WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 | 3 |

«РАЗРАБОТКА СРЕДСТВ ДИАГНОСТИКИ ВЫСОКОВИРУЛЕНТНОГО ШТАММА ВИРУСА ГРИППА А ПОДТИПА Н5N1 ...»

-- [ Страница 1 ] --

РОССИЙСКИЙ УНИВЕРСИТЕТ ДРУЖБЫ НАРОДОВ

На правах рукописи

Аканина Дарья Сергеевна

РАЗРАБОТКА СРЕДСТВ ДИАГНОСТИКИ

ВЫСОКОВИРУЛЕНТНОГО ШТАММА ВИРУСА ГРИППА А

ПОДТИПА Н5N1

03.02.02 – вирусология

Диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель Д.б.н., профессор Гребенникова Т. В.

Москва - 2014

ОГЛАВЛЕНИЕ

Список использованных сокращений

1. Введение

2. Обзор литературы

2.1. Описание заболевания

2.2. Общая характеристика вируса гриппа

2.3. Эпидемиология вируса гриппа А подтипа H5N1

Передача вируса

Клинические проявления.

Патогенез.

2.4. Способы диагностики вируса гриппа

2.4.3. Иммуноферментный анализ

2.4.4. Молекулярные методы

2.4.4.1. Полимеразная цепная реакция

2.4.4.2. Полимеразная цепная реакция в реальном времени.................. 3. Материалы и методы

3.1. Материалы

3.2. Методы

4. Результаты

4.1. Разработка тест-системы для обнаружения и дифференциации РНК вируса гриппа А подтипа Н5N1 методом ПЦР.

4.1.1. Подбор праймеров, оптимизация условий проведения ПЦР.......... 4.1.2. Определение специфичности ПЦР тест-системы.

4.1.3. Определение чувствительности ПЦР тест-системы

4.1.4. Конструирование генно-инженерного положительного контроля для ПЦР тест-системы

4.2. Разработка тест-системы для обнаружения вируса гриппа А подтипа H5N1 методом ПЦР в реальном времени.

4.2.1. Подбор праймеров, оптимизация условий проведения ПЦР.......... 4.2.2. Определение специфичности тест-системы на основе ПЦР в реальном времени.

4.2.3. Определение чувствительности разработанной тест-системы на основе ПЦР в реальном времени.

4.2.4. Конструирование генно-инженерного положительного контроля для тест-системы на основе ПЦР в реальном времени

4.3. Разработка теста для количественного определения вируса гриппа А подтипа H5N1





4.3.1. Использование количественного теста для определения накопления рекомбинантного вируса гриппа А/ H5N1, полученного методом обратной генетики.

4.4. Участие в международной интеркалибрации WHO External Quality Assessment Programm (EQAP)

4.5. Использование разработанных тест-систем для выявления вируса гриппа А подтипа H5N1

4.6. Разработка тест-системы на основе непрямого ИФА для обнаружения антител к неструктурному белку вируса гриппа NS1.

4.6.1. Создание рекомбинантного белка NS1 вируса гриппа.

4.6.2. Проведение непрямого ИФА с рекомбинантным белком NS1....... 5. Обсуждение результатов.

6. Выводы

7. Библиография

8. Приложения

Список использованных сокращений ПЦР – полимеразная цепная реакция РНК – рибонуклеиновая кислота ИФА – иммуноферментный анализ HA – гемагглютинин NA – нейраминидаза КЭ – куриные эмбрионы АГ - антиген мРНК – матричная рибонуклеиновая кислота РСК – реакция связывания комплемента РТГА – реакция торможения гемагглютинации ДНК – дезоксирибонуклеиновая кислота дНТФ - дезоксинуклеотидтрифосфат ОТ/ПЦР – полимеразная цепная реакция с предшествующей реакцией обратной транскрипции ПЦР-РВ – полимеразная цепная реакция в реальном времени кДНК – комплементарная дезиксирибонуклеиновая кислота ЕФ – европейская фармакопея ФСП – фармакопейная статья предприятия СТО – стандарт организации ЭДТА – этилендиаминтетрауксусная кислота ЭИД – эмбриональная инфекционная доза п.н. – пара нуклеотидов ПААГ – полиакриламидный гель мАТ – моноклональные антитела ВЖХ – высокоэффективная жидкостная хроматография ЯМР - ядерный магнитный резонанс ВОЗ – всемирная организация здравоохранения WHO – world health organization (всемирная организация здравоохранения) Актуальность проблемы.

Вирус гриппа А подтипа H5N1 – высоко патогенный вирус «птичьего гриппа» – впервые инфицировал человека в 1997 году во время вспышки болезни среди птиц в Гонконге (Claas et.al.,1998; Shortridge et al.,1998). В 2003 и 2004 годах этот вирус распространился из Азии в Европу и Африку и циркулировал среди домашних птиц во многих странах, что привело к сотням случаев заболевания людей, в том числе и со смертельныи исходом (Guan et al., 2009). Вспышки болезни среди домашних птиц оказывают серьезное воздействие на экономику и международную торговлю в пораженных странах. Продолжающаяся циркуляция вирусов H5N1 среди домашних птиц, особенно там, где этот вирус является эндемическим, попрежнему представляет угрозу для общественного здравоохранения (Menno D. de Jong, 2006; WHO, 2011), так как эти вирусы обладают не только способностью вызывать тяжелое заболевание у людей, но и преодолевать межвидовой барьер (Каверин Н.В., 2003; Webster et al., 2007; Manz et al., 2013).

9 января 2014 года ВОЗ сообщила о подтверждённом случае заболевания гриппом, вызванным вирусом А/H5N1 в Канаде у человека, приехавшего из Пекина, Китай. Всего в мире с 1997 года зарегистрировано 649 случаев заболевания людей гриппом, вызванным вирусом H5N1, 385 из которых закончилось смертью. Таким образом, смертность от гриппа, вызванным вирусом H5N1 составляет почти 60% (WHO, 2014). В нашей стране пока не зарегистрировано ни одного случая заболевания человека гриппом, вызванным вирусом H5N1. Первая вспышка «птичьего гриппа»





среди домашней птицы в России произошла в июле 2005 года в Новосибирской области (Львов и др., 2005) и была связана с миграцией водоплавающих птиц из Азиатских стран на территорию нашей страны.

идентификации и типирования вирусов гриппа А не только для облегчения наблюдения за пандемическим потенциалом вируса «птичьего гриппа», но и для улучшения контроля и лечения инфицированных пациентов (Sakurai, 2012).

рекомендованные ВОЗ, играют ключевую роль в выявлении и типировании вирусов гриппа (Alexander, 2008, Thanh et al., 2010). Совокупность чувствительных и специфичных современных отечественных тест-систем для качественного и количественного выявления генома вируса гриппа H5N1 на основе ПЦР и ПЦР в реальном времени, а также методов выявления антител к данному вирусу могут существенно облегчить экологический мониторинг с целью предупреждения возможной пандемии (C.A. Russell, 2012.).

