WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 |

«ХАРАКТЕРИСТИКА ПОЧВЕННЫХ МИКРООРГАНИЗМОВ, ТРАНСФОРМИРУЮЩИХ АРОМАТИЧЕСКИЕ АМИДЫ И НИТРИЛЫ ...»

-- [ Страница 1 ] --

РОССИЙСКАЯ АКАДЕМИЯ НАУК

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ УЧРЕЖДЕНИЕ НАУКИ

ИНСТИТУТ ЭКОЛОГИИ И ГЕНЕТИКИ МИКРООРГАНИЗМОВ

УРАЛЬСКОГО ОТДЕЛЕНИЯ РОССИЙСКОЙ АКАДЕМИИ НАУК

На правах рукописи

Луговская Надежда Петровна

ХАРАКТЕРИСТИКА ПОЧВЕННЫХ МИКРООРГАНИЗМОВ,

ТРАНСФОРМИРУЮЩИХ АРОМАТИЧЕСКИЕ АМИДЫ И НИТРИЛЫ

03.02.03 Микробиология Диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель:

кандидат биологических наук, доцент Максимов А.Ю.

Пермь –

ОГЛАВЛЕНИЕ

ВВЕДЕНИЕ

Ароматические амиды и нитрилы

1.1.

Биотрансформация ароматических амидов и нитрилов

1.2.

Типы метаболизма ароматических соединений

1.3.

Ферменты, участвующие в преобразовании нитрилов и амидов......... 1.4.

Биотрансформация бензамида

1.5.

Биотрансформация бензонитрила

1.6.

Энантиоселективная биотрансформация ароматических амидов и 1.7.

нитрилов

Энантиоселективный гидролиз ибупрофенамида

1.8.

Энантиоселектвный гидролиз N-ацетил- 2,3-дигидро-7,8-дифтор-3метил-4H-1,4-бензоксазина

ГЛАВА 2. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Объекты исследования

2.2. Среды и субстраты для культивирования

2.3. Селекция штаммов-деструкторов ароматических амидов и нитрилов... 2.4. Определение ростовых характеристик

2.5. Определение ферментативной активности

2.6. Изучение влияния температуры и рН на удельную активность фермента

2.7. Идентификация выделенных культур

2.8. Выделение ДНК и полимеразная цепная реакция

2.9. Секвенирование ДНК

2.11. Гидролиз ибупрофенамида

2.12. Гидролиз 2,3-дигидро-7,8-дифтор-3-метил-4H-1,4-бензоксазина (N – aцетилдифторбензоксазина)

2.13. Статистическая обработка





ГЛАВА 3. ИЗУЧЕНИЕ БИОЛОГИЧЕСКОГО РАЗНООБРАЗИЯ

МИКРООРГАНИЗМОВ ПОЧВ И ДОННЫХ ОТЛОЖЕНИЙ,

ТРАНСФОРМИРУЮЩИХ АРОМАТИЧЕСКИЕ АМИДЫ И НИТРИЛЫ...... 3.1. Изучение количества и соотношения гетеротротрофных аэробных бактерий почв и донных отложений

3.2. Отбор культур, активно трансформирующих ароматические амиды и нитрилы

3.3. Идентификация активных штаммов

3.4. Анализ генов метаболизма амидов и нитрилов у исследуемых бактерий.

3.5. Скрининг изолятов почвенных грибов, утилизирующих нитрилы и амиды.

ГЛАВА 4. БИОТРАНСФОРМАЦИЯ АРОМАТИЧЕСКИХ АМИДОВ И

НИТРИЛОВ

4.1. Изучение влияния состава среды на рост и активность бактерий........... 4.2. Изучение активности ферментов в процессе роста культуры................. 4.3. Определение температурной и рН-зависимости амидазной активности 4.4. Биотрансформация бензамида

4.5. Биотрансформация амида ибупрофена

4.6. Биотрансформация N-амида: N – aцетил-7,8-дифтор-2,3-дигидро-3метил-4H-1,4-бензоксазина

ЗАКЛЮЧЕНИЕ

ВЫВОДЫ

СПИСОК ЛИТЕРАТУРЫ

ВВЕДЕНИЕ

Актуальность проблемы Ароматические амиды и нитрилы являются сложными субстратами для микроорганизмов (Нестеров, 1991). Это разнообразная и, как правило, токсичная и устойчивая к биодеградации и биотрансформации категория неприродных соединений, которые используются как мономеры и полупродукты для синтеза полимеров и красителей, как взрывчатые вещества и компоненты ракетного топлива, а также в качестве детергентов, растворителей, пестицидов, лекарственных веществ (Хоменков, 2008). Чем сложнее структура молекулы, тем меньшее число видов или даже штаммов микроорганизмов способно к ее утилизации (Карасевич, 1982). Источниками азотсодержащих ароматических соединений являются также нефтяная, угольная, деревообрабатывающая промышленности, выхлопы автотранспорта (Форстер, Вейз 1990).

В живом мире каждая химическая реакция катализируется своим ферментом (Quax, 2006). Вследствие универсальности и стабильности, одинаковые ферменты могут быть использованы в совершенно разных частях промышленных процессов (Brady et al., 2006). В последнее время исследования направлены на поиск более жизнеспособных и экологически чистых биокаталитических процессов (Patel, 2005).

энантиоселективности (Vink et al., 2006), что позволяет использовать их в фармацевтической промышленности для биокаталитического синтеза лекарственных препаратов (Alcntara et al., 2000). Преимущество биокатализа над химическим синтезом заключается в том, что катализирует реакцию фермент, в результате чего образуется оптически чистый продукт. Такие реакции протекают при нормальной температуре и давлении, что позволяет избежать более экстремальных условий, которые в свою очередь могут привести к проблемам изомеризации, рацемизации и реорганизации (Patel, 2005; Wang, 2005; Yeom et al., 2007). Биокаталитические процессы, как правило, осуществляется в водном растворе. Это позволяет избежать использования экологически вредных химических веществ, используемых в химических процессах (Patel, 2000; D’Arrigo, 2000).





2-арилпропионамиды и 2-арилпропионитрилы активно используются в качестве субстратов для стереоселективных нитрилконвертирующих ферментов, потому что кислотные продукты, известные также как профены, представляют важный класс противоспалительных препаратов с активным (S)-изомером (Sonawane et al., 1992). Также актуальным направлением является получение интермедиатов синтеза фторхинолонов, таких как левофлоксацин, одним из которых является (S)-7,8-дифтор-2,3-дигидро-3метил-4Н-1,4-бензоксазин (Miyadera, Imura, 1999).

В связи с этим поиск и изучение ферментных систем, разработка биокаталитических технологий являются перспективными для биотехнологии и фармакологии.

Цель настоящего исследования – выделение и характеристика почвенных микроорганизмов, активно метаболизирующих ароматические амиды и нитрилы.

Основные задачи исследования:

1) Исследовать биологическое разнообразие гетеротрофных аэробных микроорганизмов почв таёжной и степной зоны.

метаболизма нитрилов (нитрилазный и/или нитрилгидратазно-амидазный).

ароматических амидов и нитрилов.

биотрансформации амида ибупрофена и N-ацетил-7,8-дифтор-2,3-дигидро-3метил-4H-1,4-бензоксазина.

Состояние вопроса Биокаталитический гидролиз нитрилов проходит по двум различным путям: одностадийный гидролиз до соответствующих карбоновых кислот с выходом аммиака с помощью фермента нитрилазы (КФ 3.5.5.1) и двустадийный, при котором нитрил с помощью нитрилгидратазы (КФ 4.2.1.84) гидролизуется до амида и далее амидазой (КФ 3.5.1.4) до кислоты (Amarant et al., 1989; Wang, 2005).

Первые исследования нитрилконвертирующих ферментов касались нитрилазы растений, которая катализировала гидролиз индол-3-ацетонитрила до индол-3-уксусной кислоты (Thimann, Mahadevan, 1964). На сегодняшний день различные нитрил-амид конвертирующие ферменты выделены и описаны из бактерий, грибов и растений. Производство акриламида и никотиновой кислоты в промышленных масштабах доказало коммерческую значимость этих ферментов (Chen et al., 2009).

В результате многих исследований было показано, что большинство нитрилгидролизующих микроорганизмов имеют либо нитрилазу, либо нитрилгидратазу и амидазу (Banerjee et al., 2002; Wang, 2005; Martinkova et al., 2009). Некоторые микроорганизмы, такие как Rhodococcus rhodochrous LL 100-21 и и Rhodococcus rhodochrous J1 содержат как нитрилазу так и нитрилгидратазу/амидазу.

До 1998 года были исследованы нитрилконвертирующие ферменты только мезофильных видов микроорганизмов, но Cramp и коллеги описали несколько умеренно термофильных видов Bacillus (Cramp et al., 1997) (табл. 1).

Виды и штаммы мезофильных и умеренно термофильных микроорганизмов, имеющих нитрилконвертирующие ферменты Pseudomonas fluorescens NCIMB11764 Kunz et al., специфичность, которая является важной характеристикой для их применения в качестве промышленных биокатализаторов. В настоящее время все больше исследований показывают стереоселективность нитрилгидратаз. Как правило, в дву-ферментном каскаде конверсии нитрилов в соответствующие кислоты амидаза имеет более высокую энантиоселективность (Shen et al., 2012; Choi et al., 2008; Wang et al., 2010; Trott et al., 2002; Chen et al., 2009). Wieser и Nagasawa описали энантиоселективную нитрилгидратазу, где амидаза была ингибирована. Эта нитрилгидратаза была выделена из Pseudomonas putida NRRL18668 (Wieser, Nagasawa, 2000). Также энантиоселективная нитрилгидратаза была выделена и описана из следующих видов: P. putida 5B (гидролиз 2-(4-хлорфенил)-3-метилбутиронитрила) (Fallon et al., 1997), Agrobacterium tumefaciens d3 (2-фенилпропионитрил, 2-фенилбутиронитрил, кетопрофен нитрил) (Bauer et al., 1998), Rhodococcus erythropolis AJ270 (2фенилбутиронитрил (Wang, 2005), 3-бензоилоксипентадинитрил (Song et al., 2007), напроксен нитрил (Van Pelt et al., 2011)), Rhodococcus equi A4 (2-(4метоксифенил)-3-пропионитрил, 2-(4—хлорфенил)-3-пропионитрил) (Pepechalov et al., 2001).

катализируемые этими амидазами, идут с получением фармацевтически значимых оптически чистых соединений, таких как аминокислоты или 2арилпропионовые кислоты. Таким образом, они вызывают значительный интерес. Амидазы сосуществуют с нитрилгидратазами, но в реакциях с образованием оптически активных кислот нитрилгидратаза проявляет плохую селективность, а амидаза – превосходную. Несмотря на универсальность амидаз, их применение в больших промышленных масштабах осталось неисследовано (Chen et al., 2009).

Brevibacterium sp. R312, культивируемая на ацетонитриле как источнике азота, имеет две амидазы: нестереоселективную амидогидролазу широкого спектра и энантиоселективную -аминоамидазу. Эта -аминоамидаза была использована для получения оптически активной L--аминокислоты из рацемического -аминонитрила и -аминоамида (Wieser, Nagasawa, 2000).

Несколько (S)-2-фенилпропионовых кислот были получены с высокой энантиомерной чистотой, выходом и продукцией (100 г/л) из рацемического нитрила при комбинированном действии неспецифической нитрилгидратазой и (S)-специфической амидазой, используя клетки штамма R. equi TG 328, который был культивирован на 2-метилбутиронитриле как источнике азота (Gilligan et al., 1993). Comamonas acidovorans KPO 2771-4 использовал (R)кетопрофен амид (2-(3’-бензофенил)-пропионамид) в качестве единственного источника азота, тогда как (S)-кетопрофен амид оставался в реакционной среде. (R)-специфичная мономерная амидаза показывает гомологию последовательностей с амидазами Rhodococcus sp., R. rhodochrous J1, Rhodococcus N-774, Brevibabcterium sp. R312, и Pseudomonas chloraphis B (Nagasawa, Yamada, 1990). Энантиоселективная амидаза из R. erythropolis MP 50, которая характеризуется как фермент широкого спектра с необычной гомооктомерной структурой, была использована в стереоселективной конверсии рацемического 2-фенилпропионамида и напроксен амида до соответствующих кислот с энантиомерным избытком более чем 99% и 50% конверсией. Фермент также гидролизовал различные -амино амиды, но без значительной энантиоселективности (Bauer et al., 1994).

Энантиоселективная нитрилаза катализировала гидролиз (R, S)манделонитрила с использованием покоящихся клеток Alcaligenes faecalis ATCC 8750.

полусинтетического цефалоспорина) составил 91% (Yamamoto et al., 1991).

