диапазоне от 7 до 14 Гц.

Подсчет индивидуального альфа ритма проводился с помощью программы MatLab, используемый скрипт приведен в приложении (Приложение 1).

Спектр мощности ЭЭГ рассчитывался для следующих диапазонов: тета ритм (3,5-7,5 Гц), нижний альфа (7,5-10 Гц), верхний альфа (10-12,5 Гц), альфа (7,5-12,5 Гц), нижний бета (12,5-18 Гц), верхний бета (18-35 Гц), бета (12,5-35 Гц), гамма (35-45 Гц). Данные ЭЭГ были усреднены по пяти отдельным областям: фронтальной, центральной, височной, теменной и затылочной для обоих полушарий (рисунок 5).

Индекс утомления был рассчитан как отношение суммы мощностей медленных ритмов (альфа и тета ритмов) к мощности быстрого ритма (бета):

ИУ = (альфа + тета) / (бета)) (Jap et al, 2009, Cheng, 2011) Фронтальная асимметрия. Коэффициент фронтальной асимметрии рассчитывался как разность логарифмов сумм мощностей в отведениях F3, F и сумм мощностей в отведениях F4, F8:

ФА = log(sqrt(a)) –log (sqrt (b)) 2.5.1. Методика генотипирования 5HTT Полиморфизм гена транспортера серотонина 5HTTLPR определяли с помощью полимеразной цепной реакции (ПЦР) и последующей идентификации различий длин продуктов (Ведяков А.М., Тоневицкий А.Г., Сысоева О.В., Портнова Г.В., Иваницкий А., 2006).

Для постановки ПЦР использовали следующие праймеры:

5HTT - F 5' – CAATGTCTGGCGCTTCCCCTACATAT - 3' 5HTT - R 5' – GACATAATCTGTCTTCTGGCCTCTCAAG - 3' Для аллеля L ожидаемая длина продукта амплификации 300 п.о., для аллеля S 256 п.о.

ПЦР проводили по следующей программе:

94С - 30 секунд, 61С – 1 минута, 72С – 1 минута; - 35 циклов;

Детекцию продуктов проводили с помощью электрофореза в 2% агарозном геле. Гель готовили на ТАЕ–буфере (0,2 М Трис, 0,1 М Ледяная уксусная кислота, 0.5М ЭДТА pH8.0). Электрофорез проходил при напряжении 100 V в течение 30 минут с охлаждением. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

2.5.2. Методика генотипирования DRD Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм определяли по длине продуктов после рестрикции. ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б» производства ЦНИИЭ (Россия). Реакцию проводили в объеме 25 мкл. Стандартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ сульфата аммония, 2,5 mM MgCl2, 0,125 мг/мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезоксинуклеозидтрифосфатов и по 8 пмоль праймеров.

При постановке ПЦР обязательно использовали технику «горячий старт», который обеспечивался разделением нуклеотидов с праймерами и Taqполимеразы прослойкой воска.

фланкирующие полиморфный участок гена DRD2 (Farde L., Gustavsson J.P., Jonsson E., 2007).

5‘-ССGTCGACCCTTCCTGAGTGTCATCA-3‘ прямой 5‘-CCGTCGACGGCTGGCCAAGTTGTCTA-3‘ обратный Ожидаемая длина продукта амплификации 310 п.о. для обеих аллелей.

ПЦР проводили по следующей программе в амплификаторе Терцик (ДНКтехнология):

94С - 30 сек., 58С - 30 сек., 72С – 30 сек; всего 35 циклов;

Хранение: +10С.

Затем к 7.5 мкл каждого образца добавляли определенное количество рестриктазы Taq I, эквивалентное 5 единицам активности фермента и проводили рестрикцию амплифицированных продуктов в течение 22 часов при 65 С в суховоздушном термостате.

Мутантный аллель А1 не расщепляется. А2 аллель (дикий тип) расщепляется на продукты длинной 130 и 180 п.о.

Детекцию продуктов проводили с помощью электрофореза в 3% агарозном геле. Гель готовили на ТАЕ-буфере (0,1 М трис, 0,1 М уксусная кислота, 2 мМ ЭДТА, рН 8,3) с добавлением бромистого этидия до конечной концентрации 0,00001 %. Электрофорез проходил с охлаждением при напряжении 100 V в течение 1 часа. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

2.5.3. Методика генотипирования COMT Проводили полимеразную цепную реакцию (ПЦР). Полиморфизм определяли по длине рестриктых фрагментов продуктов амплификации. ДНК выделяли из 100 мкл цельной крови с помощью наборов «ДНК-сорб Б»

производства ЦНИИЭ (Россия). Реакцию проводили в объеме 25 мкл.

Стандартная реакционная смесь включала: 67 мМ Трис-НCl (рН 8,4), 16 мМ сульфата аммония, 2,5 mM MgCl2, 0,125 мг/мл бычьего сывороточного альбумина, 8% глицерин, 0,001% ксиленцианол, 2,5 Ед Taq-ДНК-полимеразы (ЦНИИЭ, Россия), 0,2 мМ каждого из четырех дезоксинуклеозидтрифосфатов и по 8 пмоль праймеров. При постановке ПЦР обязательно использовали технику «горячий старт», который обеспечивался разделением нуклеотидов с праймерами и Taq-полимеразы прослойкой воска.

фланкирующие полиморфный участок гена COMT.

5'-TCG TGG ACG CCG TGA TTC AGG-3' прямой 5'-AGG TCT GAC AAC GGG TCA GGC-3' обратный Ожидаемая длина продукта амплификации 217 п.о. для обоих аллелей.

ПЦР проводили по следующей программе в амплификаторе Терцик (ДНКтехнология):

94С - 30 сек., 55С - 30 сек., 72С – 1 мин; всего 35 циклов;

Хранение: +10С.

Затем к 7.5 мкл каждого образца добавляли определенное количество рестриктазы NlaIII, эквивалентное 1 единице активности и проводили рестрикцию амплифицированных продуктов в течение ночи при 37С.

Аллель, содержащий Val (дикий тип) расщепляется на продукты длинной 136 и 81 п.о. Мутантный аллель, содержащий Met, расщепляется на продукты длинной 96, 81, и 40 п.о.

Детекцию продуктов проводили с помощью электрофореза в 10% акриламидном геле. Гель готовили на ТВЕ-буфере (0,1 М трис, 0,1 М борная акриламид:бисакриламид 19:1. Электрофорез проходил при напряжении V в течение 1,5 час. Затем гель 15 мин красили в 0,00001 % растворе бромистого этидия. Результат детектировали на трансиллюминаторе ТСР 15М (Vilber lourmat) с помощью системы видеодетекции «DNA Analyzer».

ГЛАВА 3. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ

Результаты экспериментального исследования представлены в двух разделах. В первом разделе представлены результаты по субъективным, поведенческим и электрофизиологическим показателям, усредненные по всей группе испытуемых. Во втором разделе представлены результаты по субъективным, поведенческим и электрофизиологическим показателям для носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

3.1. Результаты по субъективным, поведенческим и электрофизиологическим показателям по всей выборке.

3.1.1. Субъективные и поведенческие данные.

А) Методика САН В таблице 1 показаны средние значения для каждой шкалы опросника САН для обоих состояний: до и после влияния длительной когнитивной нагрузки. Результаты Т-теста для зависимых выборок показали значимое снижение показателя по шкалам Самочувствие, Активность и Общему баллу.

Таким образом, когнитивное утомление не отражается на настроении испытуемого, но значимо влияет на его субъективное самочувствие и активность.

Ср. значения, шкала: 1-7 баллов Б) Простая зрительно-моторная реакция В таблице 2 представлены результаты для Простой зрительномоторной реакции (ПЗМР) до и после влияния длительной когнитивной нагрузки. Статистический анализ данных выявил значимое увеличение времени реакции. Статистический анализ ANOVA показал значимые различия в скорости простой зрительно-моторной реакции в начале и в конце эксперимента (F (1,58)=12,016; p0,001). Таким образом, можно говорить о том, что в состоянии утомления, вызванном длительной когнитивной нагрузкой, происходит значимое замедление простой зрительно-моторной реакции.

В) Реакция выбора В таблице 3 представлены результаты для Реакции выбора (РВ) до и после влияния длительной когнитивной нагрузки. Статистический анализ данных выявил значимое уменьшение времени реакции одновременно со значимым увеличением количества ошибок. Статистический анализ ANOVA покзал значимое снижение скорости реакции выбора после утомления (F(1,58)=9,291; p0,004). ANOVA также показала значимое увеличение ошибок после утомления в реакции выбора (F (1,58)=7,62; p0,008). Это означает, что когнитивное утомление отражается в увеличении скорости реакции выбора с одновременным увеличением количества ошибок.

Г) Теппинг-тесты В таблице 4 представлены результаты для разных видов теппинг-тестов до и после влияния длительной когнитивной нагрузки. Статистический анализ ANOVA показал значимое снижение скорости комфортного теппинга (F(1,48)=9,74; p0,004). Скорость максимального теппинга значимо не изменилась. Из этого следует, что когнитивное утомление практически не влиет на моторные процессы, но значимо отражается на субъективном течении времени.

Сред.время реакции (ст.откл) 3.1.2. Результаты ЭЭГ А) Индивидуальный альфа ритм В таблице 5 представлены электроэнцефалографические результаты по показателю индивидуального альфа ритма (ИАР) для 5 мозговых регионов в затылочном) для обоих состояний: до и после влияния длительной когнитивной нагрузки.

Статистический анализ данных показал значимое снижение ИАР в правом полушарии после длительной когнитивной нагрузки. Результаты Ттеста показали значимое снижение частоты индивидуального альфа ритма в правом полушарии в теменной, височной и затылочной областях.

Частота индивидуального альфа ритма до и после утомления (Гц).

Ср.знач. /ст.откл.