Цели и задачи исследования Целью исследования была разработка и усовершенствование методов лабораторного выявления вируса гриппа А подтипа H5N1 и антител к нему.

1. Разработать и оптимизировать молекулярно-генетический метод обнаружения вируса гриппа А подтипа H5N1 и дифференциации его от других подтипов вируса гриппа А и других вирусов на основе ПЦР, проверить чувствительность и специфичность и на основании этих данных создать «Тест-систему для обнаружения и дифференциации вируса гриппа А подтипа H5N1 методом ПЦР» и нормативную документацию к ней (СТО и Инструкцию по применению);

2. Разработать и оптимизировать молекулярно-генетический метод обнаружения и количественного определения вируса гриппа А подтипа H5N и дифференциации его от других подтипов вируса гриппа А и других вирусов на основе ПЦР в реальном времени, проверить его чувствительность и специфичность;

3. Разработать генно-инженерные положительные контроли на основе плазмиды pGEM-T Easy, содержащие клонированные участки генома вируса гриппа А подтипа H5N1;

4. Показать возможность использования метода количественного определения содержания РНК вируса гриппа А подтипа H5N1 для контроля на стадиях получения рекомбинантных вирусов гриппа методом обратной генетики.

5. Показать возможность использования разработанных тест-систем для обнаружения и дифференциации высоковирулентного вируса гриппа А подтипа H5N1 в биологических образцах от птиц, собранных в различных регионах РФ;

6. Получить рекомбинатный белок NS1 на основе вектора pET32b+ с последующей химической трансформацией штамма E. Coli BL21trxB(DE3)pLysS, накоплением и выделением методом метало-хелатной аффинной хроматографией с использованием Ni-NTA агарозы.

7. Разработать методику обнаружения антител к рекомбинантному неструктурному белку NS1 вируса гриппа А подтипа H5N1 на основе непрямого ИФА.

Созданы отечественные тест-системы на основе ПЦР и ПЦР-РВ для диагностики вируса гриппа А подтипа H5N1 с учетом генотипов вируса, циркулирующих на территории Российской Федерации. Достигнута высокая эффективность применения молекулярно-генетических методик мониторинга вируса гриппа А подтипа H5N1 среди диких и домашних птиц в различных районах РФ. Разработанные тест-системы являются универсальными и позволяют детектировать все известные на сегодняшний день генотипы вируса гриппа А подтипа H5N1.

Получен Российский патент № 2361924 «Способ обнаружения вируса гриппа А подтипа H5N1».

Разработки могут быть использованы в лабораториях Научноисследовательских институтов в целях изучения эволюции вируса гриппа А подтипа H5N1 для предупреждения возможной пандемии.

Впервые показана возможность использования метода количественного определения содержания РНК вируса гриппа А подтипа H5N1 методом ПЦР в реальном времени для контроля получения рекомбинантного вируса гриппа H5N1 методом обратной генетики.

Показана возможность применения непрямого ИФА для обнаружения антител к неструктурному белку NS1 вируса гриппа А подтипа H5N1 для дифференциации инфицированных и вакцинированных инактивированной вакциной птиц.

Практическая значимость Для «Тест-системы для обнаружения и дифференциации вируса гриппа А подтипа H5N1 методом ПЦР» разработаны СТО 42418073-0001-2007 и Инструкция по применению от 21. 05. 2009 №1-4.7/02562, которые утверждены в Министерстве Сельского хозяйства РФ. Данная тест-система сертифицирована во Всероссийском Государственном Центре качества и стандартизации лекарственных средств для животных и кормов (ФГБУ «ВГНКИ»), сертификат соответствия № РОСС RU.ФВ01.Н26634.

Разработанные тест-система и методики на основе ПЦР и ПЦР в реальном времени использованы при проведении Международной интеркалибрации WHO External Quality Assessment Programm (EQAP) по молекулярной диагностике гриппа в 2007-2011 г.г. Получен международный сертификат от 31. 10. 2011 г.

Сконструированные генно-инженерные положительные контроли, содержащие фрагменты генома вируса гриппа А подтипа Н5N1, могут быть использованы в лабораторных и коммерческих тест-системах для качественного и количественного контроля определения генома высоковирулентного вируса гриппа А подтипа H5N1 в научных и клинических лабораториях.

Разработанные методики и «Тест-система для диагностики вируса гриппа А подтипа H5N1 методом ПЦР» используются в региональных ветеринарных лабораториях, в диагностических лабораториях Роспотребнадзора и Минсельхоза РФ для проведения мониторинга вируса гриппа А подтипа H5N1. Тест-системы могут также быть использованы для проведения научно-практических занятий в Университетах и Институтах Министерства Образования РФ.

Апробация работы.

Основные положения диссертационной работы доложены и обсуждены на конференциях, конгрессах, съездах:

Международной научной конференции «Профилактика, диагностика и (Ульяновск, 2006); итоговой конференции СНО медицинского факультета РУДН «Клинические и теоретические аспекты современной медицины (Москва, 2007г); IV Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика - 2007» (Москва, 2007); Всероссийской научно-практической конференции, посвященной памяти профессора Ю.М. Кубицкого «Современные проблемы медикокриминалистических, судебно-химических и химико-токсикологических экспертных исследований» (Москва, 2007); научно-практической конференции с международным участием «Современные проблемы инфекционной патологии человека» (Минск, 2012).

Публикации.

По материалам диссертации опубликовано 18 научных работ, в том числе 8 статей в журналах, входящих в перечень периодических изданий, рекомендуемых ВАК, 1 патент РФ.

Объем и структура диссертации.

Материалы диссертации изложены на 161 страницах машинописного текста.

Работа состоит из введения, обзора литературы, описания материалов и методов, изложения собственных результатов и их обсуждения, выводов, списка цитируемой литературы, включающего 148 источников. Работа содержит 11 таблиц и 30 рисунков, 4 приложения.

Вирус гриппа А широко распространен в природе и способен вызывать эпидемии, пандемии и эпизоотии (Слёпушкин А.Н., 2001). Вирус гриппа А отличается высокой степенью вариабельности, особенно это касается поверхностных гликопротеинов вириона: гемагглютинина (НА) и нейраминидазы (NA). Известно 15 антигенных подтипов гемагглютинина (Н1-Н15) и 9 подтипов нейраминидазы (N1-N9). От диких птиц изолированы вирусы со всеми известными сочетаниями поверхностных белков, при этом инфекция у диких птиц протекает в виде энтерита, без видимых признаков заболевания. Это указывает на высокую степень адаптации вирусов гриппа А к диким птицам, которые являются естественными хозяевами вирусов гриппа (Zambon M. C., 1999). Вирус сохраняется в воде в течение длительного времени (6-8 месяцев), а водно-фекальный путь инфицирования является основным механизмом поддержания персистенции вируса гриппа в природе (WHO,2005).