Биоконверсия рацемического манделонитрила с использованием селективной нитрилазы была расширена для промышленного получения энантиомерно чистой (R)-миндальной кислоты и (R)-3-хлорминдальной кислоты компанией Mitsubishi Rayon. Эта компания описала несколько стереоселективных нитрилаз из ряда микроорганизмов (Rhodococcus, Acinetobacter, Caseobacter, Aureobacterium, Alcaligenes, Pseudomonas, Nocardia, Gordona, Brevibacterium) (Wieser, Nagasawa, 2000). (S)-ибупрофен был получен покоящимися клетками Acinetobacter sp.AK 226. (S)-специфическая нитрилаза была очищена и охарактеризована как типичный фермент высокой молекулярной массой кДа (Yamamoto, Komatsu, 1991).

Авторами Snell D. и Colby J. было доказано, что штамм Rhodococcus AJ270 осуществляет частичный гидролиз 1,5 мМ ибупрофенамида при 30С в течение 2,5 часов. Полный гидролиз был описан при концентрации ибупрофенамида 0,25 мМ в течение 17 часов при 30С. При этом образуется S-изомер, и выход продукта составляет более 89.9% (Snell, Colby, 1999).

Miyadera А. и Imura А. сообщили об эффективном энантиоселективном микробиологическом гидролизе N-ацетил-3,4-дигидро-7,8-дифтор-3-метилH-1,4-бензоксазина в присутствии микроорганизмов рода Bacillius, в результате которого был получен (S)-амин (интермедиат в синтезе левофлоксацина) с высокой энантиомерной чистотой 99% (Miyadera, Imura, 1999).

относительно недавно – в начале 1990-х гг. (Martinkova, Kren, 2002), поэтому поиск и изучение новых ферментных систем является перспективным направлением биотехнологии.

Научная новизна Впервые проведен сравнительный анализ содержания культивируемых гетеротрофных бактерий и изолятов, трансформирующих ароматические амиды и нитрилы, и установлены их соотношения в почвах таёжной и степной зоны России и донных отложениях.

Установлено, что почвенные плесневые грибы, выделяемые на среде с амидами и нитрилами, проявляют высокую бензонитрилазную активность и способны к полной утилизации этих соединений.

Определены оптимальные условия, обеспечивающие эффективную биотрансформацию амида ибупрофена с выходом S-энантиомера более 95%, в частности, установлено, что максимальный выход ибупрофена наблюдается при рН 8,3. Впервые селекционированы культуры актинобактерий рода Rhodococcus, катализирующие реакцию биотрансформации N-ацетильных производных бензоксазина (7,8-дифтор-2,3-дигидро-3-метил-4H-1,4бензоксазина) с энантиомерным избытком от 98 до 100%.

Теоретическое и практическое значение работы.

Рельтаты диссертационной работы расширяют представления о процессах битрансформации ароматических амидов и нитрилов. Исследовано биологическое разнообразие микроорганизмов естественных почв таёжной и степной зоны России (поверхностно-подзолистая супесчаная, донные речные отложения, дерново-карбонатная, дерново-луговая глеевая почвы, солодь, каштановая почва степной зоны, солончак, грунт 2 м от солеотвала, ил с трансформирующие ароматические амиды и нитрилы, перспективные для предшественников фармакологических препаратов (ибупрофена, левофлоксацина).

«Промышленная микробиология», «Введение в биотехнологию» для студентов Пермского государственного национального исследовательского университета.

Основные положения, выносимые на защиту:

Амидтрансформирующие бактерии составляют до 48% от общего микроорганизмов. Среди активных культур преобладают представители родов бактерий Rhodococcus, Pseudomonas, Agrobacterium, Acinetobacter и грибов Fusarium.

Культуры почвенных плесневых грибов, выделяемые на среде с амидами и нитрилами, проявляют высокую бензонитрилазную активность и способны к полной утилизации этих соединений.

биотрансформации ароматических амидов, преобладают штаммы, содержащие гены амидаз, гомологичных ферменту из R. rhodochrous N-774 и Fe- зависимой нитрилгидратазы.

Штаммы актинобактерий, активно гидролизующие ароматические амиды, обладают способностью к энантиоселективной трансформации с высоким энантиомерным избытком.

диссертационной работы доложены и обсуждены на V молодежной школеконференции с международным участием "Актуальные аспекты современной микробиологии" (Москва, 2009), II Всероссийском с международным участием конгрессе студентов и аспирантов-биологов: "Симбиоз Россия 2009" (Пермь, 2009), XIII ежегодном симпозиуме студентов-биологов Европы «Symbiose 2009» (Казань, 2009), VII Международной конференции «Современное состояние и перспективы развития микробиологии и биотехнологии» (Минск, 2010), III Всероссийском с международным участием конгрессе студентов и аспирантов-биологов: "Симбиоз Россия 2010" (Н. Новгород, 2010), VI молодежной школе-конференции с микробиологии" (Москва, 2010), IV Всероссийском с международным участием конгрессе студентов и аспирантов-биологов: "Симбиоз Россия 2011" (Воронеж, 2011), II Всероссийской школе-конференции «Биомика-наука XXI века» (Уфа, 2011), III международной конференции «Техническая химия.

От теории к практике» (Пермь, 2012).

Результаты проведенных исследований опубликованы в 14 научных работах: 4 статьи, 2 из которых в журналах, рекомендованных ВАК Минобрнауки РФ, 10 тезисов.

Объем и структура диссертации.

Работа изложена на 129 страницах машинописного текста, содержит 42 рисунка и 24 таблицы, состоит из введения, обзора литературы, описания объектов и методов, трех глав результатов собственных исследований, заключения, выводов, списка литературы. Список литературы включает 137 наименований работ, в том числе 34 отечественных и 103 зарубежных авторов.

Связь работы с научными программами и собственный вклад автора. Диссертационная работа выполнена в соответствии с планом НИР Института экологии и генетики микроорганизмов УрО РАН и является частью исследований, проводимых по теме «Биохимические и генетические системы трансформации органических соединений у бактерий, перспективных для биотехнологий» (номер госрегистрации 0120.0 406511), а также в рамках Программы фундаментальных исследований Президиума РАН «Молекулярная и клеточная биология» и ФЦП «Научные и научнопедагогические кадры инновационной России» на 2009-2013 гг., АВЦП «Развитие научного потенциала высшей школы (2009–2010 гг.)» и гранта поддержки молодых ученых УрО РАН.

Научные положения и выводы диссертации полностью базируются на результатах собственных исследований автора и исследований в сотрудничестве при личном участии автора.

Список принятых сокращений:

ВЭЖХ - высокоэффективная жидкостная хроматография;

ГХ - газовая хроматография;

ЕД - единица активности фермента, мкмоль/мг/мин;

КОЕ - колониеобразующие единицы;

ОП - оптическая плотность;

ПЦР - полимеразная цепная реакция;

LB - среда Луриа-Бертани, Ac-DBF - N-ацетил-,8-дифтор-2,3-дигидро-3-метил-4H-1,4-бензоксазин, ее – энантиомерный избыток.

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Ароматические амиды и нитрилы рассматриваться как производные от кислот или аминов (Артеменко, 2005).

Амиды могут быть получены не только из алифатических или ароматических карбоновых кислот, но также и из других типов кислот, например, из Ароматические соединения амидов являются важными промежуточными звеньями при производстве красителей и лекарств (Hamme, 2003; Сейц, Князев, 1986). Большое разнообразие химического строения амидов нашло отражение в разнообразии их биологического действия (Наумова, 1985).

Несмотря на то, что собрано большое количество информации о метаболизме различных амидов, еще не удалось определить природу их токсического действия на молекулярном и клеточном уровнях (Артеменко, 2005; Наумова, 1985).

Нитрилы (также называемые органическими цианидами) органические соединения, которые содержат характерную цианистую группу ) и имеют общую формулу RCN. Их можно рассматривать как производные углеводородов, в которых три атома водорода, присоединенных к первичному углероду, заменены нитрильной группой, или как производные карбоновых кислот (R - COOH), в которых кислородные и гидроксильные радикалы заменены нитрильной группой ( ) (Агрономов, 1990). При гидролизе во всех вариантах они образуют кислоту (Kanaly, Harayama 2000).

Нитрильные соединения широко распространены в окружающей среде (Banerjee, 2002; Song, 2007). Растения продуцируют многие нитрильные соединения, такие как цианогликозиды, цианолипиды, рицинин, фенилацетонитрил и др. (Banerjee et al., 2002; Howden, Preston, 2009; Chen et al., 2009).

Нитрилы очень опасны, поскольку при нагревании, разлагаясь, выделяют цианистый водород (Рабинович, Хавин, 1991). Эти чрезвычайно активные соединения широко используются как промежуточные звенья в органическом синтезе (Song et al., 2007). Они нашли широкое применение в качестве исходных материалов для синтеза различных жирных кислот, фармацевтических препаратов, витаминов, синтетических смол, пластмасс и красителей (Агрономов, 1990; Sugai et al., 1997; Banerjee et al., 2002).

Являются мутагенами и канцерогенами (Song et al., 2007).

1.2. Биотрансформация ароматических амидов и нитрилов Биотрансформация - высокоспецифичная реакция, осуществляемая микроорганизмами или изолированными ферментами как с естественными для них, так и с чужеродными веществами (Lorenz, Eck, 2004). Эта реакция может заключаться в окислении субстрата, его гидрировании, гидролизе, этерификации, конденсации, метилировании, дезаминировании и др. Эти превращения стереоспецифичны, не дают побочных продуктов, протекают при нормальной температуре, давлении. Они широко используются в производстве ряда витаминов, стероидных гормонов, лекарственных средств (Stoecker, 1998). Биотрансформация веществ – одно из развивающихся направлений биотехнологии (Warhurst, Fewson, 1994).

Это широкое понятие включает три более узких процесса (Хоменков, 2008):

трансформацию, или незначительные изменения молекулы;

простые соединения;

минерализацию, или превращение сложного вещества в самые простые (Н2О, СО2, Н2, NH3, CH4 и т.д.).

биотрансформацию, являются микроорганизмы (Diaz, 2001).

Огромное генетическое разнообразие микроорганизмов, их метаболическая пластичность, высокие скорости размножения позволяет им развиваться и адаптироваться к быстро меняющимся условиям внешней среды даже в экстремальных условиях, в которых не способны выжить другие живые организмы (Хоменков, 2005). Основными деструкторами органических соединений являются представители грамотрицательной микрофлоры – бактерии рода Pseudomonas (Хоменков, 2008; Diaz, 2001; Baggi et al., 1987;

McNally et al., 1999; Cheng et al., 1997; Tropel, Meer, 2004; Kanaly, Harayame 2000; Di Gioia et al., 2001; Chadhain, 2006; Stoecker, 1998), из представителей грамположительной микрофлоры наиболее значимыми являются бактерии рода Rhodococcus (Жуков, 2007; Stoecker, 1998; Martinkova et al., 2008;

Iwabuchi et al., 2002; Tropel et al., 2004; Chadhain et al., 2006). Keener W. and Arp D.J. сообщили о трансформации бензола и его производных Nitrosomonas europaea (Keener, Arp, 1994).

Чтобы использовать определенное соединение в качестве единственного источника питания, микроорганизмы должны синтезировать и поддерживать в активном состоянии специальную систему ферментов (Карасевич, 1982).

1.3. Типы метаболизма ароматических соединений Существует два типа метаболизма ароматических субстратов, аэробный и анаэробный (Johnson, 2000).

Кислород является одним из наиболее распространенных конечных акцепторов электронов в процессах дыхания у микроорганизмов. Процесс аэробного дыхания обеспечивает микробной клетке наибольшее количество энергии (Хоменков, 2008).

начинается с реакции включения кислорода в молекулу субстрата. Эти реакции катализируют ферменты оксигеназы (Карасевич, 1982; Хоменков, 2008; Martinkova et al., 2008; Kaiser et al., 1996; Hamme et al., 2003; Zhang et al., 2006). Оксигеназы делятся на две основные группы: монооксигеназы и диоксигеназы. Монооксигеназы катализируют включение в молекулу субстрата одного атома молекулярного кислорода, тогда как второй атом восстанавливается до воды. Эти ферменты называют также гидроксилазами, или оксидазами. Многие монооксигеназы требуют дополнительного донора электронов, роль которого в ряде случаев выполняют НАДН или НАДФН, т.е.

несут черты дегидрогеназ (Карасевич, 1982).

Реакции, катализируемые монооксигеназами, протекают по следующей схеме (Карасевич, 1982):

где АН2 – донор электронов, субстрат – ОН – окисленный субстрат.