(*значимые изменения (p0.05);** значимые изменения (p0.01)) Трехфакторная модель ANOVA выявила значимое взаимодействие двух факторов (рисунок 6): состояние – до и после влияния длительной когнитивной нагрузки; а также фактора полушарие (F(1,44)=5,74; p0,02).

Это означает, что в разных полушариях ИАР изменяется разнонаправленно. В правом полушарии в фоне наблюдается более высокая частота ИАР, чем в левом полушарии. После утомления в правом полушарии наблюдается более сильное снижение частоты ИАР, хотя и не значимое. При этом различные области мозга не различают по частоте индивидуального альфа ритма.

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 6. Частота индивидуального альфа ритма до и после утомления в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная; 3 –теменная; 4 – височная; 5 –затылочная).

Б) Спектральный анализ данных ЭЭГ использовался двухфакторный дисперсионный анализ ANOVA. Первым из факторов было состояние – до и после влияния длительной когнитивной нагрузки; а вторым фактором были области мозга – лобная, центральная, Статистический анализ проводился отдельно для каждого спектрального диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма), а также для состояний с зактрытыми и открытыми глазами.

Спектральный анализ подсчитывался двумя различными способами, подсчитывается как относительная логарифмизированная мощность для каждого диапазона в каждой области. Во втором же он представлял среднее значение мощности, усредненное внутри каждой области и для каждого диапазона.

I способ. Обработка и анализ спектральных данных ЭЭГ в первом способе состояла из следующих этапов:

1. Отфильтрованные и очищенные от артефактов показатели мощности ЭЭГ, представленные в трехмерной матрице (257 каналов; частота 1-40 Гц с частотой дискретизации 0,03 Гц; 44 испытуемых), были усреднены по каждому отдельному региону (лобному, центральному, височным, теменному и затылочному) (см. рисунок 5).

2. Полученные усредненные данные мощности ЭЭГ для каждой области были просуммированы внутри каждого диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма).

3. Был посчитан натуральный логарифм полученных мощностей (LN).

4. Была посчитана относительная мощность логарифмизированных данных, которая высчитывалась как отношение мощности данного диапазона к сумме мощностей всех диапазонов (тета, альфа, бета, гамма).

5. Для каждого отдельного ритма и каждого состояния был проведен статистический анализ ANOVA.

II способ. Для второго способа анализ и обработка данные состояла из следующих этапов:

1. Отфильтрованные и очищенные от артефактов показатели мощности ЭЭГ, представленные в трехмерной матрице (257 каналов; частота 1-40 Гц с частотой дискретизации 0,03 Гц; 44 испытуемых), были усреднены по каждому отдельному региону (лобному, центральному, височным, теменному и затылочному) (см. рисунок 5).

2. Полученные усредненные данные мощности ЭЭГ для каждой области были усреднены также внутри каждого диапазона (тета, нижний альфа, верхний альфа, альфа, нижний бета, верхний бета, бета, гамма).

3. Для каждого отдельного ритма и каждого состояния был проведен статистический анализ ANOVA.

Спектральный анализ в диапазоне тета ритма. Двухфакторная модель ANOVA выявила значимое увеличение мощности тета ритма после (F(1,27)=7,98; p0,009) (рисунок 7) и не выявила значимых изменений для логарифмизированных данных, для которых наблюдалась лишь небольшая тенденция к увеличению. Из графика видно, что наибольшие изменения в тета диапозоне наблюдались в левой височной и затылочных областях.

ОБЛАСТИ

Рисунок 7. Спектральные характеристики для усредненных данных в диапазоне тета ритма (3,5-7,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне нижнего альфа ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение нижнего альфа ритма для логарифмизированных данных после длительной когнитивной нагрузки, как в состоянии с открытыми глазами (F(1,43)=15,048, p0,0004), так – и в состоянии с закрытыми (F(1,43)=10,903, p0,001) (рисунок 8). Для усредненных данных статистический анализ относительная мощность 0,

ОБЛАСТЬ ОБЛАСТЬ

Рисунок 8. Спектральные характеристики для LN данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых (а) и открытых (б) глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –

ОБЛАСТИ

Рисунок 9. Спектральные характеристики для усредненных данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

условиях с закрытыми глазами (F(1,38)=13,413; p0,0008) (рисунок 9). Из графиков видно, что наибольшее увеличение мощности альфа ритма наблюдается в теменной и височных областях и чуть меньше – в затылочной области. При этом также видно, что усредненная мощность альфа ритма максимальна в теменной и затылочной областях.

Спектральный анализ ЭЭГ в диапазоне верхнего альфа ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение верхнего альфа ритма для логарифмизированных данных после длительной когнитивной нагрузки как в состоянии с открытыми глазами (F(1,43)=5,08;

p0,03), хотя оно менее значимое, чем в диапазоне нижнего альфа ритма 10). Для усредненных данных статистический анализ ANOVA (рисунок выявил значимое увеличение верхнего альфа ритма только в условиях с закрытыми глазами (F(1,37)=4,646; p0,04). В данном случае также видно, что это изменение менее значимо, чем в диапазоне нижнего альфа ритма (рисунок 11).

ОБЛАСТЬ

Рисунок 10. Спектральные характеристики для LN данных в диапазоне верхнего альфа ритма (10-12,5 Гц) для открытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

ОБЛАСТИ

Рисунок 11. Спектральные характеристики для усредненных данных в диапазоне верхнего альфа ритма (10-12,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 – теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Спектральный анализ ЭЭГ в диапазоне альфа ритма. В диапазоне альфа ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое увеличение ритма после длительной когнитивной нагрузки только в условиях с открытыми глазами (F(1,43)=9,764; p0,003). Но оно также намного меньше, чем в диапазоне нижнего альфа ритма (рисунок 12).

ОБЛАСТЬ

Рисунок 12. Спектральные характеристики для LN данных в диапазоне альфа ритма (7,5-12,5 Гц) для открытых глаз во всех областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая

ОБЛАСТИ

Рисунок 13. Спектральные характеристики для усредненных данных в диапазоне альфа ритма (7,5-12,5 Гц) для закрытых глаз вр всех областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; Для усредненных данных статистический анализ ANOVA выявил значимое увеличение ритма после утомления только в условиях с закрытыми глазами (F(1,38)=12,694; p0,002) (рисунок 13). Из графика видно, что максимальная мощность альфа ритма наблюдается в теменной и затылочной областях. Таким образом, из полученных данных видно, что максимальные изменения в диапазоне альфа ритма наблюдаются в поддиапазоне нижнего альфа ритма (7,5 – 10 Гц).

Спектральный анализ ЭЭГ в диапазоне нижнего бета ритма.

Двухфакторный статистический анализ ANOVA выявил значимое увеличение нижнего бета ритма для логарифмизированных данных после длительной когнитивной нагрузки в состоянии с открытыми глазами (F(1,43)=4,651;

p0,04) (рисунок 14). Для усредненных данных статистический анализ ANOVA не выявил значимых изменений.

ОБЛАСТЬ

Рисунок 14. Спектральные характеристики для LN данных в диапазоне нижнего бета ритма (12,5-18 Гц) для открытых глаз во всех областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; Спектральный анализ ЭЭГ в диапазоне верхнего бета ритма. В диапазоне верхнего бета ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое уменьшение ритма после длительной когнитивной нагрузки в условиях с закрытыми глазами (F(1,43)=4,292; p0,04) (рисунок 15).

Для усредненных данных статистический анализ ANOVA выявил значимое увеличение верхнего бета ритма послеутомления нагрузки в условиях с закрытыми глазами (F(1,37)=4,558; p0,04) (рисунок

ОБЛАСТЬ

Рисунок 15. Спектральные характеристики для LN данных в диапазоне верхнего бета ритма (18-35 Гц) для закрытых глаз во всех областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная;

ОБЛАСТИ

Рисунок 16. Спектральные характеристики для усредненных данных в диапазоне верхнего бета ритма (18-35 Гц) для всех областей (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая Спектральный анализ ЭЭГ в диапазоне бета ритма. В диапазоне бета ритма статистический анализ ANOVA для логарифмизированных данных выявил значимое уменьшение ритма после длительной когнитивной нагрузки в условиях с закрытыми глазами (F(1,43)=8,121; p0,007) (рисунок 17).

ОБЛАСТЬ

Рисунок 17. Спектральные характеристики для LN данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех областях ( – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая Для усредненных данных статистический анализ ANOVA выявил значимое увеличение верхнего бета ритма после утомления в условиях с закрытыми глазами (F(1,38)=5,399; p0,03) (рисунок 18).

ОБЛАСТ И

Рисунок 18. Спектральные характеристики для усредненных данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; Спектральный анализ ЭЭГ в диапазоне Гамма ритма. Статистический анализ ANOVA для логарифмизированных данных не выявил значимых изменений в диапазоне гамма ритма. Отмечается лишь маленькая тенденция к уменьшению после длительной когнитивной нагрузки. Для усредненных данных статистический анализ ANOVA не выявил значимых изменений.

В) Индекс утомления.

Индекс утомления, отражающий отношение суммарной мощности альфа и тета ритмов к суммарной мощности бета ритма (FAT= (alpha + theta) / (beta)) (Jap et al, 2009), высчитывался отдельно для всех каналов для закрытых и открытых глаз для обоих состояний: до и после длительной утомления был усреднен по 6 выделенным мозговым регионам.

Статистический анализ (Т-тест) проводился отдельно, как для каждого электрода, так и для усредненных данных по мозговым областям для обоих полушарий. Т-тест для отдельных каналов выявил значимое увеличение индекса утомления в 133 каналах из 257 в условиях с закрытыми глазами, и в 55 каналах – с открытыми глазами (Рисунок 19). В таблице 6 представлены значения индекса утомления со стандартными отклонениями по отдельным регионам. Статистический анализ Т-тест показал значимое увеличение индекса утомления практически во всех регионах в условиях с закрытыми глазами, кроме лобных и центральной левой области, а также в теменных отделах в условиях с открытыми глазами.