В 20 веке отмечены четыре пандемии: 1918 (H1N1), 1957 (H2N2), (H3N2) и 1977 (H1N1), причем две (1957 и 1968 гг.) как и пандемия 2009годов вируса гриппа свиней H1N1 были обусловлены новыми реассортантными вирусами (ВОЗ, 2005; Львов Д.К., 2010; Даниленко Д.М., 2011; Игнатьева А.В., 2011).

За последние 45 лет описано свыше 50 эпизодов возникновения эпизоотий среди домашних животных в ряде случаев сопровождающихся заболеванием людей, подчас с высокой смертностью.

Вирусы H5N1 периодически выделялись от кур и других видов птиц. В 1997 году в Гонконге отмечена вспышка заболевания, обусловленная прямой передачей вируса гриппа птиц H5N1 от кур человеку (Subbarao K.,1998; Claas E.C., 1998; de Jong J.C., 1997.).

Это был первый подтвержденный случай передачи вируса гриппа от птиц человеку. В результате заболело 18 человек, 6 из которых умерли.

Второй подобный эпизод отметили в 2003 г. в Гонконге, когда из пяти инфицированных людей двое умерло.

Начиная с 2003 года высокопатогенный вирус гриппа А подтипа H5N начинает распространяться благодаря диким и домашним птицам через Азию по Европе и Африке и заражать людей, контактировавших с домашними птицами (Webster R.G., 2006; Gambotto A., 2008; Maines T.R., 2005.).

С 2005 года вспышки заболевания гриппом птиц H5N1 фиксировались во многих странах Азии и ближнего востока. На сегодняшний день в Индонезии произошел, в общей сложности, 191 случай заболевания людей птичьим гриппом A(H5N1), из которых 159 случаев закончились смертельным исходом. Из этого числа 8 случаев (все смертельные) произошли в 2012 году. По данным на конец мая 2012 года в Камбодже отмечен 21 случай заражения людей вирусом птичьего гриппа, 19 из которых с летальным исходом. Из 168 подтвержденных случаев заболевания в Египте, 60 закончились смертельным исходом (ВОЗ, 2013).

Отмечается также заражение людей вирусом гриппа H7N7 (Belser J.A., 2009). Так, в 1996 году, вирус гриппа птиц H7N7 был изолирован в Канаде от женщины с конъюнктивитом. Отмечено инфицирование людей вирусом гриппа H7N7 во время вспышки гриппа птиц в Нидерландах (Koopmans M., 2004; Fouchier R.A., 2004.).

Для вируса гриппа птиц и его реассортантов отмечали частые случаи преодоления видового барьера (Brown I.H., 2008; Yassine H.M., 2013).

Зарегистрированы вспышки заболевания свиней, обусловленные вирусами гриппа птиц H1N1, лошадей H3N8, китов (Н7N7, H5N5 и H4N6, H13N2 и H13N9), норок (Н10N4). Отмечены случаи инфицирования домашних птиц (кур, индюков) вирусами гриппа, циркулирующими среди диких птиц, особенно водоплавающих.

2.2. Общая характеристика вируса гриппа Возбудители вируса гриппа – РНК-содержащие вирусы, относящиеся к роду вирусов гриппа А и В, семейства Orthomyxoviridae. Высокая контагиозность и исключительная изменчивость поверхностных белков вирусов гриппа явились причинами их повсеместного распространения (de Jong M.D., 2006). На данный момент вирусы представлены согласно номенклатуре 16 подтипами гемагглютинина и 9 нейраминидазы (Поздеев О.К., 2009).

мукополисахаридам и гликопротеидам (в частности, с клеточными рецепторами, содержащими сиаловую кислоту) (Webster R.G., 1992). Кроме того, имеют сходные биологические свойства, а именно: способность агглютинировать эритроциты, наличие нейраминидазы, легкость культивирования в КЭ и тропизм к органам дыхания. Вирусы имеют принципиальные различия по внутриклеточной локализации АГ, по чувствительности к препаратам, затрагивающим синтез белков и нуклеиновых кислот и по генетическим свойствам.

Согласно Международной номенклатуре, любой штамм вируса гриппа рода А обозначается по следующей схеме: род/источник изоляции/место изоляции/собственный номер изолята /год изоляции/формула вида – серотипы гемагглютинина и нейраминидазы. Для штаммов, изолированных от человека, источник изоляции не пишется; для всех других штаммов год изоляции обозначается 2-мя последними цифрами.

Семейство ортомиксовирусов (от греч. Orthos – правильный, прямой и myxa – слизь) включает три рода: вирусы гриппа А и В, вирусы гриппа С и подобные вирусы.

Ионный канал гемагглютинин Липидная оболочка Рисунок 1. Схематическая структура вируса гриппа.

Вирионы представляют собой частицы плеоморфной, чаще округлой формы, диаметром 80-120 нм (рисунок 1) (Mosley V. M., 1946). Они состоят из фрагментированного нуклеокапсида спиральной симметрии диаметром 9нм и липопротеидной оболочки, на поверхности которой имеются выступы длиной 10,0-13,5 нм. Иногда обнаруживают филаментозные частицы длиной до 4 мкм, молекулярная масса вирионов 250 МД, плавучая нефиламентозных вирионов 700-800S (Fauquet C. M., 2005).

формальдегиду, -пропиолактону, быстро инактивируются при прогревании (560C), УФ облучении и рН среды ниже 5.

Геном вируса состоит из 8 сегментов однонитевой РНК размерами: PB – 2341 нуклеотид (н.), PB2 – 2341 н., PA – 2233 н., HA – 1778 н., NP – 1565 н., NA – 1413 н., M – 1027 н. и NS – 890 нуклеотидов. Число нуклеотидов колеблется у разных штаммов вируса гриппа А. Указанные белки имеют молекулярную массу: 96 000Д (PB1), 87 000Д (PB2), 85 000Д (PA), 50 000Д (NP), 48 000-63 000Д (NA), 63 000Д (HA). Два гена кодируют по два белка: M1 (27 000Д) и M2 (15 000Д), NS1 (25 000Д) и NS2 (12 000Д).

Естественно, что у разных вирусов эти величины варьируют. Таким образом, 8 фрагментов РНК кодируют синтез 10 белков (Stamboulian D., 2000).