Диоксигеназы катализируют включение в молекулу субстрата обоих атомов молекулярного кислорода.

Главными промежуточными метаболитом исходного субстрата при аэробном процессе биодеградации являются его дигидроароматические производные (катехол, протокатехоат, гидрохинон, гидроксихинон) (Хоменков, 2008; Martinkova et al., 2008). Эти соединения могут выступать в качестве субстратов ферментов, осуществляющих разрыв ароматического кольца – ключевой стадией биодеградации (Нестеров, 1991; Хоменков, 2008;

Martinkova et al., 2008).

Раскрытие ароматического кольца может происходить между двумя соседними углеродными атомами, несущими гидроксильные группы – орторасщепление. Осуществляют это расщепление ферменты – интрадиольные диоксигеназы. Если раскрытие ароматического кольца происходит в метаположении, то оно называется мета-расщепление, а соответствующие ферменты – экстрадиольными диоксигеназами. Центральные метаболические пути, включающие в себя серии реакций, приводят к образованию промежуточных соединений цикла Кребса (рис. 1) (Хоменков, 2008; Нестеров, 1991; Пунтус, 2008; Карасевич, 1982; Martinkova et al., 2008; Hamme et al., 2003; Kanaly, 2000).

Рис. 1. Центральные пути катаболизма ароматических соединений у Загрязнение окружающей среды нередко возникает в анаэробных биотопах, не содержащих достаточного количества кислорода, таких как водоносные горизонты, осадочные водные отложения и затопленные участки почвы. В этих условиях биодеградация веществ-загрязнителей достигается за счет работы анаэробных, либо факультативно-анаэробных микроорганизмов, использующих альтернативные кислороду акцепторы электронов: нитрат (денитрифицирующие бактерии), сульфат (сульфатредукторы), Fe(III) (железоокисляющие микроорганизмы), СО2 (метаногены), или другие акцепторы такие как хлорат, Mn, Cr, U и т.д. (Robertson, 1998; Хоменков, 2008).

Rhodopseudomonas palustris использует различные ароматические соединения как в аэробных так и в анаэробных условиях (Harwood, Gibson, 1988).

С точки зрения энергетики микробной клетки биодеградация ароматических соединений с использованием в качестве конечных акцепторов электронов нитрат-иона и иона Fe(III) практически столь же эффективна, как и кислорода. Когда акцептором электронов является сульфат-ион или процесс биодеградации ароматических ксенобиотиков происходит с образованием метана, то в микробной клетке образуется меньшее количество энергии (Хоменков, 2008).

1.4. Ферменты, участвующие в преобразовании нитрилов и В живом мире каждая химическая реакция катализируется своим ферментом. Ферменты проявляют высокую специфичность, так например, они способны различать разные молекулы субстратов. Более того, они имеют способность работать при умеренных температурах, давлении и pH, которая делает их привлекательными катализаторами для промышленности (Quax, 2006).

Биокаталитический гидролиз нитрилов проходит по двум различным путям: одностадийный гидролиз до соответствующих карбоновых кислот с выходом аммиака с помощью фермента нитрилазы и двустадийный, при котором нитрил с помощью нитрилгидратазы гидролизуется до амида и далее амидазой до кислоты (Wang, 2005). На сегодняшний день различные нитриламид конвертирующие ферменты были выделены и описаны из бактерий, грибов и растений. Производство акриламида и никотиновой кислоты в промышленных масштабах доказали коммерческую значимость этих ферментов (Chen et al., 2009).

В результате множества исследований было показано, что большинство нитрилгидролизующих микроорганизмов имеют либо нитрилазу, либо нитрилгидратазу и амидазу (Banerjee et al., 2002; Wang, 2005; Martinkova et al., 2009). Некоторые микроорганизмы, такие как R. rhodochrous LL 100-21 и R.

rhodochrous J1 содержат как нитрилазу так и нитрилгидратазу/амидазу.

1.4.1. Нитрилгидратазы Нитрилгидратаза, преобразующая нитрилы в соответствующие амиды, является ключевым ферментом в двуферментном пути гидролиза нитрилов до кислот (Mascharak, 2002). Фермент имеет и субъединицы в эквимолярном количестве, но их количество изменяется для ферментов из различных микробных источников (Komeda et al., 1997) Кристаллическая структура и спектроскопические исследования показали, что почти все нитрилгидратазы в активном центре содержат либо негемовое железо, либо кобальт. Fe-нитрилгидратаза и Co-нитрилгидратаза несмотря на разницу в происхождении и каталитических свойств имеют очень похожие структуры (Martinkov et al., 2010; Wang, 2005; Song et al., 2007;

Chen et al., 2009). Были предложены несколько механизмов гидратации нитрила, катализируемых Fe- и Co-нитрилгидратазой. Во всех реакциях ион металла принимает участие как кислота Льюиса. В механизме А, азот нитрила координирует непосредственно ион металла и следовательно увеличивается электрофильность атома углерода, что способствует гидратации. В механизмах В и С, метал-связанный гидроксид действует либо в качестве нуклеофила для атаки атома углерода циано группы, либо в качестве главной основы активации молекулы воды в активном центре (рис. 2) (Wang, 2005).

Рис. 2. Механизмы Fe- и Co-нитрилгидратазой катализируемых реакций Нитрилгидратазы штаммов Rhodococcus sp. R312 (прежде известного как Brevibacterium sp. R312) и P. chlororaphis B23 - первые примеры негемовых железоферментов, содержащих ион с низкой валентностью Fe (III).

Активность нитрилгидратазы повышается на свету. Хромофор, вовлеченный в фотоактивацию, является железным комплексом в субъединице. Поэтому эндогенная молекула NO, которая связана с негемовым железным центром в неактивной нитрилгидратазе, освобождается, приводя к восстановлению активности нитрилгидратазы (Maier-Greiner et al., 1991).

Модель предполагаемого каталитического механизма железосодержащих, а возможно, и кобальтсодержащих нитрилгидратаз включает три стадии.

Сначала нитрил взаимодействует с гидроксильным ионом (ОH-) молекулы воды, связанной с металлом. Затем гидроксильный ион, связанный с железом, или гидроксил поляризованной ионом металла молекулы воды атакует атом углерода в нитриле с образованием имида (R-C(-OH)=NH). B заключительной фазе реакции имид таутомеризуется в амид (Kobayashi, 1999).

В присутствие ионов кобальта, актиномицет R. rhodochrous J продуцирует две нитрилгидратазы, в зависимости от индуктора. Hнитрилгидратазы действуют предпочтительно на алифатические нитрилы, тогда как L-нитрилгидратазы проявляют более высокое сродство к ароматическим нитрилам. H- и L-нитрилгидратазы использовались для промышленного производства акриламида и никотинамида из акрилонитрила и 3-цианопиридина, соответственно. Обе выделенные нитрилгидратазы содержат кобальт как кофактор. Нитрилгидратаза с кобальтом имеет треонин в-V-C-(T/S)-L-C-S-C-последовательности как активный участок, тогда как у железосодержащих нитрилгидратаз есть серин. Различие в металлических кофакторах может быть приписано различным аминокислотным остаткам в этом положении. Анализ кристаллической структуры кобальт-содержащих нитрилгидратаз Pseudonocardia thermophila JCM3095 показал, что и кобальт (III) и Fe (III) находятся в схожей окружающей среде. Остаток триптофана (Trp 72), который может быть вовлечен в закрепление субстрата в кобальт содержащем ферменте заменяет остаток тирозина в Fe (III) - содержащем ферменте. Он, вероятно, отвечает за то, что нитрилгидратазы с кобальтом предпочитают ароматические, а не алифатические нитрилы (Kobayashi, Shimiru, 1998).

нитрилгидратаза из штамма Rhodococcus ruber GT, которая применяется для биотехнологического синтеза акриламида гидратацией акрилонитрила в водных растворах (Демаков и др., 2004).

Bauer R. и коллегами выделена энатиоселективная нитрилгидратаза из Agrobacterium tumefaciens strain d3, которая была полностью отделена от амидазы. Данная нитрилгидратаза имеет температурный оптимум 40°С и оптимум рН 7,0. Холофермент имеет молекулярную массу 69 кДа, субъединицы – 27 кДа. Фермент гидролизует 2-арилпропионитрилы и другие ароматические и гетероциклические нитрилы (2-фенилпропионитрил, 2фенилбутиронитрил, 2-(4-хлорфенил)-пропионитрил, 2-(4-метокси)пропионитрил или кетопрофен нитрил) до соответствующих S-амидов. Более цельноклеточного препарата в присутствии ингибитора амидазы.

Энатиоселективность реакции с использованием целых клеток была улучшена путем увеличения температуры (Bauer et et, 1998). Клетки R. erythropolis ATCC 25544 с помощью энантиоселективных нитрилгидратазы и амидазы продуцировали 45 мМ (S)-2,2-диметилциклопропанкарбоновую кислоту из рацемического 100 мМ 2,2-диметилциклопропан карбонитрила с энантиомерным избытком 81,8% после 64 часовой реакции (Yeom et al., 2007).

1.4.2. Амидазы Амидазы - ферменты расщепляющие амиды, катализируют гидролиз амидов до карбоксилатов и аммония и присутствуют во всех царствах живого мира (Fournand, Arnaud, 2001; Лавров и др., 2010).

Амидазы являются широко распространенными ферментами в живой природе и могут быть разделены на два типа. Первый тип включает алифатические амидазы, гидролизующие только короткоцепочечные алифатические амиды. Второй тип включаeт алифатические амидазы, гидролизующие амидные цепочки средней величины, некоторые ариламиды, a-аминоамиды и a-гидроксиамиды (Fornaud, Arnaud, 2001). Все эти амидазы проявляют ацилтрансферазную активность, ведущую к формированию гидроксамовых кислот. Некоторые из них также способны трансформировать соответствующие им карбоновые кислоты, гидроксамовые кислоты или кислотные гидразиды (Fornaud, Arnaud, 1997).

На сегодняшний момент роль амидаз в живом мире не определена.

Однако в течение последних лет стало много известно об эволюционных аспектах этих ферментов и катализируемых амидазой реакций in vitro.

Амидазы оказались эффективным инструментом для синтеза различных соединений (Chen et al., 2009).

Среди грибов-продуцентов амидаз наиболее изучена амидаза Aspergillus nidulans. Описано несколько амидаз: формамидаза, активность которой проявляется в присутствии формамида и глицинамида, в качестве субстрата;

ацетамидаза, гидролизующую короткоцепочечные алифатические амиды до 6 атомов углерода; амидазы, проявляющие активность с алифатическими амидами (бутирамид, валерамид, гексаноамид) и с aриламидами (амид бензойной кислоты, фенилацетамид) (Fournand, Arnaud, 2001).

Большинство известных в настоящее время амидаз было обнаружено и описано в бактериях. Эти ферменты содержат представители родов:

Rhodococcus, Corynebacterium, Mycobacterium, Pseudomonas, Bacillus, Micrococcus, Brevibacterium, Nocardia, Streptomyces, Blastobacter, Arthrobacter, Alcaligenes, Helicobacter, Lactobacillus, и Methylophilus (Clarke, 1970).

Эти разные амидазы проявляют различную субстратную специфичность (Brady et al., 2006). Например, Kimura Т. частично очистил никотинамидазу Mycobacterium avium, которая была абсолютно специфична к никотинамиду, тогда как Kobayashi М. и коллеги очистили и охарактеризовали амидазу R. rhodochrous J1 с очень широким спектром субстратов (Kimura, 1959;

Kobayashi et al., 1998). Отличают абсолютно специфичные амидазы от неспецифичных, алифатические амидазы от ариламидаз и амино-амид амидогидролаз. Один микроорганизм может содержать несколько амидаз.

Arnaud и коллеги обнаружили, что Rhodococcus sp. R312 содержит L-альфааминоамидазу, энантиоселективную амидазу, алифатическую амидазу (Arnaud et al., 1976). К.В. Лавровым и коллегами выделена и описана новая ациламидаза из R. erythropolis ТА37, которая использует в качестве субстрата аланина, лейцина), а также алифатические амиды (ацетамид, акриламид, изобутирамид), хотя и с меньшей эффективностью (Лавров и др., 2010).

Амидазы, вовлеченные с нитрилгидратазой в метаболизм нитрилов, осуществляли энантиоселективный гидролиз некоторых рацемических амидов. В 1995 Ciskanik и коллеги охарактеризовали амидазу Ps. chlororaphis B23, которая энантиоселективно гидролизует некоторые ароматические амиды, включая 2-фенилпропионамид (Ciskanik et al., 1995). Год спустя Hirrlinger В. и коллегами охарактеризована амидаза R. erythropolis MP50, которая конвертировала рацемический 2-фенилпропионамид, напроксенамид и кетопрофенамид до соответствующих кислот с избытком 99 % и почти с 50%-ным преобразованием рацемических амидов (Hirrlinger et al., 1996).