Индекс утомления до и после когнитивной нагрузки.

Ср.знач. /ст.откл.

Ср.знач. /ст.откл.

Рисунок 19. Значимое увеличение индекса утомления после когнитивной нагрузки в условиях с закрытыми (а) и открытыми (б) статистический анализ – дисперсионный анализ ANOVA. Статистический анализ ANOVA показал, что индекс утомления значимо увеличивается после утомления в обоих полушариях в условиях с закрытыми глазами (F(1,43)=8,316; p0,006). Трехфакторная модель ANOVA показала значимое взаимодействие всех трех факторов: состояние (до и после когнитивной нагрузки), области мозга и полушарие (F(4,172)=3,034; p0,02). Это говорит о том, что индекс утомления, во-первых, значимо увеличивается с утомлением, а во-вторых, он по-разному изменяется в разных областях мозга и в разных полушариях. В условиях с открытыми глазами трехфакторная ANOVA состояние и области мозга (F(4,172)=20,72; p0,000004). Это означает, что индекс утомления значимо возрастает с утомлением, но в разных областях мозга по-разному. При этом не наблюдается значимых различий в изменении индекса утомления в разных полушариях.

В условиях с закрытыми глазами правое полушарие характеризуется более высоким значением индекса утомления до и после когниитвной нагрузки, преимущественно в лобной и теменных областях. Это может говорить о доминировании медленных ритмов в правом полушарии. По данным многочисленных исследований показано, что увеличение мощности медленных ритмов связано с развитием когнитивного утомления (Cheng et al, 2011; Boksem et al, 2006).

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 20. Показатели индекса утомления при закрытых глазах до и после когнитивной нагрузки для левого и правого полушарий всех областей мозга (1 – лобная; 2 – центральная; 3 –теменная; 4 – височная; –затылочная) в условиях с закрытыми и открытыми глазами.

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 21. Показатели индекса утомления при открытых глазах до и после когнитивной нагрузки для левого и правого полушарий всех областей мозга (1 – лобная; 2 – центральная; 3 –теменная; 4 – височная; –затылочная) в условиях с закрытыми и открытыми глазами.

Г) Фронтальная асимметрия.

В таблице 7 представлены вычисленные показатели коэффициентов фронтальной асимметрии для условий с закрытыми и открытыми глазами в состояниях до и после длительной когнитивной нагрузки. Проведенный статистический анализ не выявил значимых изменений по показателям фронтальной асимметрии ни до, ни после когнитивной нагрузки.

3.2. Результаты по субъективным, поведенческим и электрофизиологическим показателям у носителей различных В данном экспериментальном исследовании мы пытались обнаружить возможные связи между наличием определенных полиморфизмов генов и психофизиологических параметров. Был проведен генетический анализ и определены полиморфизмы трех генов - 5HTT, COMT и DRD2.

В гене 5HTT (5-HT transporter gene, 5-НТТ) мы рассматривали представленный тремя вариантами - LL, LS и SS. Он играет важную роль в периферических тканях. Он удаляет серотонин из синаптической щели и определяет величину и продолжительность сигнала на постсинаптической мембране. При наличии одной или двух S аллелей транскрипция 5-HTT снижается на 60-70% в головном мозге и на 30-40% в лимфобластах по сравнению с гомозиготой по L аллели (Зинченко и др., 2011).

В гене СОМТ мы смотрели полиморфизм Val158Met, представленный тремя вариантами - MM, VV и MV. В литературе было показано, что частота встречаемости аллеля M варьирует в различных популяциях от 0.01 до 0.62, а для популяции русских приблизительно равна 0.5 (Palmatier, 1999).

В гене DRD2 мы смотрели полиморфизм TaqI A, который также представлен тремя различными вариантами - A1A1, A1A2 и A2A2. Известно, что аллель А1 встречает в популяции россиян с вероятностью 0,172, а аллель А2 – 0.828 (Kidd, 1998). Также было выяснено, что наличие аллеля А приводит к уменьшению плотности рецепторов на 30-40%, по сравнению с А2А2. Поэтому при анализе данных, мы будем объединять полиморфизмы А1А1 и А1А2 в одну группу. Статистический анализ проводился отдельно по каждому гену.

По гену 5НТТ выборка была разбита на 2 группы: первая группа характеризовалась наличием полиморфизма LL (16 человек), а вторая группа – наличием полиморфизмов LS и SS (23 человека). Такое решение было принято на основе литературных данных, показывающих, что LLполиморфизм ассоциирован с более высоким содержанием транспортера серотонина (Davis JM, 1995; Weicker H, 2001; Meeusen R, 2007).

По гену СОМТ мы разделили выборку на 3 группы: первая группа включала носителей ММ-полиморфизма (5 человек), вторая группа включала носителей MV-полиморфизма (22 человека), а третья группа включала носителей VV-полиморфизма (8 человек). Данное решение было основано на неравности групп, а также на опубликованных данных, показывающих, что ММ-полиморфизм ассоциирован с более медленной деградацией дофамина, который, в свою очередь, играет важную роль в когнитивных процессах (Chen, 2004).

По гену DRD2, как было сказано выше, выборка была поделена на группы: первая группа включала носителей полиморфизмов A1A1 и A1A2 ( человек), а вторая группа включала носителей полиморфизма A2A2 ( человек). Данное решение было также принято на основе литературных данных, которые показали, что полиморфизм A2A2 ассоциирован с большей плотностью дофаминовых рецепторов (Foley TE, 2008).

3.2.1. Субъективные и поведенческие показатели у носителей различных полиморфизмов генов 5НТТ, DRD2, СОМТ.

А) Методика САН В таблице 8 (а, б, в) представлены средние значения для каждой шкалы опросника САН для носителей различных полиморфизмов для обоих состояний: фонового состояния до утомления и состояния после утомления.

Результаты Т-теста показывают значимое снижение оценки по шкалам Самочувствие, Активность и Общему баллу у всех трех генов практически по всем полиморфизмам. Таким образом, видно, что изменения, происходящие на субъективном уровне после действия длительной когнитивной нагрузки, значимо не различаются у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ. Все испытуемые, независимо от наличия у них тех или иных полиморфизмов, одинаково ощущали на субъективном уровне ухудшение самачувствия и активности.

Таблицы 8 (а,б,в). Изменения субъективных ощущений по опроснику САН после утомления у носителей полиморфизмов генов До утомления/после утомления Ср. значения, шкала: 1-7 баллов A1A1+A До утомления/после утомления Ср. значения, шкала: 1-7 баллов До утомления/после утомления Ср. значения, шкала: 1-7 баллов Б) Простая зрительно-моторная реакция В таблице 9 (а, б, в) представлены показатели простой зрительномоторной реакции (ПЗМР) со стандартными отклонениями для ностилелей различных полиморфизмов трех генов до и после утомления.

Простая зрительно-моторная реакция (ген 5НТТ).

Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,50)=9,420; p0,004), но при этом значимых различий между отметить, что носители LL-полиморфизма характеризуются на уровне тенденции меньшей скоростью, по сравнению с LS+SS.

Рисунок 22. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена 5НТТ (LL и Простая зрительно-моторная реакция (ген DRD2).

Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,47)=6,479; p0,01). Также было показано, что носители двух групп полиморфизмов A1A1+A1A2 и A2A2 значимо различаются между собой: F(1,47)=6,960; p0,01. Носители полиморфизма A2A2 характеризуется значимо более высоким временем реакции, по сравнению с носителями A1A1+A1A2 полиморфизмов (рисунок 23).

Рисунок 23. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена DRD Простая зрительно-моторная реакция (ген СОМТ).

Ср.знач. (ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое увеличение времени реакции после длительной когнитивной нагрузки (F(1,49)=5,829; p0,02). Между собой носители полиморфизмов MM, MV и VV значимо не различаются в простой зрительно-моторной не значимым по сравнению с остальными генотипами (рисунок 24).

Рисунок 24. Статистический анализ ANOVA для показателей ПЗМР до и после утомления у носителей полиморфизов гена COMT В) Реакция вывбора В таблице 10 (а,б,в) представлены средние значения и стандартные отклонения по времени реакции в Реакции выбора для трех генов до и после утомления. Статистический анализ показал, что, также как и для показателей ПЗМР, полиморфизмы LL, A2A2 и MM характеризуются самым медленным временем реакции по сравнению с другими полиморфизмами.

5НТТ До утомления, мс После утомления, мс Ошибки до Ошибки после Ср.знач.(ст.откл.) Двухфакторная модель ANOVA выявила, что в целом наблюдается значимое уменьшение времени реакции после длительной когнитивной полиморфизмов LL и LS+SS значимо различаются между собой по времени реакции (F(1,50)=5,146; p0,03) (рисунок 25, а). ANOVA показала, что количество ошибок значимо возрастает с утомлением (F(1,50)=8,5256;

p0,006), но между собой носители полиморфизмов значимо не различаются по данному параметру (рисунок 25, б).

время реакции, мс значимое уменьшение времени реакции после длительной когнитивной (F(1,47)=5,643; p0,02) (рисунок 26, а). ANOVA показала, что количество ошибок значимо возрастает с утомлением (F(1,47)=9,6754; p0,004), но время реакции, мс Ср.знач. (ст.откл.) Двухфакторная модель ANOVA не выявила значимых изменений показателей реакции выбора у носителей различных полиморфизмов в гене значимых изменений, отмечается лишь общая тенденция к росту ошибок (рисунок 27, б).

время реакции, мс Г) Теппинг-тесты В таблице 11 (а, б, в) представлены данные теппинг-тестов для трех генов до и после утомления. Как мы видим, основные изменения наблюдаются в комфортном теппинге. В гене 5НТТ наблюдается значимое замедление скорости теппинга у обеих групп. В гене DRD2 значимое замедление скорости наблюдается только у полиморфизма А2А2, а в гене СОМТ – только у полиморфизма MV.