Каждый фрагмент РНК вируса содержит одинаковую последовательность из 13 нуклеотидов на 5’-конце и 11-12 нуклеотидов на 3’-конце. Установлена кодирующая функция каждого фрагмента РНК. У вируса гриппа А три больших фрагмента РНК (1-й, 2-й, 3-й) кодируют белки полимеразного комплекса (PB1, PB2, PA), 3 промежуточных по размеру фрагмента РНК (4-й, 5-й и 6-й) кодируют нуклеопротеин и поверхностные гликопротеины и малых фрагмента РНК (7-й и 8-й) – матриксные белки и 2 неструктурных белка. Кодирующие зоны генов на каждом малом фрагменте РНК частично перекрываются (Steinhauer D. A., 2002). Вирионная РНК ортомиксовирусов не является инфекционной. В вирионах обнаружено 7 белков, 4 из которых (PB1, PB2, PA, NP) связаны с нуклеокапсидом, а 3 (HA, NA, M1) входят в состав липопротеидной оболочки, причем 2 из них (HA и NA) являются гликопротеинами. Гликопротеины образуют 2 вида выступов наружной оболочки вирионов. Выступы 1-го вида образованы гемагглютинином (HA) c молекулярной массой 75-80 кД (около 500 аминокислот). Каждый выступ состоит из 3-х молекул HA, которые организованы в палочкообразную структуру. HA ответственен за адсорбцию и проникновение вирионов в клетку и гемагглютинирующую активность (ГА-активность) вируса (Velkov T., 2013). АТ к HA нейтрализуют инфекционность вируса и подавляют его ГА-активность. Выступы 2-го типа образованы нейраминидазой (NA) с молекулярной массой 60-70 кД (450-470 аминокислот). Каждый выступ состоит из 4-х молекул NA, которые организованы в грибообразную структуру. На поверхности вириона имеется примерно 500 выступов, из которых около 100 образованы нейраминидазой и 400 – гемагглютинином. В вирионах содержится 70% белка, 18-37% липидов, 5% углеводов и 1% РНК.

Углеводы и липиды имеют клеточное происхождение.

Процесс репликации вируса гриппа в восприимчивой клетке состоит из следующих стадий (рисунок 2):

Вирус связывается с поверхностным белком или липидом, обладающим сродством к сиаловой кислоте и с помощью рецептор-опосредованного эндоцитоза проникает в клетку (1). Везикула подвергается ацидификации и мембрана вируса сплавляется с мембраной везикулы (вакуоли). При этом в цитоплазму выходят вирусные нуклеокапсиды (2). Вирусные нуклеокапсиды, содержащие отрицательно полярную геномную РНК увеличивают копии белка NP и белки Р транспортируются в ядро (3). Отрицательно полярная РНК копируется с помощью РНК полимеразы вириона в вирусную мРНК, используя 5,-концы пре-мРНК и РНК как праймеры для инициации синтеза (4). Матричная РНК транспортируется в цитоплазму (5), в то же время происходит транскрипция участка мРНК, кодирующего NS2 и М2 (6), в рибосоме, прикрепленной к эндоплазматическому ретикулуму (ЕР) транслируются с мРНК вирусные мембранные белки (HA,NA, M2) (7), далее эти белки участвуют в процессе секреции клетки хозяина, подвергаясь гликолизу (8). Остальная мРНК транслируется в рибосомах, находящихся в цитоплазме (9).

Рисунок 2. Внутриклеточный цикл репродукции вируса гриппа А.

Белки PA, PB1, PB2, и NP входят в ядро (10), где они катализируют синтез полноразмерной положительно цепочечной РНК (11) и отрицательно цепочечной вирионной РНК (12), обе РНК синтезируются в ядре. Какое-то количество вновь синтезированной отрицательно цепочечной РНК вовлекается в каскад синтеза РНК (13). Белок М1, связываясь с вновь синтезированной отрицательно цепочечной мРНК, останавливает синтез вирусной мРНК и, совместно с белком NS2, способствуют выходу новых нуклеокапсидов в цитоплазму (14). Белки HA и NA транспортируются к поверхности клетки (15) и встраиваются в клеточную мембрану (16).

Вирионные нуклеокапсиды, связанные с белком М1 (17) и с белком NS2, транспортируются к поверхности клетки и связываются с участками клеточной мембраны, содержащими белки HA и NA (18). Вирионы отпочковываются от плазматической мембраны клетки-хозяина (19) (S.J.Flint, 2000.).

Впервые вирус гриппа А был изолирован в 1931 г. от свиней Ричардом Шоупом в США, в 1933 г. - от человека Кристофером Эндрюсом и Вильямом Смитом в Англии. В 1955 г. вирус гриппа А был изолирован от кур в Германии В. Шефером и от лошадей в Чехословакии Бэлой Тумовой, в г. вирус был изолирован Бэккером от диких птиц – крачек Sterna hirundo в ЮАР. В последующие годы вирусы гриппа были изолированы Гремом Лэвером в Австралии, Робертом Вэбстером в США, Дмитрием Львовым в СССР. Позднее и другие исследователи в разных странах показали широчайшее распространение известных в настоящее время вирусов гриппа А среди различных представителей диких животных, главным образом, птиц водного и околоводного комплексов (Beare AS, 1991).

2.3. Эпидемиология вируса гриппа А подтипа H5N Передача вируса Вирус гриппа передаётся воздушно-капельным путём напрямую при вдыхании вирусных частиц или косвенно путём попадания вирусных частиц в верхние дыхательные пути или конъюнктиву слизистой оболочки.

Подтверждены случаи передачи вируса гриппа А H5N1 от птицы к человеку, возможна также передача вируса из окружающей среды человеку и ограниченная, неустойчивая передача вируса от человека человеку.

В 1997 году впервые была зафиксирована передача вируса от птицы человеку, произошедшая через неделю после начала вспышки заболевания среди птиц (Mounts A.W. et al., 1999). В то время не существовало приготовлением домашней птицы или заражения людей вирусом гриппа А H5N1. Заражение вирусом после разделывания домашней птицы было связано с серопозитивностью к вирусу гриппа А H5N1. В последнее время большинство заразившихся имели прямой контакт с домашней птицей, хотя не относились к числу людей, участвовавших в выбраковке больных птиц.

Люди также заражались при ощипывании и приготовлении больных птиц, подготовке боевых петухов, при игре с домашними птицами, особенно с инфицированными утками, переносящими заболевание бессимптомно, при употреблении крови уток, а также недоваренной птицы. Передача вируса кошачьим наблюдалась при кормлении тигров и леопардов в зоопарке Таиланда зараженной курицей (Keawcharoen J. et al., 2004) и при таком же кормлении домашних кошек в эксперименте (Kuiken T. Et al.2004).