Фермент также гидролизовал различные альфа-аминоамиды, но без значительной энантиоселективности (Fournand, Arnaud, 2001).

Активность амидаз вызывает большой интерес для настоящих и будущих биотехнологических применений. Гидролиз с участием амидазы применяют в химической промышленности для производства адипиновой, акриловой, p-аминобензойной и молочной кислот, аналогов ризобитоксина; в фармацевтической промышленности для производства S или R энантиомеров 2-фенилпропионовой кислоты, ибупрофена, напроксена, кетопрофена и некоторых других соединений. Перенос ацильной группы на гидроксиламин используется в медицине для производства аминогидроксамовых кислот или пептидов (Fournand, Arnaud, 2001, 1997).

1.4.3. Нитрилазы соответствующей карбоновой кислоты и аммиака. Эти ферменты охарактеризованы и выделены из растений, бактерий и грибов, а также найдены гомологичные ферменты в геномах животных и дрожжей (Brady et al., 2006; Howden, Preston, 2009).

Нитрилазы – гомомультимерные тиольные ферменты (Cowan et al., 1998). Молекулярная масса субъединиц и нативная структура были определены для многих нитрилаз. Большинство состоят из одного полипептида с молекулярной массой около 40 кДа (32-45 кДа). Форма этого фермента представляет собой совокупность 6-26 субъединиц (O’Reilly, Turner, 2003).

Суперсемейство нитрилаз, также относящееся к CN-гидролазам, состоит из ферментов, которые катализируют гидролизы непептидных C-N связей.

Члены суперсемейства поделены на 13 ветвей согласно идентифицированной последовательности генов и каталитической активности. Они включают алифатическую амидазную, N-неизменную амидазную, биотинидазную, карбамилазную, нитрилазную ветви и др. (Pace, Brenner 2001).

Эти ферменты гидролизуют CN-группу нитрила, в результате чего получается соответствующая карбоновая кислота и аммиак (Osprian et al.

1999). Реакция катализируется нитрилазой (рис. 3).

Все члены суперсемейства нитрилаз имеют каталитическую триаду аминокислот – глутаминовую кислоту, лизин и цистеин (Pace, Brenner 2001).

Нитрилазы имеют тиольную группу, которая является необходимой для каталитической активности, и таким образом, нитрилазы классифицируются как тиольные ферменты. Активность ферментов может быть ингибирована тиол-связывающими компонентами, такими как AgNO3 и CuSO4, и увеличена в присутствии тиол-восстанавливающих агентов, таких как дитиотрейтол (Osprian et al. 1999; Pace, Brenner 2001).

Нитрилазы часто классифицируют по одной из 3 категорий согласно специфичности субстратов: алифатические нитрилазы, которые активны в первую очередь на алифатических нитрилах, таких как акрилонитрил, глутаронитрил и –циано-L-аланин; ароматические и гетероциклические нитрилазы, которые, в первую очередь, активны на ароматических и гетероциклических нитрилах, таких как бензонитрил и цианопуридин, и арилацетонитрилазы, которые активны на арилацетонитрилах, таких как фенилпропионитрил (Robinson, Hook, 1964). Среди грибов описана нитрилаза из Fusarium oxysporum f. sp. melonis и Fusarium solani IMI196840, которая специфична только к ароматическим нитрилам, в частности, к бензонитрилу.

(O’Reilly, Turner, 2003).

Некоторые нитрилазы являются крайне специфичными субстратами (Banerjee et al, 2002). Другие ферменты имеют широкий субстратный ряд (Brady et al., 2006). Нитрилизы с одинаковой субстратной специфичностью часто имеют похожую последовательность аминокислот и могут попадать в одинаковые категории в филогенетических анализах (Banerjee et al, 2002).

Оптически активные 2-арилпропионовые кислоты, такие как (S)напроксен, (S)-ибупрофен и (S)-кетопрофен могут быть продуцированы с помощью (S)-энантиоселективной нитрилазы. Так, при взаимодействии AK226 выход S-2-(4’-изобутилфенил)-пропионовой кислоты (S-ибупрофена) составил 95% (Chen et al., 2009).

1.5. Биотрансформация бензамида Молекулярная формула: С6Н5СНNН2, молекулярная масса 121,15, бесцветные кристаллы. Тпл = 132,5°С, Ткип = 290°С. Малорастворим в воде, хорошо растворим в горячей воде (Рабинович, Хавин, 1991).

Использовать бензамид в качестве источника азота и энергии способны многие бактерии. Так, по Brady (Brady et al., 2006) деградировать бензамид могут представители разных родов, например, таких как Alkaligenes sp., Bacillus sp., Chryseomonas sp., Microbacterium sp., Pseudomonas sp., Rhodococcus sp.

1.6. Биотрансформация бензонитрила бесцветная жидкость с миндальным запахом. Т пл = -12,8°С, Т кип. = 191,1 °С. Плохо растворим в воде. Умеренно токсичен (под ред. Кнунянц, 1998).

Бензонитрил, как представитель органонитрилов, представляет класс чрезвычайно токсичного вещества, которое воздействует на различные уровни организации жизни, включая человека, и, как известно, обладает канцерогенными и мутагенными свойствами. Широко используется в промышленности, как растворитель, в фармацевтической промышленности, а также как гербицид и пестицид (например, дихлобенил, бромоксинил), и т.д.

Как следствие, оганонитрилы часто содержатся в сточных водах (Li et al., 2007).

Использовать, в качестве источника углерода, азота и энергии, бензонитрил способны многие бактерии, о чем свидетельствуют многочисленные публикации разных авторов (табл. 2).

Li и коллеги сообщают о биодеградации бензонитрила смешанной бактериальной культурой. После 314-часового культивирования утилизируется 92,1% бензонитрила (Li et al., 2007).

Бактерии-деструкторы бензонитрила Литературный источник Nocardia sp. NCIB 11215 Nagasawa, Yamada, 1990; Thuku et al., Arthrobacter sp.

Rhodococcus rhodochrous Mustacchi et al., Alkaligenes faecalis ATCC8750 Brady et al., Bacillus subtilis Pseudomonas alcaligenes 1 Thuku et al., Geobacillus pallidus DAC Rhodococcus rhodochrous ATCC Rhodococcus rhodochrous J Rhodococcus rhodochrous PA- Rhodococcus rhodochrous NCIMB Bacillus pallidus DAC Nocardia sp. NCIMB Acinetobacter sp. AK Rhodococcus rhodochrous LL100-21 Mustacchi et al., Ингибирующими концентрациями бензонитрила для роста культуры были ниже 2мМ и выше 25мМ. Биодеградация осуществляется с помощью ферментов нитрилаз. Пути биодеградации бензонитрила представлены на рисунке 4.

Рис. 4. Пути биодеградации бензонитрила смешанной культурой 1.7. Энантиоселективная биотрансформация ароматических Известно, что ферментативный катализ демонстрирует высокий уровень энантиоселективности (Vink et al., 2006). В результате подобных реакций образуется один энантиомер из рацемической смеси.

Энантиомеры – вещества, характеризующиеся противоположными по знаку и одинаковыми по величене вращениями плоскости поляризации света при идентичности всех других физических и химических свойств (Kus, Sochanic, 2007; Beard, 1998). Когда две зеркальные формы присутствуют в равных количествах, то смесь называют рацемической. Наиболее распространенная система для описания стереогенетических и использующая R- и S-номенклатуру. Белки, кодируемые нуклеиновыми кислотами, используют L--аминокислоты, которые представлены в Sконфигурации, за исключением L-цистеина, который описан как R (Beard, 1998).

Ladik J.J. и Szekeres Z. показали, что с помощью молекулярнодинамического моделирования изменение хиральности в нескольких хиральных центрах фермента полностью меняет его вторичную структуру, что в итоге приводит к исчезновению каталитической активности. Таким образом, даже незначительные изменения в структуре молекулы могут представлять серьезную опасность для жизнедеятельности живых существ (Ladik, Szekeres, 2006).

Производство одного энатиомерно чистого продукта становится все более важной проблемой в фармацевтической промышленности (Patel, 2005).

На данный момент известно, что во многих случаях только один стереоизомер лекарственного вещества является эффективным, тогда как другой либо неактивен, либо показывает значительно сниженную активность (Nugent et al., 1993; Patel, 2000; Csuk, 2006), в худшем случае он может иметь нежелатьную биологическую активность (Lennard, 1991).

Разница в фармакологической активности энантиомеров была известна с начала XX века, но до конца 1980-х годов она не учитывалась для производства лекарств и агрохимикатов (Csuk, 2006).

Некоторые производные пропионовой кислоты, такие как кетопрофен, ибупрофен и напроксен имеют один асимметричный атом углерода в молекуле. Известно, что только S-изомер имеет терапевтическую значимость, в то время как кетопрофен находит применение в R-конфигурации (Ladik, Szekeres, 2006; Stock et al., 1999; Alcantara et al., 2000). Тем не менее, только напроксен, декскетопрофен, флюноксапрофен и торадол имеются в продаже в виде активного энантиомера (Alcantara et al., 2000).

Таким образом, использование одного изомера из рацемической смеси является важным элементом разработки лекарственных средств (Lennard, 1991). Фармацевтические компании осознают, что новые препараты должны быть гомохиральными, чтобы избежать возможности возникновения побочных эффектов из-за нежелательных стереоизомеров (Patel, 2000; Csuk, 2006).

Ферменты представляют собой хиральные молекулы и многие реакции, катализируемые ими, проходят с образованием хирально чистых продуктов.

Если выбирать между коммерчески доступными ферментами различной чистоты, сырым ферментным препаратом, выделенным из органов животных или клеток микроорганизмов, и целыми клетками, то последние имеют ряд преимуществ. Они удобны в использовании и являются стабильным источником ферментов, которые синтезируются клетками в ответ на присутствие субстрата. В случае, когда большая ферментная активность соответствующих гидантоинов, использование целых клеток в качестве биокатализаторов не может быть заменено изолированными ферментами.

Также активность окислительной и восстановительной реакции с помощью биокатализаторов проводятся цельноклеточными препаратами в связи с ограниченной устойчивостью изолированных ферментов, необходимостью определенных условий и повторного использования кофактора. Одной из привлекательным, является то, что они генерируют фермент и кофакторы вместе с катализаторами, поэтому они особенно удобны в использовании (D’Arrigo et al., 2000).

Однако использование целых клеток для разделения рацемической смеси подходит только при работе в водной среде, поскольку клетки биокатализаторы могут быть использованы для разделения рацемических нитрилов, сложных эфиров или амидов в гидролитической форме, но бесполезны для этерификации и амидирования в органических растворителях, Следовательно, условия эксперимента имеют решающее значение для выбора оптимального биокатализатора (Alcantara et al., 2000).

Первые патенты, касающиеся кинетического разложения рацемических Corynebacterium, были зарегистрированы в конце 1980-х годов. Большинство микроорганизмов, таких как R. butanica, R. equi A4 и R. rhodochrous NCIMB энантиомерной чистотой 95-98%. Для улучшения производительности экспрессированный в E. coli. Наличие эстераз или амидаз во многих микроорганизмах также используется для разделения рацемических смесей эфиров или амидов данных препаратов. В этом смысле, эстеразы Kluyvera oxytoca SNSM 87 и B. subtilis были успешно использованы для разделения рацемических эфиров, в то время как, R. erythopolis MP50 был применен для разделения амида (R, S-2-(6-метокси-2-нафтил)пропионовой кислоты с выходом 48% напроксена с энантиомерной чистотой 99% после 45 часов (Alcantara et al., 2000).

Большинство исследований по энантиоселективной биотрансформации нитрилов на данный момент сосредоточены на -арилпропионитрилах, потому что их легко получить и они имеют важное значение, поскольку продуктом их гидролиза являются -арилпропионовые кислоты, производные которых являются нестероидными противовоспалительными средствами (НПВС). Амидазы почти во всех микроорганизмах, таких как R. rhodochrous IFO 15564, R. sp. 361, R. equi TG328, Rhodococcus sp. AJ270, Rhodococcus sp.

CGMCC 0497 и R. equi A4 показывают хорошую S-энантиоселективность от -арилпропиоамидных субстратов, в то время как нитрилгидратазы из различных источников показывали низкую R- или S-энантиоселективность, либо ее отсутствие вообще. Энантиоселективность нитрилгидратазы находится под сильным влиянием заместителей бензольного кольца нитрильных субстратов. Например, нитрилгидратаза R. rhodochrous IFO показывает низкую R-энантиоселективность 2-(4'-изо-бутилфенил)пропионитрила (Ибупрофен нитрил) и нитрилгидратаза R. equi A4 имеет умеренную S-энантиоселективность 2-(4'-хлоро- и 4'-метоксифенил)пропионитрилов, в то время как нитрилгидратаза Rhodococcus sp. показывает R-, S- и отсутсвтие селективности ибупрофен нитрила, 2-(4'метилфенил)-пропионтрила и 2-фенилпропионитрила, соответственно.