Сред. время реакции (ст. откл) носителями различных полиморфизмов в удобном теппинге в гене 5HTT (рисунок 28, а). Замедление комфортного теппинга наблюдается как у носителей LL полиморфизма (F(1,19)=4,62; p0.05), так и у носителей LS+SS полиморфизмов (F(1,22)=4,62; p0.05). В максимальном же теппинге двухфакторный ANOVA показал значимую интеракции между факторами время (до и после утомления) и типом полиморфизма (LL или LS+SS):

F(1,27)=10,408; p0,004 (рисунок 28, б). Это говорит о том, что у разных максимального теппинга при утомлении. Полиморфизм LL характеризуется повышением скорости при утомлении, но не значимым, а носители S-аллеля, наоборот, значимым снижением скорости (F(1,11)=10,828; p0,007).

время реакции, мс Рисунок 28. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена 5НТТ (LL и LS+SS). Синий сплош. – полиморфизм LL, красный пунктир – полиморфизмы LS+SS.

Сред.время реакции (ст.откл) носителями различных полиморфизмов в максимальном теппинге в гене DRD2 (рисунок 29, а,б). По показателям удобного теппинга двухфакторная модель ANOVA выявила значимое замедление скорости теппинга после утомления (F(1,40)=4,97; p0,04). При этом у носителей полиморфизма A2A наблюдается значимое снижение скорости (F(1,28)=6,30; p0,02), тогда как у группы A1A1+A1A2 – не наблюдается.

время реакции, мс Рисунок 29. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена DRD2 (A1A1+A1A2 и A2A2) после Сред.время реакции (ст.откл) Статистический анализ ANOVA не выявил значимых различий между полиморфизмами после утомления в гене СОМТ.

время реакции, мс

COMT MM COMT MM

COMT MV COMT MV

COMT VV COMT VV

Рисунок 30. Статистический анализ ANOVA для показателей комфортного (а) и максимального (б) теппингов до и после утомления у носителей полиморфизов гена COMT (MM, MV и VV) после длительной 3.2.2. ЭЭГ результаты у носителей различных полиморфизмов генов 5НТТ, DRD2, СОМТ.

показателей ЭЭГ после длительной когнитивной нагрузки для всех трех генов. Ген 5НТТ ассоциирован с серотониновым транспортером. Носители LL-полиморфизма имеют на клеточных мембранах больше транспортера серотонина по сравнению с остальными полиморфизмами. Это означает, что серотонин у них удаляется гораздо быстрее из синаптической щели, чем у остальных полиморфизмов. Ген DRD2 определяет плотность рецепторов к дофамину. Наличие А1-аллеля ведет к уменьшению плотностью рецепторов положительного подкрепления. СОМТ играет важную роль в деградации дофамина в префронтальной коре (Apud, 2007). Носители VV-полиморфизма характеризуются наибольшей скоростью распада дофамина.

А) Частота индивидуального альфа ритма (ИАР) полиморфизмов гена 5НТТ - LL и LS+SS до и после когнитивной нагрузки.

характеризуются незначительным изменением данного показателя. Носители же S-аллеля (LS и SS) характеризуются значимым уменьшением ИАР в теменной области правого полушария.

Статистический анализ ANOVA не выявил значимых различий между группами LL и LS+SS (рисунок 31, а, б). При этом носители S-аллеля (LS+SS) характеризуются значимым уменьшением ИАР в правом полушарии после когнитивной нагрузки (F(1,23)=5,097; p0,04), чего не наблюдается у носителей LL полиморфизма.

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 31. Частота индивидуального альфа ритма у полиморфизмов гена 5НТТ – LL (а) и LS+SS (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная; 3 –теменная; 4 – височная; 5 –затылочная).

полиморфизмов гена DRD2 (A2A2 и А1А1+А1А2) до и после длительной когнитвной нагрузки. Генотип А2А2 характеризуется в целом большим значением ИАР, по сравнению с носителями А1-полиморфизма (А1А1+А1А2). Проведенный статистический анализ Т-тест выявил, что у носителей А1-аллеля (А1А1+А1А2 полиморфизмы) наблюдается значимое снижение частоты ИАР во фронтальной, теменной, затылочной областях, а также в среднем по всему скальпу. У носителей А2А2 полиморфизма значимых изменений не наблюдается.

Ср.знач. (ст.откл.) Статистический анализ ANOVA не выявил значимых различий между группами носителей полиморфизмов A2A2 и A1A1+A1A2. При этом у носителей А1-аллеля (A1A1+A1A2 полиморфизмы) наблюдается значимое уменьшение ИАР в обоих полушариях (F(1,11)=7,678; p0,02) (рисунок 32, а), чего не наблюдается у носителей А2А2 полиморфизма (рисунок 32, б).

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 32. Частота индивидуального альфа ритма у полиморфизмов гена DRD2 - A1A1+A1A2 (а) и A2A2 (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная; 3 –теменная; 4 – височная; 5 –затылочная).

полиморфизмов гена СОМТ (ММ, MV и VV) до и после длительной когнитвной нагрузки. Статистический анализ выявил значимое уменьшение ИАР после когнитивной нагрузки только у полиморфизма MМ в лобной области обоих полушарий.

У полиморфизма VV и MV также наблюдается уменьшение частоты ИАР, но не значимое. Интересно отметить, что полиморфизм ММ характеризуется изначально самым высоким значением ИАР (среднее значение по всем областям 10,28 Гц), а также самым сильным относительным сниженим – до 9,82 Гц. VV полиморфизм характеризуется самым низким значением ИАР – 9,63 Гц, а также самым маленьким его уменьшением – до 9,45 Гц. Таким образом, получается, что полиморфизм ММ характеризуется самым высоким ИАР и до и после утомления.

Ср.знач. (ст.откл.) Центральная правая 9,43 (0,96) 9,20 (0,99) Статистический анализ ANOVA не выявил значимых изменений у полиморфизмов гена СОМТ после утомления.

полиморфизмов генов 5НТТ, DRD2 и СОМТ.

Спектральный анализ, как было описано выше, подсчитывался двумя различными способами, отражающими разные спектральные параметры.

Первый способ характеризовал относительную мощность данного диапазона по сравнению с остальными. Второй же способ отражал усредненную мощность данного диапазона. Спектральный анализ вычислялся отдельно для каждой мозговой области.

Проведенный дисперсионный анализ ANOVA выявил, что наибольшие изменения после длительной когнитивной нагрузки наблюдаются в диапазоне нижнего альфа ритма в обоих условиях (закрытыми и открытыми глазами), а также в диапазоне бета ритма в условиях с закрытыми глазами.

Дисперсионный анализ ANOVA был также проведен отдельно для носителей различных полиморфизмов генов 5НТТ, DRD2 и COMT.

полиморфизмов гена 5НТТ. Дисперсионный анализ ANOVA был проведен для групп носителей полиморфизмов гена 5НТТ: LL и LS+SS. Трехфакторная модель ANOVA для логарифмизированных данных показала, что в гене 5НТТ носители полиморфизмов значимо не отличаются между собой по мощности альфа и бета ритмов. Трехфакторная модель ANOVA для усредненных данных выявила, что носители полиморфизмов LS и SS характеризуются более сильным увеличением мощности в диапазоне нижнего альфа ритма (F(1,23)=9,13; p0,007), по сравнению с носителями LL генотипа, у которыъ тоже наблюдается значимое увеличение мощности в диапазоне нижнего альфа ритма (F(1,13)=6,30; p0,03) (рисунок 33).

Рисунок 33. Спектральные характеристики для носителей LL и LS+SS генотипов гена 5НТТ для усредненных данных в диапазоне нижнего альфа ритма (альфа1; 7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

полиморфизмов гена DRD2.Дисперсионный анализ ANOVA был проведен для групп носителей полиморфизмов гена DRD2: А1А1+А1А2 и А2А2.

Трехфакторная модель ANOVA для логарифмизированных данных не выявила значимых различий между различными полиморфизмами по мощности альфа и бета ритмов. Показано, что в диапазоне нижнего альфа ритма у носителей полиморфизма А2А2 происходит значимое увеличение мощности в обоих условиях с закрытыми (рисунок 34) и открытыми (рисунок 35) глазами (F(1,23)=5,170; p0,03), в то время как у носителей А1-аллеля наблюдается тенденция к увеличению, но не значимая. Статистический анализ ANOVA также не выявил значимых различий между носителями полиморфизмов по мощности бета ритма, но было показано, что носители полиморфизма А2А2 характеризуется значимым снижением мощности после длительной когнитивной нагрузки (F(1,25)=8,899; p0,007), тогда как у носителей А1А1 и А1А2 генотипов значимого снижения не наблюдается (рисунок 36).

Рисунок 34. Спектральные характеристики для носителей А1А1+А1А2 и А2А2генотипов гена DRD2 для логарифмизированных данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Рисунок 35. Спектральные характеристики для носителей А1А1+А1А2 и А2А2генотипов гена DRD2 для логарифмизированных данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для открытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Рисунок 36. Спектральные характеристики для носителей А1А1+А1А2 и А2А2генотипов гена DRD2 для логарифмизированных данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Трехфакторная модель ANOVA для усредненных данных выявила когнитивной нагрузки) и типа полиморфизма для диапазонов нижнего альфа ритма (F(1,29)=5,36; p0,03) (рисунок 38), альфа ритма (F(1,29)=6,68;

p0,02) (рисунок 39) и бета ритма (F(1,29)=15,90; p0,0005) (рисунок 40). Для тета ритма ANOVA не показала значимых взаимодействий, но при этом повышением мощности тета ритма после утомления (рисунок 37).