предположительно происходила в общежитиях и был зафиксирован один случай передачи вируса от матери ребёнку (Ungchusak K. et al., 2005). Не было выявлено ни одного случая передачи вируса воздушно-капельным путем от человека к человеку, однако при тесном контакте без мер предосторожности передача вируса возможна. В 1997 году передача вируса от человека к человеку произошла, по-видимому, не через социальный контакт, малую эффективность такой передачи вируса доказывают и серологические исследования инфицированных работников здравоохранения. Серологические исследования во Вьетнаме и Тайланде не нашли доказательств бессимптомного инфицирования среди зараженных. В последнее время, благодаря активному эпиднадзору за контактами пациентов, с помощью ОТ-ПЦР были выявлены легкие формы заболевания.

Выявлено больше инфекций у пожилых людей, а также увеличение числа и продолжительности заболевания в семьях во Вьетнаме, предположительно вызванные адаптацией местных штаммов вируса к человеку. Однако необходимы вирусологические и эпидемиологические исследования для подтверждения этих выводов. На сегодняшний день риск внутрибольничной передачи вируса среди медицинских работников низок, даже не используя меры предосторожности (Liem N.T. et al., 2005). Тем не менее, был зарегистрирован один случай тяжелого заболевания медсестры, контактировавшей с инфицированным пациентов во Вьетнаме.

Учитывая наличие вируса гриппа А H5N1 в окружающей среде также возможно инфицирование при проглатывании контаминированной воды во время плавания в водоёмах, при попадании воды в нос и на конъюнктиву глаза. Фактором риска также является использование необработанных фекалий птиц в качестве удобрения.

Клинические проявления.

Спектр клинических проявлений вируса гриппа А H5N1 основан на описаниях госпитализированных пациентов. Описание случаев заболевания вирусом гриппа А H5N1 позволяет выявить лёгкие случаи заболевания, субклинические, а также атипичные формы, такие как гастроэнтерит и энцефалопития (M.D. de Jong, 2005). Большинство пациентов до заболевания были здоровыми детьми или взрослыми.

Инкубационный период вируса гриппа А H5N1 более длинный, чем у других вирусов гриппа человека. В 1997 году клинические признаки заболевания появлялись через 2-4 дня после инфицирования, недавние исследования показывают такие же интервалы, но с разбросом до 8 дней (Hien T.T. et al., 2004). В случае передачи вируса в бытовых условиях инкубационный период составлял от 2 до 5 дней, однако верхний предел мог быть до 8-17 дней, что может быть связано с заражением через окружающую среду или при контакте с инфицированными животными.

У большинства пациентов начальным симптомом заболевания была высокая температура (как правило, выше 380С) и гриппоподобная инфекция нижних дыхательных путей. Иногда отмечалось инфицирование верхних дыхательных путей. У пациентов, инфицированных вирусом гриппа А H5N конъюктивит встречался реже, чем у пациентов, инфицированных вирусом птичьего гриппа Н7. Также сообщалось, что у некоторых пациентов на начальном этапе возникает диарея, рвота, боль в животе, боль в плевральной полости и кровотечение из носа и десен. Водянистая бескровная диарея и воспаление встречались чаще, чем при вирусах гриппа человека, и могут предшествовать респираторным симптомам на неделю. В одном из сообщений описывались два пациента, у которых не было респираторных симптомов, однако была энцефалопатия и диарея.

Симптомы инфекции нижних дыхательных путей проявлялись не только в начале заболевания, но и сохраняются в дальнейшем. Одышка появлялась через 5 дней после начала заболевания. Общими симптомами являлись дыхательная недостаточность, тахипноэ и потрескивание при вдохе.

Количество мокроты, иногда с примесью крови варьировалось у разных пациентов. Почти у всех пациентов клиническим проявлением заболевания было воспаление лёгких. Рентгенологические исследования показывали наличие диффузных, мультифокальных и очаговых инфильтратов, на бронхограмме визуализируются интерстициональные инфильтраты.

Рентгенологические изменения появлялись в течение 5 дней после начала заболевания. В Хошимине во Вьетнаме самым распространенным изменением у только поступивших пациентов было многоочаговое исследований говорят о том, что это процесс возникает при первичной госпитализации. Прогрессирование дыхательной недостаточности было связано с наличием диффузных, двусторонних инфильтратов и проявлением острого респираторного дистресс-синдрома (ОРДС). В Тайланде время от начала заболевания до развития ОРДС составляло в среднем 5 дней. Общими признаками заболевания являлись полиорганная недостаточность с признаками дисфункции почек и патология сердца, в том числе дилатация сердца и суправентрикулярная тахиаритмия. Другими осложнениями были пневмония, легочное кровотечение, пневмоторакс, панцитопения, синдром Рейе, а также сепсис.

Летальность среди госпитализированных пациентов была высокой, хотя общий уровень летальности, скорее всего, значительно ниже. В отличие от 1997 года, когда большинство летальных случаев приходилось на пациентов старше 13 лет современный вирус гриппа А H5N1 вызывает высокий уровень смертности среди младенцев и маленьких детей. В Тайланде смертность составила 89 процентов среди лиц моложе 15 лет. Смерть наступала в основном на 9 или 10 день от начала заболевания, большинство пациентов умирало в основном от прогрессирующей лёгочной недостаточности.

Общими лабораторными признаками заболевания были лейкопения, в основном лимфопения, лёгкая или умеренная тромбоцитопения и слабо или умеренно повышенный уровень АЛТ. Одним из признаков заболевания также является гипергликемия, которая может быть связана с приёмом кортикостероидов или повышения уровня креатинина. В Тайланде повышенный риск смерти наблюдался у пациентов, поступивших с низким уровнем лейкоцитов, тромбоцитов и лимфоцитов.

Диагностика вируса гриппа А H5N1 включает вирусовыделение и обнаружение РНК вируса подтипа Н5, или оба метода. В отличие от вирусов гриппа А человека вирус птичьего гриппа H5N1 ассоциирован с более высокой частотой обнаружения вируса и более высоким уровнем вирусной РНК в фаренгиальном секрете, а не в назальном. Во Вьетнаме вирусная РНК обнаруживалась в носоглоточных смывах начиная со 2 до 15 дня после начала заболевания (в среднем через 5 дней), а вирусная нагрузка на 4-8 день после начала заболевания была в 10 раз выше у пациентов с вирусом гриппа А H5N1, чем у пациентов с вирусами гриппа А подтипов H3N1 и H1N1.

Большинству госпитализированных с диагнозом «птичий грипп»

пациентам, в первые 48 часов после поступления, потребовалась искусственная вентиляция лёгких, а также интенсивная терапия при полиорганной недостаточности и иногда при гипотонии. У большинства пациентов наряду с эмпирической терапией антибиотиками широкого спектра действия использовались противовирусные средства, иногда совместно с кортикостероидами. При медикаментозной терапии на поздних стадиях заболевания эффективность терапии была ниже, чем при противовирусной терапии, начатой на ранних стадиях заболевания.