Исследования Rhodococcus sp. CGMCC 0497, катализирующего гидролиз арилпропионитрилов, показали, что полный гидролиз нитрилов идет с выходом оптически активных S-карбоновых кислот и R-карбоксамидов. Были получены энантиомерные выходы как хорошие, так и отличные, из арилпропионитрильных субстратов в пара- и мета-положении, независимо от природы заместителя, в то время как орто-замещенные аналоги привели только к умеренной энантиоселективности (Wang, 2005).

Влияние заместителей на энантиоселективную биотрансформацию ароматических амидов и нитрилов.

Введение аллильной группы в -позицию арилацетонитрилов приводит к повышению скорости конверсии по сравнению с -этил- и -изопропил замещенных аналогов. Биотрансформация -аллил-фенилацетонитрила проходит эффективно с получение S-кислоты и R-амида с энантиомерной чистотой более 99%. Rhodococcus sp. AJ270 катализирует реакцию -аллиларилацетонитрила независимо от положения заместителей бензольного кольца. Хотя скорость реакции была ниже, чем у предшественников - -аллилфенилацетонитрила, почти со всеми субстратами были получены продукты с высоким выходом, с отличными значениями энантиомерной активности, за исключением 2-(2-метилфенил)-4-пентеннитрила с орто-замещением кинетического разделения амидов и стереохимических восстановленных нитрилов показывают комбинированный эффект высокой селективности Sамидазы и низкой селективности нитрилгидратазы, с доминирующей амидазой (Shen et al., 2012; Choi et al., 2008; Wang et al., 2010; Trott et al., 2002;

Chen et al., 2009). Применение этой энантиоселективной биотрансформации было показано с помощью синтеза промежуточных лактонов и R-(-)баклофена (Wang, 2005).

микроорганизмами или ферментами было использовано несколько нитрилов в качестве рацемических субстратов, главным образом в -гидрокси- и -амино замещениях. Однако результаты энантиоселективности были плохими.

эффективность хирального центра по сравнению с субстратами. Только в нескольких случаях реакции дают практическую полезность энантиоконтроля.

Например, рацемический 3-бензоилоксипентаннитрил был трансформирован с помощью клеток R. rhodochrous IFO 15564 в R-3-бензоилоксипентанамид и S-3-бензоилоксипентановую кислоту с энантиомерной чистотой 96% и 55% исключительно амидазой, в то время как нитрилгидратаза не была энантиоселективной (Wang, 2005; Chen et al., 2009).

Биотрансформация -гидрокси нитрилов с R. rhodochrous IFO приводит к формированию -лактонов в умеренном выходе. Энантиомерная чистота продуктов была чрезвычайно мала (Wang, 2005).

1.8. Энантиоселективный гидролиз ибупрофенамида Получение энантиомерно-чистых веществ традиционными химическими методами представляет собой трудноразрешимую задачу. Так, один из способов промышленного синтеза ибупрофена проходит в три стадии. Первая состоит в ацилировании изобутилбензола уксусным ангидридом в растворе катализатором. Параллельно образуется уксусная кислота. Последующие реакции каталитического гидрирования и карбонилирования дают ибупрофен (Швец, 1997).

стереослективностью, т.е. способны трансформировать лишь один стереоизомер в рацемической смеси или превращать оптически неактивный субстрат преимущественно в один из возможных стереоизомеров.

Ибупрофен (производное арилпропионовой кислоты) - нестероидное противовоспалительное средство. Принадлежит к группе 2-арилпропионовых кислот, которые существуют в виде R-и S-энантиомеров (рис. 5) (Freer, 1993;

Stock et al., 1991). Известно, что только S-ибупрофен имеет терапевтическую значимость, тогда как R-энантиомер неактивен (Graham, Williams, 2004) Рис.5 Структура энантиомеров ибупрофена (Freer, 1993) Субстратом для получения ибупрофена с помощью бактериальных ферментов могут служить нитрил или амид ибупрофена (рис. 6). Так биотрансформацию амида ибупрофена катализирует фермент амидаза (Alcntara et al., 2000; Freer, 1993).

Рис. 6. Пути ферментативной конверсии ибупрофен нитрила (Yamamoto et al., Авторами Snell D. и Colby J. было доказано, что штамм Rhodococcus AJ270 осуществляет частичный гидролиз 1,5 мМ ибупрофенамида при 30С в течение 2,5 часов. Полный гидролиз был описан при концентрации ибупрофенамида 0,25 мМ в течение 17 часов при 30С. При этом образуется S-изомер, и выход продукта составляет более 89.9% (Snell, Colby, 1999).

1.9. Энантиоселектвный гидролиз N-ацетил- 2,3-дигидро-7,8дифтор-3-метил-4H-1,4-бензоксазина Хиральные амины, в структуре которых аминогруппа находится вблизи асимметрического центра, являются ключевыми полупродуктами в синтезе практически важных органических соединений: антибиотиков, хиральных катализаторов, реагентов для разделения оптических изомеров в результате их дериватизации и пр. При этом стереоконфигурация и оптическая чистота имеют определяющее значение, как для избирательности протекания химических процессов, так и для проявления биологической активности.

В настоящее время большое внимание уделяется поиску и изучению стереоселективных ферментов и энантиоселективному биокаталитическому синтезу практически важных органических соединений. В частности, актуальным направлением является получение интермедиатов синтеза фторхинолонов, таких как левофлоксацин (Miyadera, Imura, 1999).

Важным интермедиатом в синтезе левофлоксацина является (S)-2,3дигидро-7,8-дифтор-3-метил-4H-1,4-бензоксазина. В присутствии энантиомерной чистотой 99% (Miyadera, Imura, 1999).

В Институте органического синтеза УрО РАН разработан метод получения левофлоксацина, в основе которого лежит кинетическое разделение энантиомеров бензоксазина (рис. 7):

Рис. 7. Метод получения левофлоксацина на основе кинетического Этот метод запатентован в Японии, Южной Корее и России. Найдены хиральные агенты, которые вступают в реакцию с одним из энантиомеров бензоксазина в 10 раз быстрее, чем с другим, что и позволяет достичь их эффективного разделения. Расчёты показывают, что это связано с определённой пространственной ориентацией переходных комплексов и различиях в их энергетических характеристиках (Чарушин, Чупахин, 2007).

ГЛАВА 2. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

2.1. Объекты исследования Объектом исследования являлись почвенные микрорганизмы таёжной и степной зоны России, имеющие нитрилконвертирующую ферментативную активность. Также использовали штаммы из коллекции лаборатории (R. rhodochrous 1185, R. erythropolis 416, 417, B15).

Культуры плесневых грибов предоставлены из коллекции НИЛ «Бактерицид» ЕНИ ПГНИУ.

Образцы почв естественной среды Пермского края, Челябинской и Саратовской областей были взяты в качестве материала исследования.

микроорганизмов ПГНИУ под руководством О.З. Еремченко проведены описание и анализ образцов почв с повышенным засолением (солончак, солодь, грунт в 2 м от солеотвала СКРУ-2).

Солончаки болотные формируются у края болота, покрытыми гидрофильной солеустойчивой растительностью (тростник обыкновенный, полынь селитряная, соссюрея горькая, бескильница тончайшая). Профиль этих солончаков отличается наличием верхнего оторфованного гумусового горизонта Ат. Морфологическое описание болотного солончака:

Ат – 0–18 см – оторфованный органогенный горизонт темно-бурого цвета.

Аg – 18–26 см – гумусовый оглеенный горизонт темно-бурого цвета с ржавыми прожилками и пятнами, бесструктурный, влажный, вязкий, глинистый, заметен переход в нижележащий горизонт.

G – с 26 см – глеевый горизонт, серого цвета с ржавыми пятнами, сырой бесструктурный, вязкий, глинистый.

Солончаки относительно однородны по гранулометрическому составу, валовой состав связан с накоплением легко- и среднерастворимых солей.

Содержание гумуса очень различно – от 0,5 до 8 %. В поглощающем комплексе содержатся кальций, магний, натрий. Реакция почвенного раствора – от слабощелочной и до сильнощелочной и зависит от химизма солей.

Карбонаты присутствуют с поверхности, в профиле содержится гипс.

Болотный солончак характеризовался средней степенью засоления и хлоридно-гидрокарбонатно-сульфатный (смешанным) составом солей.

Солоди формируются в облесенных западинах, реже в понижениях под влаголюбивой травянистой растительностью. Морфологическое описание солоди луговой:

О – 0–1 см – бурая, малоразложившаяся рыхлая подстилка из свежего листового опада, березовых веток и злаков, не потерявших анатомического строения.

ОА – 1–5 см – темно-коричневый полуразложившийся опад прошлых лет.

А – 5–14 см – гумусовый горизонт темно-серого цвета, рыхлый, слегка уплотненный, порошисто-комковатой непрочной структуры, среднесуглинистый, пронизан корнями древесных и травянистых растений;

переход постепенный.

Е – 14–31 см – осолоделый горизонт светло-серого цвета с массой ржавых пятен, уплотненный, плитчато-пластинчатый, легкосуглинистый, пронизан, корнями; переход в следующий горизонт ясный по окраске.

В – 31–51 см – иллювиальный горизонт красно-бурого цвета с неравномерно ржавыми пятнами, струйчатыми затеками гумуса, уплотненный, глинистый, пронизан корнями деревьев; переход ясен по цвету и структуре.

ВС – 51–66 см – переходный к породе горизонт бурого цвета с серыми заклинами породы, ржавыми пятнами и гумусовыми затеками, крупнопризматический, суглинистый; встречаются единичные корни; переход очень четкий по цвету, гранулометрическому составу и сложению.

С – 55–150 см – супесчаная порода голубовато-серого цвета с многочисленными ржавыми прослойками, пятнами, рыхлая, бесструктурная;

присутствуют единичные корни древесных растений; переход четкий.

Вскипания не обнаружено. Реакция почвенного раствора в верхних горизонтах - кислая. Солодь отличается малым содержанием гумуса в профиле, лишь в гумусовом горизонте его количество достигает несколько процентов. Сумма обменных катионов – низкая, обусловлена легким гранулометрическим составом и малым содержанием гумуса. При малой сумме обменных катионов преобладают кальций и магний.

Техногенные почвоподобные образования (ТПО) зоны солеотвала.

Исследования проводились в окрестностях города Соликамск в зоне воздействия солеотвалов – отходов производства солей. Соляные породы месторождения представлены калийной солью, сильвинитами и карналлитовыми породами.

В основании солеотвала залегают болотные и аллювиальные отложения.

Болотные отложения представлены торфом влажным и водонасыщенным, сильно и среднеразложившимся. Аллювиальные отложения представлены переслаивающейся толщей песчано-глинистых грунтов, не имеющей закономерности в залегании. Суглинки и глины коричневато-желтые, желтые и желто-бурые, с переслаиванием песка и супеси, местами заторфованные.

К условиям техногенного засоления приспособились преимущественно синантропные, адвентивные растения, в данном регионе они произрастают у дорог, жилья, в посевах сельскохозяйственных растений.

Разрез № 4 Описан возле солеотвала СКРУ-2 г. Соликамска на расстоянии 1-3 м. Поверхностный слой мощностью около 40 см желтоватобурого цвета, тяжелосуглинистый, глыбистый, бесструктурный, каменистость 50-70%.

ТПО из разреза № 4 был также отнесен к подгруппе литостратов, каменистость этого литострата связана с остаточным накоплением камней по мере растворения галитовых отходов.

ТПО зоны солеотвалов имели от нейтральной до щелочной реакции почвенного раствора. Исследуемые литостраты характеризуются очень низким содержанием углерода гумуса. По доле обменного натрия ТПО варьируют от слабосолонцеватых до сильносолонцеватых. Литострат у солеотвала СКРУ-2 имеет среднесуглинистый состав с пониженным содержанием песка и повышенной доле крупной пыли.

2.2. Среды и субстраты для культивирования Минеральная солевая среда для культивирования бактерий была разработана ранее А.Ю. Максимовым и коллегами, её состав (г/л): KH2PO4 ­ 1.0; K2HPO43H2O ­ 1.6; NaCl ­ 0.5; MgSO47H2O ­ 0.5; CaCl2 ­ 0.005;

CoCl26H2O – 0.01; FeSO47H2O ­ 0.005; рН 7.2 ± 0.2 (Максимов и др., 2003).