Рисунок 37. Спектральные характеристики для носителей А1А1+А1А2 и А2А2генотипов гена DRD2 для усредненных данных в диапазоне тета ритма (3,5-7,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; Рисунок 38. Спектральные характеристики для носителей А1А1+А1А2 и А2А2 генотипов гена DRD2 для усредненных данных в диапазоне нижнего альфа ритма (7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

Рисунок 39. Спектральные характеристики для носителей А1А1+А1А2 и А2А2генотипов гена DRD2 для усредненных данных в диапазоне альфа ритма (7,5-12,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; Рисунок 40. Спектральные характеристики для носителей А1А1+А1А2 и А2А2 генотипов гена DRD2 для усредненных данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; полиморфизмов гена СОМТ. Дисперсионный анализ ANOVA был проведен для групп носителей полиморфизмов гена СОМТ – ММ, MV и VV.

Трехфакторная модель ANOVA для логарифмизированных данных не выявила значимых различий между различными полиморфизмами по мощности альфа и бета ритмов. Показано, что носители полиморфизма MV характеризуются значимым увеличением мощности в диапазоне нижнего альфа ритма после когнитивной нагрузки в условиях с закрытыми глазами (F(1,21)=8,871; p0,008) (рисунок 41). У носителей MV генотипа также наблюдается тенденция к повышению мощности в диапазоне нижнего альфа ритма после утомления с открытыми глазами (F(1,21)=4,138; p0,06) (рисунок 42). У носителей ММ полиморфизма наблюдается значимое повышение мощности в диапазоне нижнего альфа ритма в условиях с открытыми глазами (F(1,4)=8,9273; p0,05). У носителей полиморфизма VV наблюдается значимое снижение мощности бета ритма после утомления в условиях с закрытыми глазами (F(1,7)=5,9416; p0,05) (рисунок 43).

относительная мощность

MM MV VV

Рисунок 41. Спектральные характеристики для носителей MM, MV и VV генотипов гена СОМТ для логарифмизированных данных в диапазоне нижнего альфа ритма (альфа1; 7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

относительная мощность

MM MV VV

Рисунок 42. Спектральные характеристики для носителей MM, MV и VV генотипов гена СОМТ для логарифмизированных данных в диапазоне нижнего альфа ритма (альфа1; 7,5-10 Гц) для открытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

MM MV VV

Рисунок 43. Спектральные характеристики для носителей MM, MV и VV генотипов гена СОМТ для логарифмизированных данных в диапазоне бета ритма (12,5-35 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; ANOVA для усредненных данных показал, что полиморфизм MV характеризуется значимым увеличением мощности в диапазонах: нижнего альфа (F(1,18)=11,87; p0,003) (рисунок 44), альфа (F(1,18)=11,15; p0,004) (рисунок 45) и бета (F(1,18)=12,01; p0,003) ритмов.

средняя мощность, мкВ2

COMT MM COMT MV COMT VV

Рисунок 44. Спектральные характеристики для носителей MM, MV и VV генотипов гена СОМТ для усредненных данных в диапазоне нижнего альфа ритма (альфа1; 7,5-10 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая височная; 6 –затылочная).

средняя мощность, мкВ

COMT MM COMT MV COMT VV

Рисунок 45. Спектральные характеристики для носителей MM, MV и VV генотипов гена СОМТ для усредненных данных в диапазоне альфа ритма (7,5-12,5 Гц) для закрытых глаз во всех мозговых областях (1 – лобная; 2 – центральная; 3 –теменная; 4 – левая височная; 5 – правая В) Индекс утомления у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

В таблице 13 (а) представлены результаты по параметру индекса утомления для носителей различных полиморфизмов гена 5НТТ (LL и LS+SS) до и после длительной когнитвной нагрузки.

Индекс утомления до и после утомления у гена 5НТТ.

Центральная левая 2,38 (1,30) 3,46 (2,74)* 3,85 (2,87) 4,25 (1,85)* Центральная правая 2,34 (1,32) 3,57 (1,88)** 3,97 (3,00) 5,25 (2,76)** Теменная левая 2,23 (1,33) 3,72 (2,73)** 4,41 (3,39) 5,76 (3,19)** Теменная правая 3,29 (2,86) 4,13 (3,16) 5,69 (4,09) 7,34 (4,25)** Височная левая 2,13 (1,14) 2,93 (1,84) 3,54 (2,51) 4,55 (2,50)** Височная правая 2,08 (1,39) 2,96 (2,79) 3,76 (2,65) 4,76 (2,76)** Затылочная левая 2,39 (1,47) 2,93 (1,86) 4,47 (3,21) 5,32 (3,04)** Затылочная правая 2,19 (1,24) 2,83 (1,83) 4,09 (2,82) 5,15 (2,66)** Ср.знач. (ст.откл.) *значимые изменения (p0.05)** значимые изменения (p0.01) характеризуются значимым увеличением индекса утомления только в цетральных и левой лобной областях, тогда как у LS+SS группы наблюдается значимое увеличение индекса утомления практически по всем областям, кроме левой лобной области.

Дисперсионный анализ ANOVA выявил значимые различия между группами носителей различных полиморфизмов гена 5НТТ (F(1,37)=6,7863;

p0,02) (рисунок 46). ANOVA показал, что носители полиморфизма LL характеризуются значимо меньшим индексом утомления, по сравнению с носителями LS и SS полиморфизмов как до, так и после утомления (F (4,148) = 2,7487; p0,03). При этом, по динамике утомления LL-носители характеризуются значимым увеличением индекса утомления в левом полушарии в центральной и теменной областях, а в правом – только в центральной области. Носители S аллеля характеризуются значимым увеличением индекса утомления во всех областях, кроме левой лобной области.

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 46. Показатели Индекса утомления у полиморфизмов гена 5НТТ – LL (а) и LS+SS (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная; 3 – В таблице 13 (б) представлены результаты по параметру индекса утомления для носителей различных полиморфизмов гена DRD2 (A2A2 и А1А1+А1А2) до и после длительной когнитвной нагрузки.

Индекс утомления до и после утомления у гена DRD2.

Лобная левая 3,72 (2,32) 4,18 (2,82) 4,65 (3,00) 5,18 (3,15) Центральная левая 2,66 (1,40) 3,27 (1,72) 3,59 (2,81) 4,36 (2,45) Центральная правая 2,78 (1,34) 4,16 (2,58)** 3,62 (2,95) 4,97 (2,57)** Теменная левая 3,37 (2,91) 4,42 (3,41) 3,66 (3,09) 5,31 (3,04)** Теменная правая 4,58 (4,17) 5,78 (5,02) 5,00 (3,90) 6,56 (3,89)** Височная левая 2,49 (1,38) 3,96 (2,74)* 3,26 (2,46) 4,10 (2,33)* Височная правая 2,97 (3,25) 3,92 (3,85)* 3,24 (2,15) 4,26 (2,70)* Затылочная левая 3,14 (2,40) 4,44 (3,88)* 3,97 (3,08) 4,62 (2,57)* Затылочная правая 3,11 (2,63) 4,38 (3,69)* 3,56 (2,58) 4,40 (2,27)* Ср.знач. (ст.откл.) *значимые изменения (p0.05)** значимые изменения (p0.01) Носители А1-аллеля характеризуются в целом большим значением индекса утомления, по сравнению с носителями А2-аллеля в фоновом состоянии. Результаты статистического анализа (Т-теста) показали, что после утомления более сильное увеличение индекса утомления наблюдается у полиморфизма А2А2. Статистический анализ ANOVA не выявил значимых различий между носителями полиморфизмов A2A2 и A1A1+A1A2 (рисунок 47).

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 47. Показатели Индекса утомления у полиморфизмов гена DRD2 – A1A1+A1A2 (а) и A2A2 (б) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная;

3 –теменная; 4 – височная; 5 –затылочная).

В таблице 13 (в) представлены результаты по параметру индекса утомления для носителей различных полиморфизмов гена СОМТ (ММ, MV и VV) до и после длительной когнитвной нагрузки.

Центральная правая 3,05 (1,60) 4,83 (1,98)* 3,19 (2,22) 4,34 (2,87)** Теменная левая 3,24 (1,99) 5,76 (3,04)* 3,41 (2,77) 4,49 (3,39)** Теменная правая 4,60 (3,20) 6,27 (3,47) 4,30 (3,49) 5,28 (4,12)* Височная правая 3,04 (1,77) 4,72 (3,41) 2,98 (2,51) 3,63 (2,86)** Затылочная левая 3,15 (1,93) 3,96 (1,86) 3,53 (2,87) 4,17 (3,28)* Затылочная правая 2,85 (1,60) 4,09 (2,06) 3,19 (2,39) 3,94 (2,82)* Ср.знач. (ст.откл.) Центральная левая 3,01 (1,26) 4,86 (2,25)* Центральная правая 2,72 (1,01) 4,71 (2,08)* Затылочная левая 3,46 (1,70) 5,07 (2,23)** Затылочная правая 3,11 (1,54) 4,74 (2,47)* Ср.знач. (ст.откл.) меньшим индексом утомления. Статистический анализ (Т-тест) выявил, что носители MV генотипа характеризуется значимым увеличением индекса утомления в теменной области, а также усредненно по всему скальпу.

Носители VV генотипа характеризуется значимым увеличением индекса утомления только в правой височной области.

утомления у всех полиморфизмов гена СОМТ после длительной когнитивной нагрузки (F(1,36)=24,14; p0,00002) (рисунок 48). ANOVA также показала гена СОМТ (F (2,36)=2,86; p0,07).

индекс утомления

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

ЛЕВОЕ ПОЛУШАРИЕ ПРАВОЕ ПОЛУШАРИЕ

Рисунок 48. Показатели Индекса утомления у полиморфизмов гена COMT – ММ (а), MV (б) и VV (в) до и после когнитивной нагрузки в правом и левом полушариях для 5 областей (1 – лобная; 2 – центральная;

3 –теменная; 4 – височная; 5 –затылочная).