Активный вирус обычно исчезал через 2-3 дня после начала терапии озельтамивиром, однако были описаны летальные случаи ранней терапии озельтамивиром с отсутствием уменьшения вирусной нагрузки в носоглотке (Peiris J.S. et al., 2004).

Исследования изолятов вируса птичьего гриппа А H5N1, выделенных от пациентов в 1997 году, показали наличие таких факторов вирулентности, как наличие гемагглютинина, с высокой расщепляющей способностью, который активируется клеточными протеазами, замена в гене РА2 (Glu627Lys), усиливающая репликацию и замена в гене NS1 (Asp92Glu), приводящая к повышению устойчивости к ингибиторам интерферона и ФНО- in vitro и пролонгированной репликации в свиньях, а также повышенной выработке цитокинов, в особенности ФНО- в макрофагах человека, подверженных воздействию вирусных частиц. Исследования вируса гриппа А H5N1, проводимые с 1997 года показывают, что этот вирус продолжает эволюционировать, меняется его антигенная структура, расширяется диапозон птиц-хозяев инфекции и появляется способность инфицировать кошачьих, усиливается патогенность у экспериментально заражённых мышей и хорьков, у которых он вызывает системную инфекцию и увеличивается стабильность вируса в окружающей среде.

Филогенетический анализ показал, что Z генотип стал доминантным и что вирус эволюционировал в два различных клайда, первый клад охватывает все изоляты из Камбоджи, Лаоса, Малайзии, Таиланда и Вьетнама, второй клайд охватывает изоляты из Китая, Индонезии, Японии и Южной Кореи. Недавно выделенный кластер изолятов появился в северном Вьетнаме и Тайланде, который включает разнообразные замены около рецепторсвязывающего сайта и один остаток аргинина в полиосновном сайте расщепления гемагглютинина. Однако важность этих генетических и биологических изменений для человеческой эпидемиологии и вирулентности не определена. Также различают Цинхай-Сибирский генотип H5J 2.2 а также Уссурийский генотип H5J 2.3.2.

Вирусологическое течение гриппа А человека H5N1 полностью не охарактеризовано, но исследования госпитализированных пациентов показывают увеличение репликации вируса. В 1997 году вирус обнаруживался в среднем через 6,5 дней (от 1 до 16) после инфицирования, в Тайланде интервал от начала заболевания до первых выделенных изолятов составлял от 3 до 16 дней. Вирус реплицируется в носоглотке меньше, чем вирус гриппа человека, поэтому необходимы исследования нижних дыхательных путей. Семь из девяти образцов фекалий содержали РНК вируса, в то время как в образцах мочи вируса не содержалось. Высокая частота развития диареи у заболевших людей, а также наличие РНК вируса в образцах фекалий, в одном случае даже инфекционного вируса, говорит о том, что вирус размножается в желудочно-кишечном тракте. Результаты вскрытия также подтвердили эти наблюдения.

У высокопатогенного вируса гриппа А H5N1 есть последовательность аминокислот в сайте расщепления гемагглютинина, отвечающая за распространение вируса среди птиц. Инвазивная инфекция была зарегистрирована у млекопитающих, а у человека шесть из шести образцов сыворотки содержали РНК вируса через 4-9 дней после начала заболевания.

У пациента инфекционный вирус и РНК вируса обнаруживалась в крови, спинномозговой жидкости и кале. Остаётся неизвестным, возможна ли передача вируса с кровью и калом.

Относительно низкая частота развития птичьего гриппа H5N1 у человека, несмотря на широко распространённые контакты с больной птицей, указывает на то, что преодоление видового барьера играет значительную роль в восприимчивости вируса. Наличие нескольких случаев заболевания среди членов одной семьи может быть вызвано общими факторами риска, также на восприимчивость к болезни могут повлиять генетические факторы.

Патогенез заболевания также зависит от врождённого иммунитета к вирусу гриппа А H5N1. Во время вспышки в 1997 году у отдельных пациентов наблюдалось повышение уровня интерлейкина-6, ФНО-, интерферона- и растворимого рецептора интерлейкина-2, а в 2003 году у пациентов на 3-8 день после начала заболевания повышался уровень IP- (интерферон индуцированный белок 10), CCL2 (белок хемоаттрактант моноцитов 1) и MIG (монокины, индуцированные интерфероном- ). У умерших пациентов уровень медиаторов воспаления (интерлейкина- 6, интерлейкина-8, интерлейкин- 1 и CCL2) в плазме крови был выше, чем у выживших пациентов. Средний уровень интерферона- в плазме крови у умерших от птичьего гриппа пациентов был в 3 раза выше, чем у здоровых людей. Такой иммунный ответ у многих пациентов является частью респираторного дистресс-синдрома, полиорганной недостаточности и сепсиса.

Специфический гуморальный иммунный ответ на вирус гриппа А H5N микронейтрализации на 10-14 день после начала заболевания. Приём кортикостероидов может замедлить или уменьшить иммунный ответ.

Ограниченное число посмертных исследований описывали серьёзную лёгочную травму с гистопатологическими изменениями в диффузных повреждениях альвеол, что соответствует полученным данным о развитии гистопатологическим изменениям относились заполнение альвеолярных пространств фибринозным экссудатом и эритроцитами, формирование гиалиновой мембраны, сосудистая гиперемия, инфильтрация эритроцитов интерстициальное пространство, а также пролиферация реактивных фибробластов. Происходит заражение пневмоцитов II типа. Биопсия костного мозга показала наличие реактивного гистиоцитоза с гемофагоцитозом у некоторых пациентов, также при вскрытии было отмечено наличие лимфоидного истощения и атипичных лимфоцитов в лимфоидной ткани и селезенке. В некоторых случаях отмечался некроз печени и острый тубулярный некроз.

Всех пациентов с острыми респираторными заболеваниями в странах и на территориях которых отмечались случаи инфицирования вирусом гриппа А H5N1животных необходимо обследовать на наличие гриппа А H5N1, особенно людей, контактировавших с птицей. Однако некоторые вспышки у птиц обнаруживали только после обнаружения вируса у людей. Раннее обнаружение заболевания осложняется неспецифическими начальными проявлениями заболевания и высоким темпом развития фоновых острых респираторных заболеваний. В регионах с подтверждёнными случаями заражения людей и животных вирусом гриппа А H5N1 обязательно проверяют всех пациентов с серьёзной неизвестной болезнью (например, энцефалопатией или диареей) на наличие птичьего гриппа.

Диагностическая ценность различных типов образцов и вирусологических анализов ещё не полностью определена. В отличие от вирусов гриппа человека, при инфицировании вирусом птиц H5N1 большее диагностическое значение имеют образцы, взятые из глотки, чем образцы, взятые из носа. Для раннего выявления вируса гриппа больше подходят пробы из дыхательных путей, но чувствительность анализа сильно зависит от специфичности праймеров и метода анализа (ВОЗ, 2005).