Агаризованную среду получали добавлением бакто-агара (Sigma) до конечной концентрации 1,5 %.

Источником углерода служила глюкоза в конечной концентрации 0.1 %.

ацетамид/пропионамид, которые служили единственными источниками азота.

Ростовые субстраты асептически добавляли до конечной концентрации в автоклавированную и охлажденную до 25°С среду.

Чистота культур контролировалась высевом на агаризованную среду LB (Луриа­Бертани), содержащей (г/л): триптон ­ 10.0, дрожжевой экстракт ­ 5.0, NaCl ­ 10, агар (Sigma) ­ 15.

2.3. Селекция штаммов-деструкторов ароматических амидов и нитрилов Штаммы выделяли методом прямого высева. Навеску почвы (1,0 г) суспендировали в 100 мл стерильного фосфатного буфера, оставляли при температуре 28С при постоянном перемешивании со скоростью вращения 120 об/мин на 1 час. Полученный раствор использовали для разведений и последующего параллельного высева на чашки Петри с агаризованной средой N, содержащей селективный субстрат – ацетонитрил, ацетамид/пропионамид в концентрации 10 мМ. На 3-7 сутки роста среди образовавшихся колоний наиболее крупные, а также морфологически различающиеся переносили на чашки Петри со свежей селективной средой. Очищенную культуру пересевали в колбы с жидкой средой аналогичного состава и культивировали микроорганизмов расти на более токсичных субстратах, таких как бензамид и бензонитрил (конечная концетрация 10 мМ).

2.4. Определение ростовых характеристик Плотность культуры оценивали по изменению оптической плотности фотоэлектроколориметре КФК-3 с использованием кварцевой 1 см кюветы, либо на спектрофотометре СФ-46 с использованием кварцевой 1 см кюветы.

Одна единица оптической плотности при 540 нм соответствует 0,42 мг сухого веса клеток (Ремезовская, 1991).

2.5. Определение ферментативной активности спектрофотометре СФ-46 по изменению оптической плотности реакционной среды при =240 нм с добавлением 15 мкл акрилонитрила на 4 мл пробы в течение одной минуты (Кузнецова, 2004).

Амидазную активность определяли по повышению проводимости на кондуктометре с добавлением 500 мкл акриламида на 10 мл пробы в течение 10 минут.

Трансформацию нитрилов с использованием биомассы выделенных штаммов проводили в 1 мл 10 мМ калий­натрий фосфатного буфера, pH 7.2, при начальной концентрации нитрила 2%. Реакция протекала параллельно при 25 и 50С в течение 10 мин и останавливалась добавлением концентрированной HCl до концентрации 2%. Пробы центрифугировали при спектрофотометрически (=240 нм), методами газовой хроматографии и ВЭЖХ.

оптической плотности реакционной среды при =240 или 260 нм в начале и в конце реакции. Оптическую плотность измеряли на спектрофотометре СФ­ (ЛОМО, СССР) (рис. 8).

Рис. 8. Спектры поглощения акрилонитрила (1), акриламида (2) и акриловой кислоты (3) в концентрации 0,01 M (Кузнецова, 2004).

Удельную активность ферментов нитрилгидратазы и амидазы выражали в мкмоль продукта реакции (амида или кислоты), образуемой за мин, в пересчете на 1 мг веса сухих клеток (мкмоль/мг/мин). Единица нитрилгидратазной активности (1 ЕД) соответствует 1 мкмоль амида/мг сухих клеток/мин.

2.6. Изучение влияния температуры и рН на удельную активность фермента Для изучения влияния температуры и рН бактерии культивировали в течение 2-3 сут., в зависимости от пика активности, на миниральной среде N с добавлением субстрата. Клетки промывали калий-натриевым фосфатным буфером. Реакцию проводили в термостатах «Термит» и термошейкерах TS100C BIOSAN (диапазон температур 5–80°С, шаг 5°С) с добавлением акриламида в течение 10 мин, останавливали добавлением 20 мкл HCl конц., затем смесь центрифугировали 10 мин при 13 тыс. об. Для изучения влияния кислотности среды на активность фермента конверсию акриламида проводили в калий-фосфатном буфере в диапазоне рН 3–12 с шагом рН=1. Продукты реакции анализировали с помощью газовой хроматографии.

Газовую хроматографию продуктов трансформации амида проводили на хроматографе Chrom 5d (LP, Чехословакия), оснащенном пламенноионизационным детектором. Хроматографическая колонка длиной 2 м и внутренним диаметром 3 мм была заполнена твердым носителем полисорб-1, фракция 0,25-0,5 мм (Реахим, Россия). Газ-носитель азот подавался с температура испарителя 22010С. В качестве стандартов использовали растворы чистых акриламида и акриловой кислоты.

2.7. Идентификация выделенных культур стандартных культурально-морфологических, биохимических и хемотаксономических характеристик по определителю бактерий Берджи (Определитель бактерий…, 1997), а также используя руководства О.А.

Нестеренко и соавт. (Нестеренко и др., 1985) и И.Б. Ившиной (Ившина и др., 1987).

Для определения группы бактерий по Граму, проводили стандартное общепринятое окрашивание, а также тест с 3% КОН.

Определение аминокислот и сахаров клеточной стенки проводили стандартными методами ТСХ. Для определения мезо-диаминопимелиновой кислоты (мезо­ДАПК) в ампулу добавляли 10 мг сухой биомассы и 0,1 мл 6Н H2SO4. Запаянную ампулу автоклавировали в течение 3 ч при 120°С. Затем вскрывали охлажденную ампулу и на хроматографическую пластинку наносили 10 мкл гидролизата. Контролем служили 0,1 М растворы мезо­ДАПК, лизина и орнитина. Для разделения аминокислот использовали дистиллированная вода : пиридин : 6Н HCl. По истечении 2-3 часов пластинку опрыскивали 0,5 % раствором нингидрина в ацетоне, высушивали и прогревали 2 минуты при 100°C. Пятна мезо­ДАПК имели оливковый цвет.

Для выявления сахаров 10 мг сухой биомассы помещали в ампулу и добавляли 0,1 мл 1Н H2SO4. Запаянную ампулу автоклавировали в течение хроматографическую пластинку Sorbfil наносили 4 мкл гидролизата. В качестве контроля использовали раствор, содержащий галактозу, глюкозу, арабинозу, ксилозу, рамнозу в концентрации 1,0 %. Для разделения сахаров бутанол : уксусная кислота : дистиллированная вода. По истечению 3-4 часов хроматограмму обрабатывали раствором, содержащим 5 г анилинфталата в 100 мл водонасыщенного бутанола. Высушивали и прогревали 4 минуты при 100°С. Пятна гексоз окрашивались в буро-коричневый цвет, пентоз ­ в розово­коричневый.

консервативным участкам генов 16S рРНК на основе анализа нуклеотидных последовательностей, приведенных в базе данных GenBank. Праймеры были синтезированны в ООО «Евроген», г. Москва (табл. 3).

R. erythropolis 7т, 17, 19, R. ruber 63, 72 и R. rhodochrous 67т из Региональной профилированной коллекции алканотрофных микроорганизмов, предоставленные чл.-корр. РАН И.Б. Ившиной (номер во Всемирной федерации коллекций культур – WFCC 768).

515F GTGCCAGCMGCCGCGGTAA

Rh1 GTGGAAAGTTTTTCGGTGCAGGATGA

Rh2 AAACCACATCTCTGCAGTCGTCCGGTA

Re1 GGTCTAATACCGGATATGACCTCCTATC

Rub1 GGATAGGACCTCGGGATGCATGTTCCG

2.8. Выделение ДНК и полимеразная цепная реакция При выполнении исследовний использованы молекулярно-генетические методы, ранее оптимизиорованные в работе Ю.А. Павловой (Павлова, 2012).

Выделение ДНК проводили фенольным методом. В центрифужных пробирках «Эппендорф» ресуспендировали клетки в количестве одной микробиологической петли в 0,5 мл раствора SSC следующего состава: NaCl 0.15 М, цитрат натрия 0.015 М, лизоцим 5 мг. Реакцию проводили 30 мин при 37 С. К полученному раствору добавляли 50 мкл 20% раствора SDS. Данная реакция протекала в термостате при 65 С в течение 10 мин. Затем добавляли фенол в количестве 0,5 мл, центрифугировали 10 мин. при 13000 об./мин.

Водную фазу переносили в новую микропробирку. Добавляли 0,5 мл хлороформа, после перемешивания центрифугировали 3 мин. при об./мин. Супернатант снова переносили в новую микропробирку, к которому добавляли 0,5 мл изопропанола, центрифугировали 13 тыс. об./мин в течение 3 мин. Смесь охлаждали при -18 С 1 ч. Центрифугировали 5 мин. при об./мин. Жидкость сливали, осадок высушивали, растворяли в 100 мкл ТЕбуфера (10 мМ трис-HCl, 1 мМ ЭДТА, рН 8.0).

ДНК грамотрицательных микроорганизмов выделяли методом кипячения. Клеточную биомассу переносили в микропробирки в количестве одной микробиологической петли. Ресуспендировали в 100 мкл стерильной Н2О. Реакцию проводили при 95°С в течение 15 минут в термостате «Термит»

(Россия).

Амплификацию ДНК проводили с применением термостабильной Taqполимеразы производства ООО «СибЭнзим» (Новосибирск) на термоциклере Т3 (Biometra, Германия).

Электрофоретическое разделение продуктов реакции проводили в 1,2 % агарозном геле в трис­боратном буфере (ТВЕ, рН 8,0) при напряженности электрического поля 6 В/см. Агарозные гели окрашивали раствором бромистого этидия (1­2 мкг/мл) в течение 15­20 мин. Для оценки молекулярной массы фрагментов ДНК использовали молекулярные маркеры 1kb и 100b (ООО «СибЭнзим»). Визуализацию полос осуществляли c использованием системы гель­документации BioDocAnalyze (Biometra, Германия).

2.9. Секвенирование ДНК Последовательность нуклеотидов анализировали с помощью системы секвенирования ДНК MegaBACE1000 (APBiotech) и APBisystems 3500 XL с использованием набора реактивов Big Dye Terminator Cycle Sequencing Kit.

2.10. Сравнительный анализ последовательностей ДНК Полученные нуклеотидные последовательности обрабатывали с помощью пакета программ MegaBACE1000 и программы Chromas lite 2.1.

Поиск гомологичных последовательностей проводили, используя базу данных GenBank. Сравнение нуклеотидных последовательностей проводили с применением программ ClustalW 2.0.9 и YACWGUI 1.2.

2.11. Гидролиз ибупрофенамида Синтез субстрата (R,S-ибупрофенамид) проведен в Лаборатории асимметрического синтеза Института органического синтеза им. И.Я.

Постовского УрО РАН г. Екатеринбург под руководством д.х.н.

В.П. Краснова. Анализ продуктов биотрансформации ибупрофенамида проведен на базе ИТХ УрО РАН и ИЭГМ УрО РАН.

Культуры выращивали в 100 мл среды в конических колбах общим объемом 250 мл. Для определения оптимального состава среды с максимальным сохранением амидазной активности использовали следующие варианты:

1. Питательный бульон LB;

2. Питательный бульон LB и 10 мМ ацетонитрил (АцН);

3. Питательный бульон LB и 10 мМ пропионамид (ПА);

4. Питательный бульон LB и 10 мМ ацетамид (АцА);

5. Синтетическая среда N, 0.1% раствор глюкозы в качестве источника углерода и 10 мМ АцН в качестве источника азота;

6. Синтетическая среда N, 0.1% раствор глюкозы в качестве источника углерода и 10 мМ ПА в качестве источника азота;

7. Синтетическая среда N, 0.1% раствор глюкозы в качестве источника углерода и 10 мМ АцА в качестве источника азота;

8. Синтетическая среда N и 10 мМ АцН в качестве источника азота и 9. Синтетическая среда N и 10 мМ ПА в качестве источника азота и 10. Синтетическая среда N и 10 мМ АцА в качестве источника азота и Критерием отбора сред служили: прирост биомассы и пик амидазной активности. В результате были отобраны питательный бульон LB с 10 мМ ацетонитрилом в качестве индуктора амидазы и минеральная среда N с добавлением 0.1% раствора глюкозы и 10 мМ ацетонитрила.

Клетки собирали центрифугированием при 4500 об/мин в течение минут и дважды промывали в калий-натриевом фосфатном буфере (рН=7.4).

добавлением ибупрофенамида до конечных концентраций – 0.25; 0.5; 1; 1.5 и 2 мМ. Общий объем составлял 1 мл. Пробы отбирали через 30 часов. Реакция проходила параллельно при 30 и 50С на закрытых шейкерах при скорости вращения 88 об/мин. Реакцию останавливали центрифугированием при об/мин в течение 5 минут.