Г) Фронтальная асимметрия данных ЭЭГ у носителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

В таблице 14 (a) представлены результаты по показателям фронтальной асимметрии для носителей различных полиморфизмов гена 5НТТ (LL и LS+SS) до и после когнитивной нагрузки. Статистический анализ выявил значимое уменьшение фронтальной асимметрии только у носителей LLполиморфизма после утомления в отведениях F3-F4 в условиях с закрытыми глазами.

Таблица 14(а). Коэффициенты фронтальной асимметрии до и после Закрытые глаза Открытые глаза В таблице 14 (б) представлены результаты по показателям фронтальной асимметрии для носителей различных полиморфизмов гена DRD2 (A2A2 и А1А1+А1А2) до и после когнитивной нагрузки. Статистический анализ выявил значимое увеличение фронтальной асимметрии только у носителей А2А2 полиморфизма после утомления в отведениях F7-F8 в условиях с открытыми глазами. После утомления генотип А2А2 характеризовался большим уровнем активации в левом полушарии по сравнению с фоновым состоянием.

Коэффициенты фронтальной асимметрии до и после утомления у Закрытые глаза F3-F4 -0,03(0,16) -0,12(0,16) 0,02(0,17) -0,04(0,14) Открытые глаза F3-F4 0,02(0,14) -0,06(0,16) 0,04(0,25) 0,12(0,19)* В таблице 14 (в) представлены результаты по показателям фронтальной асимметрии для носителей различных полиморфизмов гена СОМТ (ММ, MV и VV) до и после когнитивной нагрузки. Статистический анализ выявил значимые изменения показателя только у носителей полиморфизма MV в отведениях F7-F8 в условиях с закрытыми глазами. В фоновом состоянии большая мозговая активность наблюдалась левом полушарии, но после утомления большая мозговая активность начала наблюдаться в правом полушарии.

Коэффициенты фронтальной асимметрии до и после утомления у Закрытые глаза Открытые глаза Ср.знач. (ст.откл.) Закрытые глаза Открытые глаза Ср.знач. (ст.откл.) Для интеграции и подтверждения полученных результатов был электрофизиологические и генетические. Для нормировки генетических показателей была сделана шкала относительного содержания конкретного нейромедиатора (дофамина или серотонина) на основе литературных данных.

Показано, что при наличии в гене 5НТТ одного или двух S-аллелей транскрипция транспортера серотонина снижается примерно на 60%. Веса для данного гена были расставлены следующим образом: 100% для LL генотипа и 40% для SS и LS генотипов. В гене DRD2 показано, что наличие одной или двух А1-аллелей ведет к снижению плотности рецепторов на 40%.

Таким образом, для данного гена были поставлены следующие веса: 100% для А2А2 генотипа и 60% для А1А1 и А1А2 генотипов. Для гена СОМТ было показано, что у носителей М-аллеля наблюдается снижение активности фермента на 40%. И для этого гена были поставлены следующие веса: 100% для VV генотипа и 60% для ММ и МV генотипов.

На первом этапе факторного анализа было показано, что субъективные параметры вносят наименьший вклад, поэтому они были ислючены из дальнейшей обработки. Таким образом, для факторного анализа использовались следующие показатели: индекс утомления (ИУ), индивидуальный альфа ритм (ИАР), спектральные характеристики ритмов, время простой зрительно-моторной задачи и задачи выбора. Статистический анализ выявил 5 факторов, описывающих в общей сложности больше 75% дисперсии (рисунок 49; таблица 15).

В первый фактор, который описывает почти 40% дисперсии, основной вклад вносят следующие показатели: мощности бета ритмов во всех мозговых областях с положительным значением и мощности гамма ритмов с отрицательными весами (таблица 15). Также в данный фактор значительный вклад вносят мощности тета ритма в различных областях мозга с положительным весом. Относительный вклад в данный фактор вносит и ген СОМТ с положительным весом. Таким образом, можно сказать, что более высокий уровень дофамина связан с более высокой мощностью гамма ритма, а низкое содержание дофамина связано с более высокой мощностью бета и тета ритмов.

Рисунок 49. Результаты факторного анализа (по горизонтали – номер фактора; по вертикали – вес фактора).

Во второй фактор, который описывает около 14% дисперсии, основной вклад вносит ген 5НТТ и немного меньший вклад – ген DRD2, а из психофизиологических: индивидуальный альфа ритм (преимущественно в лобных и центральных отведениях), мощность верхнего альфа ритма, а также показатели ПЗМР и РВ (таблица 15). Таким образом, можно говорить, что носители генотипов LL и A2A2 характеризуются более высокой частотой индивидуального альфа ритма, более высокой мощностью верхнего альфа ритма и большим временем реакции, по сравнению с другими генотипами.

В третий фактор, описывающий около 10% дисперсии, основной вклад вносят покзатели индекса утомления.

В четвертый фактор, описывающий примерно 8,5% основной вклад вносят: индивидуальный альфа ритм в теменных и затылочных отведениях, а также мощность нижнего альфа ритма практически во всех областях (таблица 15).

В пятый фактор, описывающий около 5 % дисперсии, основной вклад вносят показатели мощности ритмов в лобной области: тета ритма с отрицательными весами, а также бета и гамма ритмов – с положительными весами (таблица 15).

Полученные результаты факторного анализа подтверждают, полученные нами результаты. Мы показали, что время реакции в ПЗМР и РВ значимо различаются у носителей различных полиморфизмов генов 5НТТ и DRD2. Мы также показали, что полиморфизмы LL и A2A2 характеризуются более высокими значениями альфа ритма. А в гене СОМТ мы показали, что полиморфизм VV характеризуется большей мощностью бета и альфа ритмов.

5НТТ DRD COMT Индекс ут.

ИАР (фронт., центр., височн.) ИАР (-‘) (темен., затыл.) ПЗМР, РВ Тета (фронт. (-‘), бета, гамма) Альфа верх. (все области) Альфа нижн., альфа (все обл.) Бета, гамма (центр, височ., затыл.), тета, гамма (-‘) 3.4. Моделирование структурными уравнениями связей между уровнем нейромедиаторов (серотонина и дофамина) и психофизологическими характеристиками при длительной когнитивной нагрузке.

Данный метод позволяет определить наиболее значимые сочетания полиморфизмов в различных генах, при которых наблюдаются наиболее сильное утомление. Для оценки причинных связей между явными и скрытыми параметрами использовался модуль SEPATH (selection of structural equation modeling techniques) программы STATISTICA. Данный модуль позволяет оценить связи между явными и скрытыми параметрами, которые могут быть экзогенными и эндогенными.

рассматривался некоторый фоновый уровень нейромедиаторов, определяемый сочатанием различных полиморфизмов в генах 5НТТ, DRD2 и COMT (в модели переменная NEURO‘). В качестве скрытых эндогенных факторов рассмативались состояния до и после нагрузки. Структурное моделирование в нашем случае проводилось для трех, наиболее значимых параметров: поведенческих реакций, индивидуального альфа ритма, индекса утомления.

Рисунок 50. Структурная модель выявления скрытых связей между уровнем нейромедиаторов (серотонина и дофамина) с Для оценки адекватности построенных моделей использовалось несколько показателей: критерий Брауна (MRC), который характеризует успешную сходимость процедуры оценивания модели при его значении равном нулю; критерии инвариантности модели (ICSF и ICS) должны иметь значения, близкие к нулю; критерий граничных значений (BC), равный нулю, свидетельствует об успешной сходимости процедуры оценивания модели;

индекс стандартизованных остатков (RMSSR) говорит о хорошем качестве подгонки модели при значении менее 0,05; стандартизованные остатки переменных. Их значения, равные или близкие к нулю, говорят об адекватности модели. Для параметра поведенческих реакций (рисунок 50) скрытые эндогенные факторы, определялись временем простой зрительномоторной реакции (ПЗМР) и реакции выбора (РВ), а также количеством ошибок. Параметр NEURO‘в данном случае определялся полиморфизмами SS+LS гена 5НТТ и A1A1+A1A2 гена DRD2, по которым были получены наиболее значимые результаты и которые, по нашей изначальной гипотезе, должны больше утомляться. Статистический анализ выявил значимую связь в данном случае между параметром NEURO‘ и генами, а также значимую связь между параметром NEURO‘ и состояниями до и после когнитивной нагрузки.

Критерии адекватности модели связей между уровнем нейромедиаторов (серотонина и дофамина) с показателями времени реакции.

При этом между фоном и нагрузкой значимых связей не наблюдалось.

Критерии адекватности модели достаточно значимые (таблица 16). Таким образом, данная модель подтверждает гипотезу о том, что определенный уровень нейротрансимиттеров значимо по-разному отражается на поведенческих реакциях и на процессы утомления он практически не влияет.

Для параметра индивидуального альфа ритма (ИАР) (рисунок 51) скрытые эндогенные факторы, определялись частотами ИАР в различных областях: теменной, левой височной, правой височной, затылочной и усредненно по всем областям. Параметр NEURO‘ в данном случае определялся полиморфизмами VV гена СОМТ и А1А1+А1А2 гена DRD2, по которым были получены наиболее значимые различия по ИАР между разными состояниями.

Рисунок 51. Структурная модель выявления скрытых связей между уровнем нейромедиаторов (серотонина и дофамина) и Критерии адекватности модели связей между уровнем нейромедиаторов (серотонина и дофамина) и индивидуальным альфа ритмом.

Статистический анализ выявил значимую связь в данном случае между параметром NEURO‘ и геном DRD2, а также значимую связь между параметром NEURO‘ и состоянием утомления после когнитивной нагрузки.

Также значимая связь наблюдается между фоном и нагрузкой. Критерии адекватности модели достаточно значимые (таблица 17). Следовательно, в данном случае можно говорить о причинно-следственных связях между низким уровнем дофамина и более высокой скоростью развития утомления, оценивающемся по снижению частоты индивидуального альфа ритма. Это означает, что при низком содержании дофамина будет происходить более сильное снижение частоты ИАР при длительной когнитивной нагрузке.