Диагностика вируса гриппа состоит из выделения вируса и обнаружения и характеристики фрагментов его генома.

Идентификация вируса. В аллантоисную полость 9-11 дневного куриного эмбриона вносят суспензию, представляющую собой ротоглоточный или клоакальный мазок, взятый у живых птиц или фекалии и объединённые пробы органов от мёртвых птиц. Эмбрионы инкубируют при 370С в течение 2-7 дней. Далее проверяют аллантоисную жидкость на наличие гемагглютинирующей активности, проверяют также аллантоисную жидкость у эмбрионов, умерших во время инкубации. Наличие вируса гриппа А также может быть подтверждено методом иммунодиффузии концентрированного вируса и антисыворотки к нуклеокапсидному или матричному антигену, которые являются общими для всех вирусов гриппа А.

На сегодняшний день большинство случаев инфицирования людей вирусом гриппа H5N1 происходит при тесном (обычно прямом) контакте с инфицированными птицами. Эпидемиологические наблюдения позволяют предположить, что в не которых случаях имеет место передача вируса от человека к человеку при очень тесном контакте (например, лицом к лицу).

Инфицирование возможно при вдыхании инфекционной единицы или путем прямого контакта и попадания вируса в нос, глаза или, возможно, в рот.

Заражение через глаза происходит при инфицировании конъюнктивы или если инфицированной водой промывают слёзные протоки и носоглотку.

Существует несколько подтверждений того, что инфицирование желудочно-кишечного тракта и глотки может произойти после начала заболевания. Инфицирование не происходит через неповреждённую кожу.

Вирусные частицы размером больше 5 микрон могут передаваться воздушнокапельным или механическим путем. Вирус не может долго существовать в сухой окружающей среде, но может сохраняться в течение недели во влажной среде, защищенной от прямых солнечных лучей. На сегодняшний день не доказано инфицирование вирусом при попадании его на кожу во время ухода за больными или при отборе пробы. Использование индивидуальных средств защиты является обязательным, если ожидается прямой контакт с пациентом, при отборе проб от диких птиц и млекопитающих и при принятии образцов от домашней птицы.

Уровень используемой индивидуальной защиты определяется риском инфицирования. Например, при работе в птицеводческом хозяйстве, где инфицированный материал может накапливаться и в воздухе присутствует много контаминированной пыли, требуется более высокий уровень индивидуальной защиты, чем при отборе проб от диких птиц. Юн и Вонг (2005) рекомендуют в связи с высокой смертностью от этой болезни соблюдать контактные и воздушно-капельные меры предосторожности, пока позволяют ресурсы, несмотря на то, что относительная важность этих мер при внутрибольничной передаче вируса гриппа H5N1 пока не известна.

Средства индивидуальной защиты должны включать защиту органов дыхания подходящей формы, нестерильные латексные перчатки, очки или защитную маску, халат и головной убор. Также может быть необходим непроницаемый фартук и резиновые сапоги. Деятельность, сопряжённая с высоким риском заражения, как, например, посмертная экспертиза подтверждённых или предполагаемых случаев заболевания человека, отлов предположительно инфицированных птиц и животных, а также такие процедуры как обеззараживание сельскохозяйственных объектов, должны проводиться только в специальном защитном комбинезоне, резиновых сапогах, в тяжёлых резиновых перчатках и с защитой для глаз.

Золотое правило диагностики вируса гриппа H5N1 гласит, что нельзя анализировать в одной лаборатории клинические образцы от людей и от животных. Однако они могут анализироваться в одном учреждении при чётком и ясном разделении рабочих помещений для животных и для людей.

Это необходимо для исключения риска перекрёстного загрязнения образцов от людей и животных (WHO, 2006).

микроорганизмов, из-за высокой вирулентности и способа передачи.

Диагностику вируса гриппа А подтипа H5N1 проводят в лабораториях третьего уровня биологической безопасности. Лаборатория должна быть отделена от других частей здания, в которых разрешен свободный проход.

Дополнительная изоляция достигается посредством размещения лаборатории в тупиковом конце коридора с использованием внутренних перегородок и дверей или же вестибюля. Поверхность стен, пола и потолков должна быть водостойкой и легко моющейся. Отверстия и щели на этих поверхностях (например, для выводных труб) должны быть герметично заделаны для обеспечения деконтаминации помещений. Лабораторные комнаты должны быть герметизированы для предотвращения контаминации. С этой же целью проектируется и система вентиляции. Окна должны быть закрыты, герметизированы и оснащены небьющимися стеклами. У выходной двери каждой лаборатории должны быть оборудованы автоматические краны для мытья рук. Необходимо установить управляемую вентиляционную систему для обеспечения отрицательного давления внутри лаборатории, с тем, чтобы биологической безопасности должны быть расположены вдали от проходов и вне потоков воздуха от входных дверей и вентиляционных систем (ВОЗ, 2004).

Иммуноферментный анализ (ИФА), возникший около двадцати лет назад, является одним из наиболее активно развивающихся направлений химической энзимологии, как в нашей стране, так и за рубежом. Это обусловлено тем, что в ИФА уникальная специфичность иммунохимического анализа сочетается с высокой чувствительностью детекции ферментативной метки. Высокие результаты достигаются благодаря использованию неограниченных возможностей ферментов-биокатализаторов, которые позволяют создавать каскадные системы усиления различных химических сигналов (Lequin R., 2005).

Явные преимущества данного метода, к которым относится простота выполнения, доступность и стабильность реагентов, технологичность и возможность автоматизации для проведения массовых анализов, обеспечили его прочное положение в клинической биохимии, при диагностике заболеваний растений и животных, в научных исследованиях.

иммунологический метод определения инсулина в плазме человека с использованием инсулина, меченного радиоактивным изотопом йода.

Предложенный метод основан на конкуренции между немеченым инсулином специфических мест связывания на антителах к инсулину. Количество меченого инсулина, связавшегося с антителами, обратно пропорционально количеству инсулина в образце плазмы. Метод, столь простой и изящный по своему замыслу, удалось осуществить благодаря лёгкости измерения предельно низких уровней радиоактивности, а также благодаря высокой специфичности связывания определяемого вещества антителами (Van Weemen B.K., 1971). Сочетание специфичности и чувствительности составляет основу метода, названного радиоиммунологическим анализом (РИА).

Наряду с преимуществами РИА обладает и некоторыми недостатками. К ним относятся: сравнительно короткий период полураспада изотопов, испускающих -кванты; опасность для здоровья, которую представляет введение изотопных меток, подготовка и выполнение анализов; повреждение структуры меченых молекул, вызываемое излучением; необходимость отделения меченых и немеченых антигенов, связавшихся с антителами, от свободных антигенов и обусловленная этим трудность автоматизации РИА.