Продукты реакции анализировали методом хромато-массспектрометрии на аппарате 689/573Т MSD (Agilent-Hewlett Packard).

Предварительно проводили экстракцию этилацетатом. Условия анализа:

капиллярная колонка HP-5MS, температура колонки начальная – 60° С ( мин), нагрев до 315° со скоростью 7°/мин. Температура испарителя 280°С, газ-носитель гелий.

2.12. Гидролиз 2,3-дигидро-7,8-дифтор-3-метил-4H-1,4-бензоксазина (N – aцетилдифторбензоксазина) Синтез субстрата (2,3-дигидро-7,8-дифтор-3-метил-4H-1,4бензоксазина) и анализ продуктов его биотрансформации проведены на базе Лаборатории асимметрического синтеза Института органического синтеза им.

И.Я. Постовского УрО РАН г. Екатеринбург под руководством д.х.н.

В.П. Краснова.

Для проведения трансформации N – aцетилдифторбензоксазина культуры выращивали на трех вариантах агаризованной среды в течение суток (среда Луриа-Бертани; минеральная среда, содержащая N – aцетилдифторбензоксазин; минеральная среда с N – aцетилдифторбензоксазином и ацетатом аммония). Реакцию проводили в микропробирках с добавлением калий-натрий фосфатного буфера (10мМ), N – aцетилдифторбензоксазина ( мг/мл), ДМСО и живых клеток, общий объем пробы составлял 1 мл, в течение 5 суток при 30С при 90 об/мин. Реакцию останавливали центрифугированием при 13 тыс. об./мин в течение 5 мин.

Продукты трансформации анализировали методом ВЭЖХ.

Подготовка проб для анализа: отделяли органический слой от водного, водный слой подщелачивали содой до pH 9, экстрагировали 3 мл дихлорметана, отделяли органический слой, объединяли органические экстракты, сушили над MgSO4, упаривали в вакууме.

коэффициента соотношения концентраций продуктов и площади пика на хроматограмме была приготовлена модельная смесь (R,S)-амида и (R,S)амина с концентрацией 1 мг/мл каждого из компонентов. Анализ проб проводили на колонке Chiralcel-OD-H, подвижная фаза гексан-iPrOH 40:1, скорость потока 1мл/мин, детектирование при 230 нм. В указанных условиях, первым элюируется (R)-амин (11,3 мин), затем (S)-амин (14,5 мин), (R)-амид (20,8 мин) и (S)-амид (45,6 мин).

2.13. Статистическая обработка повторности. При статистической обработке определяли среднее арифметическое, стандартное отклонение и доверительные интервалы.

Достоверность различий определяли с использованием t-критерия Стьюдента (Лакин, 1990).

Анализ результатов проводили с помощью прикладных программ MS Office XP Excel и Statistica 5.0.

ГЛАВА 3. ИЗУЧЕНИЕ БИОЛОГИЧЕСКОГО РАЗНООБРАЗИЯ

МИКРООРГАНИЗМОВ ПОЧВ И ДОННЫХ ОТЛОЖЕНИЙ,

ТРАНСФОРМИРУЮЩИХ АРОМАТИЧЕСКИЕ АМИДЫ И НИТРИЛЫ

аэробных бактерий почв и донных отложений Исследовано биологическое разнообразие бактерий, способных активно метаболизировать амиды и нитрилы карбоновых кислот, в образцах почв.

Было проанализировано 11 различных типов почв таёжной (Прикамье) и степной (Челябинская и Саратовская обл.) зоны России: поверхностноподзолистая супесчаная, донные речные отложения, дерново-карбонатная, дерново-луговая глеевая почвы, солодь, каштановая почва степной зоны, солончак, грунт 2 м от солеотвала, ил с очистных сооружений (табл. 4).

Исследованы наиболее богатые аэробными микроорганизмами верхние слои почв: дернина, гумусовый или элювиальный горизонт, образцы ризосферной зоны растений.

Для первичного отбора микроорганизмов использовали минеральную среду N, содержащую в качестве селективного субстрата ацетонитрил, ацетамид/пропионамид или фенилацетонитрил в качестве единственного источника углерода, азота и энергии в концентрации 10 мМ. Затем произвели очистку культур на богатой среде Луриа-Бертани. Для исследования способности к трансформации ароматических соединений использовали минеральную среду N, содержащую в качестве селективного субстрата бензонитрил или бензамид в концентрации 10 мМ, в качестве источника углерода – 0,1% глюкозу.

Результаты получены совместно с с.н.с. ИЭГМ УрО РАН, к.б.н. Кузнецовой М.В.

Места отбора образцов почв и выделенные из них штаммы Аллювиальная Нытвенский р-н Пермского края, R. erythropolis 416* Дерново-луговая с Нытвенский р-н Пермского края A. tumefaciens М Дерново-луговая с Краснокамский р-н Пермского Pseudomonas sp. 31f, Грунт 2 м от Соликамский р-н Пермского края R. erythropolis степной зоны Подзолистая Соликамский р-н Пермского края R. erythropolis Донные отложения Очистные сооружения г.Перми Acinetobacter guillouiae 22ио * Штаммы из лабораторной коллекции, выделенные ранее Было выделено более 300 изолятов микроорганизмов, обладающих способностью к биотрансформации нитрилов и амидов, определено их количество, а также общее число гетеротрофов. Исследования показали, что культуры бактерий, способные активно трансформировать нитрилы и амиды, представлены во всех исследованных типах почв (рис.9).

Рис. 9. Соотношение общего количества культивируемых аэробных гетеротрофов и бактерий, утилизирующих нитрилы и амиды в почвах Наибольшее количество гетеротрофных микроорганизмов обнаружено в образцах отбранных из гумусового дернового горизонта (на глубине 5 см) дерново-луговой почвы с повышенным увлажнением (2,931010 КОЕ). Много гетеротрофов содержалось также в пробах солончака, отобранных в Челябинской области (2,171010 КОЕ) и в пробах грунта в 2 м от солеотвала СКРУ-2 г. Соликамск (2,68109 КОЕ). Очевидно, что это соответствует образцам с наилучшим соотношением питательных веществ, аэрации и увлажнения. Е.В. Даденко и М.А. Репях сообщают, что по обогащенности почв бактериями на МПА солонцы и солончаки отнесятся к богатым почвам (Даденко, Репях, 2006).

Бактерии, активно трансформирующие амиды и нитрилы, обнаружены во всех исследованных почвах и донных отложениях в количестве 105- КОЕ/г сухой почвы, что составляет от 0,05 до 48,1% (переходный горизонт дерново-луговой почвы с повышенным увлажнением, глубина отбора проб см) от общего числа гетеротрофов.

Наибольшим абсолютным количеством амид-трансформирующих бактерий отличались пробы солончака, отобранные в Челябинской области (3,11х107 КОЕ), образцы из гумусового переходного горизонта дерноволуговой почвы с повышенным увлажнением, г. Краснокамск (2,89107 КОЕ) и пробы грунта в около солеотвала (2,32107 КОЕ), а наибольшее количество нитрил-трансформирующих бактерий обнаружено в последних двух из них (3,08х107 и 7,50107 КОЕ). В большинстве образцов почв количество амид и нитрилтрансформирующих бактерий было примерно равным или соотносимым. Это свидетельствует в пользу координированного метаболизма нитрилов и амидов в экосистемах. Кроме того, было показано, что до 86% изолятов, трансформирующих амиды были способны к метаболизму и нитрильных соединений. Преобладание амидтрансформирующих бактерий наблюдалось в образцах гумусового горизонта дерново-луговой почвы и солончака, что может быть связано с повышенным увлажнением данных образфов почв, при котором образцы содержат большое количество грамотрицательных бактерий, среди которых распространена способность активно метаболизировать амидосоединения.

Однако в относительном выражении образцы солончака, гумусового горизонта дерново-луговой почвы с повышенным увлажнением и солоди амидтрансформирующих бактерий.

Фенилацетонитрил-утилизирующие бактерии представлены во всех типах почв. Наибольшее их количество обнаружено в образцах, отбранных на глубине 5 см дерново-луговой почвы с повышенным увлажнением (3,68106), а также в пробах подзолистой супесчаной почвы (6,25105). Высокая степень встречаемости бактерий, вероятно, связано с тем, что растения продуцируют многие нитрильные соединения, в том числе и фенилацетонитрил (Banerjee et al., 2002; Howden, Preston, 2009; Chen et al., 2009).

3.2. Отбор культур, активно трансформирующих ароматические амиды и нитрилы Для дальнейшей работы были отобраны 57 штаммов наиболее быстрорастущих культур аэробных микроорганизмов. Исследовали способность микроорганизмов к росту на алифатических (ацетонитрил, пропионамид) и более токсичных ароматических (бензонитрил, бензамид и фенилацетонитрил) субстратах в концентрации 10 мМ. Установлено, что наибольшее предпочтение изоляты отдавали минеральной среде с добавлением пропионамида в качестве источника азота. Наименьшее – средам с ацетонитрилом, бензонитрилом, бензамидом и фенилацетонитрилом.

Однако несколько штаммов (25, 26, 30ф, 31ф, 34ф, 35ф) активно росли как на алифатических, так и на ароматических субстратах (табл. 5).

Результаты получены лично.

Рост бактерий на различных субстратах (амидах и нитрилах) R. erythropolis В 15* + + + +/рост бактерий; ** - активный рост; *** - отсутствие роста; **** слабовыраженный рост.

3.3. Идентификация активных штаммов По совокупности морфологических признаков, результатов теста с КОН, биохимических признаков, а также ПЦР-анализа установлено, что штаммы, имеющие высокую активность, представлены как грамположительными, так и грамотрицательными бактериями.

Для изучения хемотаксономических признаков культуры выращивали в аэробных условиях на среде Луриа-Бертани. Диагностические аминокислоты модификациями.

Определено соотношение различных групп бактерий, обладающих способностью трансформировать нитрилы и амиды (рис. 10).

Рис. 10. Процентное соотношение изолятов, обладающих системой Результаты получены лично.

Показано, что наибольшую часть активных изолятов составляли актинобактерии видов R. erythropolis (20%), R.rhodochrous (9%), а также рода Arthrobecter (2%);

представители P. fluorescens (7%), P. putida (8%), а также другие представители рода Pseudomonas и бактерии рода Agrobacterium – 2%, Acinetobacter – 3%.

Для культур рода Pseudomonas (2нх, 3нх, 9нх, 10нх, 105, 146, 31f, 34f, 35f) характерны следующие признаки: клетки не изменяются по морфологии в течение жизненного цикла и представляют собой мелкие, одиночные подвижные палочки правильной формы с закругленными концами, образующие круглые, ровные, выпуклые глянцевые колонии коричневатого оттенка среднего или крупного размеров (табл. 6).

Идентификация грамотрицательных бактерий Образование Принадлежность грамотрицательных штаммов к роду Pseudomonas родоспецифичными праймерами к генам 16S рРНК (рис. 11).

Рис. 11. Продукты амплификации с праймерами к гену 16S РНК Методами полифазной таксономии, а также путем секвенирования генов 16S рРНК на аппарате MegaBACE1000 и APBisystems 3500 XL изоляты грамотрицательных бактерий идентифицированы как представители рода Pseudomonas, в том числе видов Pseudomonas fluorescens и Pseudomonas putida (рис. 12).

Бактерии рода Agrobacterium (М1, М3) образуют выпуклые, гладкие колонии округлой формы, светло-бежевого цвета. Палочки, одиночные или в парах, спор не образуют, оксидазо- и каталазоположительные.

последовательностей ПЦР-фрагмента ДНК, в результате которого было установлено, что нуклеотидные последовательности исследуемых штаммов гомологичны на 100% последовательностям генов 16S рРНК Agrobacterium tumefaciens из базы данных GenBank.

Рис. 12. Сравнение нуклеотидных последовательностей ПЦР-фрагмента штамма С3кр и генов 16S рРНК Pseudomonas sp. из базы данных GenBank.

FJ796428 - P. frederiksbergensis, FJ845040 - P. fluorescens, AB494443 - P. veronii, FJ845016 - P. fluorescens, FJ805446 - P. putida, FJ807483 - P. fulva, AB449026 - P. aeruginosa, FJ823152 - P. aeruginosa, FJ538211 - P. aeruginosa, DQ842018 - P. lubricans, FJ828671 - P. mendocina Штамм 22ио определен как представитель рода Acinetobacter: палочки, в стационарной фазе роста становятся сферическими, в парах или цепочках, спор не образуют, оксидазоположительные и каталазротрицательные.