Для параметра индекса утомления (ИУ) (рисунок 52) скрытые эндогенные факторы, определялись значениями индекса утомления в различных областях: лобной, теменной, центральной и затылочной. Параметр NEURO‘ в данном случае определялся полиморфизмами МV гена СОМТ, А2А2 гена DRD2 и SS+SL гена 5НТТ, по которым были получены наиболее значимые изменения после длительной когнитивной нагрузки.

Статистический анализ выявил значимую связь в данном случае между параметром NEURO‘ и генами DRD2 и СОМТ, с геном 5НТТ показана связь на уровне тенденции (р=0,08). Также показана значимая связь между фоновым состоянием и утомлением. Однако не было показано связи между параметром NEURO‘ и состоянием утомления после когнитивной нагрузки.

Критерии адекватности модели относительно нормальные (таблица 18).

Таким образом, данная модель показывает, что индекс утомления является хорошим индикатором состояния утомления и что он связан с определенным уровнем нейромедиаторов в мозге: при высоком уровне серотонина и дофамина наблюдается более значимое изменение данного параметра.

Рисунок 52. Структурная модель выявления скрытых связей между уровнем нейромедиаторов (серотонина и дофамина) и индексом Критерии адекватности модели связей между уровнем нейромедиаторов (серотонина и дофамина) и индексом утомления.

Суммируя данные результаты, можно подвести некоторый итог. В нашем исследовании мы получили, что наиболее сильное утомление наблюдается в двух вариантах и характеризуется при этом изменением различных параметров:

высокий уровень серотонина и низкий уровень дофамина;

высокий уровень серотонина и высокий уровень дофамина.

II.

В первом случае основные изменения проявляются в снижении индивидуального альфа ритма (ИАР), но сами испытуемые при этом характеризуются более высокой скоростью реакции. Во втором случае мы получили, что основные изменения наблюдаются в увеличении мощности медленных ритмов. Таким образом, наиболее оптимальный вариант, при котором процессы утомления выражены наименее: низкий уровень серотонина и средний уровень дофамина.

ГЛАВА 4. ОБСУЖДЕНИЕ РЕЗУЛЬТАТОВ

Когнитивное утомление очень сложный феномен, отражающийся в целом комплексе психологических и физиологических параметров. Целью психофизиологические изменения в процессе когнитивного утомления, вызванного непрерывным решением в течение почти трех часов когнитивных заданий, а также посмотреть, как меняются эти параметры у разных полиморфизмов генов 5НТТ, DRD2 и СОМТ. Таким образом, наше исследование состояло из двух частей. Целью первой части исследования было поиск комплекса параметров, отражающих сдвиги функционального состояния в процессе утомления. Целью второй части исследования было посмотреть, как этот комплекс параметров изменяется у представителей различных полиморфизмов генов 5НТТ, DRD2 и СОМТ.

4.1. Обсуждение результатов по субъективным, поведенческим и ЭЭГ данным по всей выборке.

4.1.1. Обсуждение субъективных и поведенческих результатов В субъективном состоянии после длительной когнитивной нагрузки отмечается снижение показателей по шкалам самочувствие и активность.

Многие авторы отмечают, что после длительной когнитивной деятельности испытуемые себя чувствуют намного хуже, чем до нее (Wijesuriya et al., 2007). Так, Трейо обнаружил, что после трех часов арифметических задач субъективная оценка по шкалам энергичность и спокойствие значимо снижаются, а значение по шкале усталость – значимо возрастает (Trejo et al., 2005).

В поведенческих реакциях было обнаружено значимое снижение скорости в простой зрительно-моторной реакции (ПЗМР), что может свидетельствовать о том, что испытуемые испытывали состояние утомления.

одновременным увеличением количества ошибок. Это может также говорить о том, что испытуемые испытывали утомление и, пытаясь сохранить высокую скорость выполнения задания, они жертвовали точностью его выполнения.

Различные исследования показали уменьшение скорости в ПЗМР с развитием умственного утомления (Lorist et al., 2000; Trejo et al., 2005; Boksem et al., 2006), а также увеличение скорости в РВ, которое обычно ассоциируется с увеличением количества ошибок. Данный феномен был назван в литературе Speed-accuracy tradeoff (Jennings,1976; Wickelgren, 1977; Sternberg, 2004).

комфортного теппинга, что может свидетельствовать о снижении функционального состояния, при этом максимальный теппинг практически не изменяется. Родригесом было показано, что изменения в максимальном теппинге имеет центрльное происхождение (Rodrigues, 2009). Таким образом, в нашем исследовании мы, с одной стороны, подтверждаем уже полученные данные относительной динамики времени реакции при утомлении, а с другой стороны, - показываем, что наибольшие изменения времени реакции наблюдаются в задачах, требующих когнитивного контроля. Это означает, что умственное утомление влияет в первую очередь на снижение когнитивных ресурсов, а не на активность мотонейронов и сократительные возможности мышц.

4.1.2. Обсуждение ЭЭГ результатов.

А) Индивидуальный альфа ритм В настоящем исследовании было показано, что длительная когнитивная нагрузка отражается в уменьшении индивидуального альфа ритма (ИАР), но значимое уменьшение наблюдается только в правом полушарии (ANOVA), Т-тест показал значимое снижение ИАР в теменной, височной и затылочной областях.

Некоторыми авторами было показано, что во время когнитивной нагрузки происходит увеличение индивидуальной частоты альфа ритма, причем, чем сильнее умственная нагрузка – тем сильнее будет увеличение ИАР (Knott, 1938; Osaka, 1984). Также было показано, что во время выполнения когнитивных заданий наблюдается снижение мощности альфа ритма (Glass et al., 1970; Osaka, 1984). Различные исследования показывают, что пик альфа ритма положительно коррелирует с различными когнитивными функциями – вниманием, памятью, скоростью протекания информационных процессов (Klimesh, 1999; Angealakis, 2004). ИАР больше возрастает в правом полушарии при выполнении зрительных заданий и больше в левом при выполнении арифметических заданий (Angealakis, 2004).

При длительном выполнении когнитивных заданий многие авторы, наоборот, отмечают снижение индивидуальной частоты альфа ритма (Angelakis, 2004; Klimesh, 1999) и увеличение мощности медленных ритмов (альфа и тета ритмов) (Boksmen et al., 2005; Jap, 2009; Cheng, 2011, Trejo et al., 2005, Lol et al., 2007). Джап и Лэл показали, что при длительной когнитивной нагрузке происходит смещение индивидуальной частоты альфа ритма и общей мощности спектра в сторону медленных частот (Jap, 2009; Lаl et al., 2007). Климеш показал, что испытуемые с высокими мнестическими характеризуются частотой альфа пика в среднем на 1 Гц большей по сравнению с контрольной группой (Klimesh, 1996, 1997). Испытуемые со сниженными мнестическими способностями характеризуются снижением пика альфа ритма во время выполнения заданий на память, а испытуемые с высокими мнестическими способностями характеризуются стабильностью пика альфа ритма в различных условиях (Klimesh, 1993). Нг и Равендран показали, что снижение ИАР происходит также после физического утомления и преимущественно в центральных областях (Ng et al., 2007).

Многими авторами было показано снижение частоты индивидуального альфа ритма в состоянии утомления (Jap, 2009; Lol et al., 2007).

Исходя из полученных нами данных, следует вывод, что процессы утомления, измеряемые по динамике индивидуального альфа ритма, выражены по-разному в левом и правом полушариях. Процессы утомления сильнее выражены в правом полушарии (у правшей) преимущественно в теменных и височных областях, а также височных.

Б) Спектральный анализ данных ЭЭГ В нашем исследовании мы показали, что когнитивное утомление отражается в изменении мощности почти во всех диапазонах. Наибольшие изменения наблюдаются в тета, альфа (преимущественно в поддиапазоне нижнего альфа) и бета диапазонах.

Спектральный анализ ЭЭГ в диапазоне тета ритма.В диапазоне тета ритма (3,5-7,5 Гц) мы получили значимое увеличение средней мощности после утомления в условиях с закрытыми глазами. Это согласуется с многочисленными данными, описанными в литературе, которые также подтверждают увеличение мощности тета ритма после длительной когнитивной нагрузки, которое в основном наблюдаются в лобных областях (Boksmen et al., 2005; Jap, 2009; Cheng, 2011, Trejo et al., 2005, Lol et al., 2007).

В нашем исследовании наибольшая мощность тета ритма наблюдалась в теменной области и по усредненным данным и по логифмизированным данным. В большинстве случаев среднелобный тета ритм регистрируется с максимумом в Fz, но иногда и в Pz (Кропотов, 2010). В исследованиях с использованием МЭГ было показано, что существует два основных источника тета ритма – префронтальная средняя поверхность коры и передняя поясная извилина (Asada, 1999). В одном из исследований было ассоциирована с самым низким уровнем тревожности и невротизации и самым высоким уровнем экстраверсии (Inanaga, 1998). Среднелобный тета ритм также связан с активацией и уровнем метаболизма в средней лобной и передней поясной извилине (Кропотов, 2010).

Среднелобный тета ритм у человека очень часто связывают с гиппокампальной тета активностью. Согласно Кропотову (Кропотов, 2010) тета ритм вознивает в стволе мозга, нейроны которого передают возбуждение норадренергическим клеткам в голубом пятне, серотонинергическим клеткам в ядрах шва, дафаминергическим клеткам в передней части покрышки и компактной части черной субстанции. Эти клетки могут активироваться либо напрямую от коллатералей нейронов, либо через обратные проекции от коры и в таком случае это ведет к активации клеток в ядрах перегородки в основании переднего мозга. Активация этих ядер приводит к вспышкам тета ритма.

Ряд исследователей показал, что после умственного утомления наблюдается значимое увеличение мощности альфа и тета ритмов. В нашем исследовании мы также показали значимое увеличение средней мощности тета ритма после трех часов умственной нагрузки по всем областям мозга.