секвенирования последовательностей ПЦР-фрагмента ДНК, в результате исследуемого штамма гомологичны на 100% последовательностям генов 16S рРНК Acinetobacter guillouiae из базы данных GenBank (рис. 13).

Секвенирование выполнялось совместно с м.н.с. ЛММБ ИЭГМ УрО РАН к.б.н. Павловой Ю.А.

Рис. 13. Сравнение нуклеотидных последовательностей ПЦР-фрагмента штамма 22ио и генов 16S рРНК Acinetobacter sp. из базы данных GenBank Культуры отнесены к роду Rhodococcus на основании следующих признаков: грамположительные клетки с выраженным клеточным циклом, формируют на плотных средах круглые, гладкие или шероховатые, кремовые Секвенирование выполнялось совместно с м.н.с. ЛММБ ИЭГМ УрО РАН к.б.н. Павловой Ю.А.

(2н, 3н, 6РИ, 7РИ, 25, 26, 37, 5212, 7-1, В15), розово-красные (38, 43, 12и, М16, 155), желтые (21, М6) колонии, в гидролизатах клеток исследуемых штаммов были обнаружены мезо­диаминопимелиновая кислота, арабиноза, галактоза (табл.7).

Идентификация грамположительных бактерий Образование кислоты при росте на углеводах и многоатомных спиртах Сахара клеточной стенки Таксономическая принадлежность грамположительных штаммов была видоспецифичными праймерами к генам 16S рРНК R. rhodochrous, R. erythropolis и R. ruber. В качестве контроля использовали ДНК коллекционных штаммов R. erythropolis ИЭГМ 7T, R. rhodochrous ИЭГМ 62T и коллекции алканотрофных микроорганизмов (WFCC 768), а также ДНК ранее микробиологии и биотехнологии ИЭГМ УрО РАН штаммов R. Rhodochrous 1185, R. erythropolis 416 и R. ruber В15.

Штаммы 2н, 3н, 4РИ, 6РИ, 7РИ,25, 26, 37, 5212, 7-1, 13 (рис. 14) отнесены к виду R. erythropolis, а штаммы 43, М16, 38, 12и (рис. 15) идентифицирован как R. rhodochrous. Только один штамм принадлежал к виду R.ruber (рис. 16).

Рис. 14. Продукты амплификации с праймерами к генам 16S РНК Рис. 15. Продукты амплификации с праймерами к генам 16S РНК Рис. 16. Продукты амплификации с праймерами к генам 16S РНК Путем секвенирования генов 16S рРНК было подтверждено, что грамположительные штаммы 3н, 6РИ и 7РИ на 98% соответствуют генам 16S рРНК R. erythropolis из базы данных GenBank (рис. 17).

Рис. 17. Сравнение нуклеотидных последовательностей ПЦР-фрагмента штаммов 3н, 6РИ и 7РИ и генов 16S рРНК R. erythropolis В результате секвенирования ПЦР-фрагмента 16S рДНК штаммов М6 и 21и установлено, что нуклеотидные последовательности исследуемого штамма гомологичны на 100% последовательностям генов 16S рРНК R.

fascians из базы данных GenBank (рис. 18).



Pages:   || 2 |
 
Похожие работы:

«ДЖАМБЕТОВА ПЕТИМАТ МАХМУДОВНА ГЕНЕТИЧЕСКИЕ ПОСЛЕДСТВИЯ ЗАГРЯЗНЕНИЯ ОКРУЖАЮЩЕЙ СРЕДЫ НЕФТЕПРОДУКТАМИ В ЧЕЧЕНСКОЙ РЕСПУБЛИКЕ 03.02.07 – генетика Диссертация на соискание ученой степени доктора биологических наук Научные консультанты: доктор биологических наук, профессор Сычева Л.П.; доктор биологических наук Рубанович А.В. Грозный –  ...»

«Сабанцев Антон Владимирович Молекулярные механизмы действия белков FtsZ, виллина и системы рестрикции-модификации Esp1396I, исследованные флуоресцентными методами. 03.01.02 – биофизика Диссертация на соискание ученой степени кандидата физико-математических наук Научный руководитель : к.ф.-м.н. Ходорковский...»

«Цатурян Людмила Дмитриевна Функциональное состояние сердечно-сосудистой системы организма детей с учетом их конституциональных особенностей 03.00.13 – физиология 14.00.09 – педиатрия диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор Бутова О.А. доктор медицинских наук, профессор Калмыкова А.С. Ставрополь – ОГЛАВЛЕНИЕ Стр. Список сокращений Введение Глава 1....»

«Пищелко Анна Олеговна МОЛЕКУЛЯРНО-ЦИТОГЕНЕТИЧЕСКИЙ АНАЛИЗ ДНК РАЙОНА ПРИКРЕПЛЕНИЯ ХРОМОСОМЫ 2 L К ЯДЕРНОЙ ОБОЛОЧКЕ ТРОФОЦИТОВ ЯИЧНИКОВ МАЛЯРИЙНОГО КОМАРА ANOPHELES BEKLEMISHEVI (DIPTERA, CULICIDAE) Генетика – 03.02.07 Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель д–р биол. наук, профессор В.Н. Стегний МОСКВА – ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ...»

«СЕРГЕЕВА ЛЮДМИЛА ВАСИЛЬЕВНА ПРИМЕНЕНИЕ БАКТЕРИАЛЬНЫХ ЗАКВАСОК ДЛЯ ОПТИМИЗАЦИИ ФУНКЦИОНАЛЬНО-ТЕХНОЛОГИЧЕСКИХ СВОЙСТВ МЯСНОГО СЫРЬЯ И УЛУЧШЕНИЯ КАЧЕСТВА ПОЛУЧАЕМОЙ ПРОДУКЦИИ Специальность 03.01.06 – биотехнология ( в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Доктор биологических наук, профессор Кадималиев Д.А. САРАНСК ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.....»

«ДУБИННЫЙ Максим Анатольевич ПРОСТРАНСТВЕННАЯ СТРУКТУРА ЦИТОТОКСИНОВ NAJA OXIANA И ИХ ВЗАИМОДЕЙСТВИЕ С МИЦЕЛЛАМИ И БИОМЕМБРАНАМИ Специальность 03.00.02 — БИОФИЗИКА Диссертация на соискание учёной степени кандидата физико–математических наук Научный руководитель доктор химических наук Арсеньев А.С. Москва 2006 2 Работа выполнена в лаборатории структурной биологии Института Биоорганической Химии им. М.М....»

«Ильичева Екатерина Юрьевна МЕХАНИЗМЫ ВЛИЯНИЯ ИОНОВ СЕРЕБРА НА МЕТАБОЛИЗМ МЕДИ МЛЕКОПИТАЮЩИХ 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор Н. В. Цымбаленко Санкт-Петербург, ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ОБЗОР...»

«ЧИСТЯКОВА АННА АЛЕКСАНДРОВНА Оптимизация технологии получения иммуногенного мембранного протеина B r u c e l l a a b o r t u s в растительных клетках 03.00.00 - Биологические наук и Диссертация на соискание академической степени доктора PhD Члены консультационной комиссии: Научный руководитель : д.м.н., проф. Алмагамбетов К.Х. Научный консультант : Prof. Dr. Heribert Warzecha Республика Казахстан Астана,...»

«Дмитриева Алла Викторовна НАСЛЕДСТВЕННЫЕ АНГИОНЕВРОТИЧЕСКИЕ ОТЕКИ: ГЕНЕТИЧЕСКИЕ АСПЕКТЫ, ДИФФЕРЕНЦИАЛЬНАЯ ДИАГНОСТИКА 14.03.09 – клиническая иммунология, аллергология 03.02.07 – генетика Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: Доктор медицинских наук, профессор Т.В. Латышева Доктор...»

«ДЕМАКОВА Наталья Александровна ИЗУЧЕНИЕ РОЛИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ЦИТОКИНОВ В ФОРМИРОВАНИИ ГИПЕРПЛАСТИЧЕСКИХ ПРОЦЕССОВ ЭНДОМЕТРИЯ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель : доктор медицинских наук, профессор Чурносов Михаил Иванович Белгород – СОДЕРЖАНИЕ Стр. ВВЕДЕНИЕ..5- ГЛАВА 1. Обзор литературы..11- 1.1. Молекулярные...»

«Беляева Екатерина Андреевна Микробиота кишечника коренного жителя Центрального федерального округа РФ как основа для создания региональных пробиотических препаратов 03.02.03 – микробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор...»

«Захаров Алексей Борисович Дендроиндикация загрязненности окружающей среды урбанизированных территорий на примере искусственных популяций сосны обыкновенной (Pinus sylvestris L.) Балахнинской низменности 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель :...»

«Петренко Дмитрий Владимирович Влияние производства фосфорных удобрений на содержание стронция в ландшафтах Специальность 03.02.08 - экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор Белюченко Иван Степанович Москва – 2014 г. Содержание Введение Глава 1. Состояние изученности вопроса и цель работы 1.1...»

«Тишкова Антонина Сергеевна ИССЛЕДОВАНИЯ МОРФОЛОГИЧЕСКИХ ОСОБЕННОСТЕЙ ХРУСТАЛИКА ГЛАЗА С ДИАБЕТИЧЕСКОЙ И ВОЗРАСТНОЙ КАТАРАКТАМИ 03.01.02 – биофизика 14.01.07 – глазные болезни Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители:...»

«КОЦАРЬ Александр Геннадьевич МАТЕМАТИЧЕСКОЕ МОДЕЛИРОВАНИЕ И АЛГОРИТМИЗАЦИЯ ПРОГНОЗИРОВАНИЯ, ДИАГНОСТИКИ, ПРОФИЛАКТИКИ И ЛЕЧЕНИЯ МОЧЕКАМЕННОЙ БОЛЕЗНИ Специальность 03.01.09 -Математическая биология, биоинформатика (медицинские наук и) Диссертация на соискание ученой степени доктора медицинских наук Научный консультант : доктор медицинских наук Серегин Станислав Петрович Курск - СОДЕРЖАНИЕ ВВЕДЕНИЕ 1. АНАЛИТИЧЕСКИЙ ОБЗОР...»

«Дедков Виталий Николаевич РАЗРАБОТКА БИОТЕХНОЛОГИИ КОРМОВОГО БЕЛКА ИЗ РАСТИТЕЛЬНОГО СЫРЬЯ Специальность 03.01.06 – Биотехнология (в том числе бионанотехнологии) Диссертация на соискание учёной степени кандидата технических наук Научный руководитель : доктор биологических...»

«Байгильдина Асия Ахметовна ОСОБЕННОСТИ МЕТАБОЛИЗМА И СТРУКТУРНОФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ ЭНДОТЕЛИЯ ПРИ ГЕМОРРАГИЧЕСКОЙ ЛИХОРАДКЕ С ПОЧЕЧНЫМ СИНДРОМОМ 03.01.04 – биохимия Диссертация на соискание ученой степени доктора медицинских наук Научный консультант : доктор медицинских наук,...»

«ТИКУНОВА Евгения Викторовна РОЛЬ ГЕНЕТИЧЕСКИХ ПОЛИМОРФИЗМОВ ФАКТОРОВ НЕКРОЗА ОПУХОЛЕЙ И ИХ РЕЦЕПТОРОВ В РАЗВИТИИ ПЕРВИЧНОЙ ОТКРЫТОУГОЛЬНОЙ ГЛАУКОМЫ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель : доктор медицинских наук, профессор Чурносов Михаил Иванович Белгород – СОДЕРЖАНИЕ Стр. ВВЕДЕНИЕ ГЛАВА 1. Обзор литературы 1.1. Молекулярные...»

«Гималов Фуат Рамазанович СИГНАЛЬНАЯ РЕГУЛЯЦИЯ ЭКСПРЕССИИ ГЕНОВ ЗАЩИТНЫХ БЕЛКОВ РАСТЕНИЙ ПРИ ХОЛОДОВОМ СТРЕССЕ 03.01.04 – биохимия Диссертация на соискание ученой степени доктора биологических наук Научный консультант : доктор биологических наук, профессор В.А.Вахитов Уфа – 2014 СОДЕРЖАНИЕ Список сокращений ВВЕДЕНИЕ ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ...»

«УДК: 579.846.2[063+22+26](043) НАМСАРАЕВ Зоригто Баирович МИКРОБНЫЕ СООБЩЕСТВА ЩЕЛОЧНЫХ ГИДРОТЕРМ. Специальность 03.00.07. – микробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор В.М. Горленко МОСКВА – 2003 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ОБЗОР ЛИТЕРАТУРЫ 1.1. Характеристика основных типов щелочных гидротерм 1.1.1. Основные типы щелочных гидротерм...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.