Буксем показал, что мощность тета ритма после умственного утомления была больше в лобных срединных электродах, мощность нижнего альфа ритма была больше в теменных областях, а высокого альфа ритма была выше в затылочных электродах, а бета ритм был выше в лобной области (F3, F4) (Boksmen et al., 2005).

утомления (в условиях вождения) происходит увеличение мощности тета ритма и снижение мощности бета ритма. В ее исследовании данные были усреднены по 19 каналам (Lol et al., 2007).

Таким образом, результаты нашего исследования в целом согласуются с литературными данными, однако, мы показали, что наибольшие измения в тета диапазоне наблюдаются в центральных и теменных областях.

Спектральный анализ ЭЭГ в диапазоне альфа ритма. В спектре альфа ритма в нашем исследовании мы получили наиболее значимые результаты в поддиапазоне нижнего альфа ритма (7,5 – 10 Гц). Было показано, что на этих частотах наблюдается самое сильное увеличение мощности после утомления, причем как средней мощности, так и относительной мощности. В поддиапазоне верхнего альфа ритма было также показано значимое увеличение мощности, но гораздо слабее, чем в нижнем альфа поддиапазоне.

В целом альфа диапазоне в целом было показано также значимое увеличение мощности после утомления, но, как мы сказали раньше, основной вклад в это увеличение был сделан за счет увеличения мощности нижнего альфа ритма.

Максимум средней мощности в поддиапазоне нижнего альфа наблюдался в теменной и в затылочной областях. А максимум относительной мощности наблюдаются в теменной и затылочных областях. Эти результаты соответствуют данным, полученным Буксеном (Boksmen et al., 2005), который показал, что после длительной когнитивной нагрузки происходит увеличение мощностей нижнего и верхнего альфа ритмов. При этом, однако, мощность нижнего альфа ритма была выше в теменной области, а мощность верхнего – в затылочной.

В целом, полученные результаты соответствуют литературным данным, согласно которым считается, что максимальный альфа ритм регистрируется в затылочных и теменых областях при закрытых глазах (Кропотов, 2010;

Голубева, 2005). В ряде работ было также показано увеличение мощности альфа ритма при умственном утомлении (Boksmen et al., 2005; Trejo et al., 2005, Jap, 2009). Хотя некоторые авторы отмечают уменьшение мощности альфа ритма после длительной когнитивной нагрузки (Lol et al., 2007, Cheng, 2011). Климеш считает, что снижение мощности альфа ритма после когнитивной нагрузки, например, после арифметических задач происходит из-за того, что такая деятельность требует задействования рабочей памяти, что в свою очередь приводит к подавлению альфа ритма на ЭЭГ (Klimesh, 1997).

Эдрианом и Метьюзом была выдвинута гипотеза, согласно которой разные сенсорные области мозга имеют собственные альфа-ритмы, которые представляют собой ритмы «холостого хода», преобладающие в ЭЭГ человека в спокойном состоянии (Кропотов, 2010). В настоящее время принято выделять несколько типов альфа-ритма: сенсомоторный, или мюритм, затылочный альфа ритм, теменной альфа-ритм. Считается, что они независимы друг от друга (Кропотов, 2010). Сенсомоторный ритм регистрируется обычно в центральных отведениях (С3, С4), которые расположены над сенсо-моторными участками коры. Мю-ритм обычно блокируются при движении соответствующей рукой или прикосновением к ней. Во время расслабления, наоборот, наблюдается его увеличение.

Сенсомоторный ритм наблюдается в обоих полушариях, но считается, что его генераторы независимы. Затылочный альфа-ритм представляет собой высокоамплитудные колебания, регистрирующиеся в затылочных отведениях (О1 и О2). На спектральном анализе он имеет вид острого пика. Мощность затылочного альфа ритма значительно увеличивается при закрывании глаз.

Теменной альфа ритм представляет собой также высокоамплитудные колебания в диапазоне альфа ритма с максимумом в теменных отведениях (Рz). Теменной альфа ритм может присутствовать одновременно с затылочным, но считается, что они независимы (Кропотов, 2010). Суммарная мощность теменных ритмов увеличивается с возрастанием сложности задачи.

Возникновение альфа ритмов конролируется активностью таламуса, который играет доминирующую роль в управлении информационными процессами от рецепторов к сенсорным областям коры. Помимо контроля за информационными процессами, таламус также принимает участие в модуляции информационного потока в ассоциативные, моторные и эмоциональные корковые области. Активация таламо-корковых нейронов передается в корковые нейроны через таламо-корковые пути.

Существует три основных таламических генератора альфа-ритма.

Одним из них является заднее вентральное ядро таламуса, которое связано с сенсомоторным ритмом. Он генерируется в постцентральной борозде теменной доли, соответствующей первичной соматосенсорной коре, которая получает проекции от заднего вентрального ядра таламуса (Кропотов, 2010).

Другим таламическим генератором является шпорная борозда, в которой генерируется затылочный альфа ритм. Шпорная борозда относится к первичной зрительной коре, которая получает проекции от бокового коленчатого тела. Третий таламический генератор, в котором генерируется таламический альфа ритм расположен в 7 поле Бродмана, области, которая получает проекции от подушки таламуса.

По данным фМРТ было показано, что синхронизации альфа ритма отрицательно коррелирует с метаболической активностью (по Голубевой, 2005). Таким образом, возникновение альфа ритмов в определенных сенсорных областях мозга может говорить о замедлении обработки сенсорной информации. В исследовании Эргеноглу (Ergenoglu, 2004) испытуемым предъявляли стимулы на пороговом уровне (50% опознания), было показано, что перед обнаруженными стимулами относительная мощность альфа ритма была значимо ниже, чем перед необнаруженными.

Таким образом, увеличение мощности альфа ритма может говорить о снижении метаболических процессов и замедлении обработки сенсорной информации, что в свою очередь может отражаться на замедлении скорости реакции, показанное нами в ПЗМР, и ухудшении эффективности выполнения РВ. При этом интересно, что в максимальном теппинге, который отражает чисто моторный компонент – замедления не происходит.

Корреляционный анализ между временем реакции в ПЗМР и РВ и средней мощностью в нижнем альфа диапазоне показал значимые результаты для РВ в условии после умственной нагрузки. Значимые положительные корреляции были найдены для РВ и мощности нижнего альфа ритма в лобном отведении (0,42; р0,022), центральном (0,38; р0,04) и теменном (0,44; р0,016). Для РВ также была найдена значимая корреляция в альфа диапазоне в теменной области (0,38; р0,020). При этом количество ошибок с мощностью альфа ритма не коррелировало. Таким образом, уменьшение времени реакции в РВ коррелирует с увеличением средней мощности альфа ритма, что согласуется с литературными данными и говорит о снижении метаболической активности мозга.



Pages:     | 1 || 3 | 4 |
 


Похожие работы:

«НАУМОВА ВАЛЕНТИНА АЛЕКСАНДРОВНА ОПТИМИЗАЦИЯ ЛИЧНОСТНЫХ РЕСУРСОВ НА ЭТАПЕ ПОЗДНЕЙ ЗРЕЛОСТИ Специальность: 19.00.13 – Психология развития, акмеология (психологические наук и) Диссертация на соискание ученой степени кандидата психологических наук Научный руководитель : доктор психологических наук, профессор Глозман Жанна Марковна Петропавловск-Камчатский – СОДЕРЖАНИЕ ВВЕДЕНИЕ.. ГЛАВА...»

«Кригер Евгения Эвальдовна ПСИХОЛОГИЧЕСКОЕ СОДЕРЖАНИЕ И УСЛОВИЯ РАЗВИВАЮЩЕГО ПРОФЕССИОНАЛЬНОГО ПЕДАГОГИЧЕСКОГО ОБРАЗОВАНИЯ Специальность 19.00.07 Диссертация на соискание ученой степени доктора психологических наук Научный консультант д.пс.н., профессор Кравцова Елена Евгеньевна Москва - СОДЕРЖАНИЕ:...»

«Девятко Дина Викторовна Условия и механизмы иллюзий зрительного исчезновения Специальность 19.00.01 – Общая психология, психология личности, история психологии Диссертация на соискание ученой степени кандидата психологических наук Научный руководитель доктор психологических наук, профессор, член-корреспондент РАО Братусь Б. С. Москва – 2012 ВВЕДЕНИЕ ГЛАВА 1. ИССЛЕДОВАНИЯ УСЛОВИЙ И МЕХАНИЗМОВ...»

«Овсяник Ольга Александровна Социально-психологической адаптации женщин второго периода взрослости Специальность 19.00.05 – Социальная психология Диссертация на соискание ученой степени доктора психологических наук Научный консультант : доктор психологических наук, профессор Базаров Тахир Юсупович Москва - 2013 Содержание Введение.....»

«Новикова Мария Александровна САМООЦЕНКА ИНТЕЛЛЕКТА В СВЯЗЯХ С ФАКТОРАМИ ПРИНЯТИЯ НЕОПРЕДЕЛЕННОСТИ (У СТУДЕНТОВ ВУЗОВ) Специальность 19.00.01 – Общая психология, психология личности, история психологии ДИССЕРТАЦИЯ на соискание ученой степени кандидата психологических наук Научный руководитель : доктор психологических наук, профессор Корнилова Т.В. Москва - Содержание Введение.... Глава 1....»

«Кулешова Ксения Владимировна НАПРАВЛЕНИЯ И ФАКТОРЫ РАЗВИТИЯ ЖЕНСКОЙ ЛИЧНОСТИ В ПЕРИОД БЕРЕМЕННОСТИ Специальность 19.00.13 – Психология развития, акмеология (психологические наук и) Диссертация на соискание ученой степени кандидата психологических наук Зинченко Юрий Петрович – член-корр. РАО, доктор психологических наук, профессор, зав. кафедрой методологии факультета психологии ФГБОУ ВПО МГУ имени М.В. Ломоносова Москва – 2013 1 ОГЛАВЛЕНИЕ Введение. Глава 1. Концептуальные...»







 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.