Двенадцать лет спустя Энгвалл и Пэлман (Engvall, Perlmann, 1971) и независимо от них Ван Веемен и Шуурс (Van Weemen, Schuurs, 1971) ввели в употребление другой тип чувствительных и ещё более универсальных меток для иммуноанализа - ферменты. Энгвалл и Пэлманн предложили сокращённо называть этот анализ ELISA (от англ. Enzyme Linked Immunosorbent Assay), что означает фермент - зависимый иммуносорбционный анализ.

Как в случае РИА, так и в случае ELISA сначала отделяют меченые немеченые антигены, связавшиеся с антителами, от свободных антигенов и только потом измеряют активность метки в одной из двух фракций. Такие методы относят к иммуноанализу с разделением компонентов (гетерогенный иммуноанализ) (Егоров А.М., 1991).

Методы иммунологического анализа, применение которых сопряжено с необходимостью разделения связавшихся и не связавшихся антител, были разработаны для целого ряда гаптенов и антигенов. Среди этих методов можно выделить два типа – это методы так называемого последовательного (неконкурентного) и конкурентного анализа. Наиболее широкое применение на практике находит вариант последовательного гетерогенного анализа ELISA.

Этот метод связан с осуществлением двустадийного процесса. На первой стадии антигены, адсорбированные на нерастворимом носителе или ковалентно связанные с ним, взаимодействуют с антителами. Не связавшиеся компоненты отмывают и затем добавляют антивидовой конъюгат (антитела, конъюгированные с ферментом). Вторая стадия процесса также завершается отмывкой несвязавшихся компонентов реакционной смеси, после чего в систему вводят соответствующий субстрат для осуществления индикаторной ферментативной реакции (Qigai He, 2007).

В настоящее время метод полимеразной цепной реакции (ПЦР) является наиболее удобным и надёжным методом ранней диагностики ДНК и РНКсодержащих вирусов.

Метод ПЦР основывается на природном процессе - комплементарном достраивании ДНК матрицы, осуществляемом с помощью фермента ДНКполимеразы. Эта реакция носит название репликации ДНК (Глик Б., 2002).

Естественная репликация ДНК включает в себя три стадии: денатурация ДНК, образование коротких двухцепочечных участков ДНК и синтез новой цепи ДНК. Этот процесс можно использовать для получения копий коротких участков ДНК, специфичных для конкретных микроорганизмов, т.е.

осуществлять целенаправленный поиск таких специфических участков, что и является целью генодиагностики для выявления возбудителей инфекционных заболеваний.

Открытие термостабильной ДНК-полимеразы (Taq-полимеразы) из полимеризацию ДНК при температуре от 700С до 950С, позволило сделать процесс репликации ДНК циклическим и использовать его для работы in vitro. Создание программируемых термостатов (амплификаторов), которые по заданной программе осуществляют циклическую смену температур, позволило внедрить метод ПЦР в практику лабораторной клинической диагностики. При многократном повторении циклов синтеза происходит экспоненциальное увеличение числа копий специфического фрагмента ДНК, что позволяет из небольшого количества анализируемого материала, который может содержать единичные клетки микроорганизмов получить достаточное количество ДНК копий для идентификации их методом электрофореза.

Комплементарное достраивание цепи начинается не в любой точке последовательности ДНК, а только в определенных стартовых блоках – коротких двунитевых участках. При присоединении таких блоков к специфическим участкам ДНК можно направить процесс синтеза новой цепи только в этом участке, а не по всей длине ДНК цепи. Для создания стартовых блоков в заданных участках ДНК используют две олигонуклеотидные затравки (обычно, примерно 20-30 нуклеотидных пар), называемые праймерами. Праймеры комплементарны последовательностям ДНК на левой и правой границах специфического фрагмента и ориентированы таким образом, что достраивание новой цепи ДНК протекает только между ними (Vernet G., 2004).

Таким образом, ПЦР представляет собой многократное увеличение числа копий (амплификация) специфического участка ДНК катализируемое ферментом ДНК-полимеразой (Ellis J.S., 2001).

характеристического фрагмента ДНК амплификация включает 20-40 циклов.

Каждый цикл амплификации включает 3 этапа, протекающих в различных температурных режимах.

1 этап: Денатурация ДНК (раскручивание двойной спирали). Проходит при температуре 93-95° С в течение 15-30 сек. (рисунок 4) 2 этап: Присоединение праймеров (отжиг). Присоединение праймеров происходит комплементарно к соответствующим последовательностям на противоположных цепях ДНК на границах специфического участка. Для каждой пары праймеров существует своя температура отжига, значения которой располагаются в интервале 50-65° С. Время отжига составляет 15- сек.

3 этап: Достраивание цепей ДНК. Комплементарное достраивание цепей ДНК происходит c 3’-конца цепей в противоположных направлениях, начиная с участков присоединения праймеров. Химическими компонентами для синтеза новых цепей ДНК служат добавляемые в раствор дНТФ. Процесс синтеза катализируется ферментом термостабильной ДНК-полимеразой (Taqполимеразой) и проходит при температуре 70-72° С. Время протекания синтеза – 15-40 сек., в зависимости от длины фрагмента (Ellis J.S., 2002).

При выявлении молекул РНК первой стадией реакции является обратная транскрипция (ОТ), т.е. превращение РНК в кДНК, с которой в дальнейшем будут амплифицироваться специфические фрагменты. Поэтому ПЦР для РНК-содержащих вирусов называется ОТ/ПЦР (рисунок 4.).

На рисунке 3 представлены компоненты, необходимые для проведения ПЦР на матрице РНК (например, вируса гриппа).

специфический фрагмент;

2. Праймеры – синтетические олигонуклеотиды (20-30 нуклеотидных пар), комплементарные последовательностям ДНК на границах определяемого специфического фрагмента. Выбор специфического специфичности проведения амплификации, что сказывается на качестве проведения анализа.

3. Смесь дезоксинуклеотидтрифосфатов (дНТФ) – смесь четырех дНТФ, являющихся материалом для синтеза новых комплементарных цепей Рисунок 3. Компоненты для проведения ПЦР.

4. Фермент Taq-полимераза – термостабильная ДНК-полимераза, последовательного присоединения нуклеотидных оснований к растущей цепи синтезируемой ДНК.

5. Фермент ревертаза – синтезирует кДНК на матрице РНК.

6. Фермент RNA-зин – фермент, разрушающий РНКазы (ферменты, разрушающие РНК) (Брюханов А.Л., 2012; Viljoen G.T., 2005).

1. Обратная транскрипция 2. Денатурация ДНК 3. Отжиг праймеров Рисунок 4. Схема ОТ/ПЦР.

Образовавшиеся в первом цикле амплификации новые цепи ДНК служат матрицами для второго цикла амплификации, в котором происходит образование искомого специфического фрагмента ДНК (ампликона) (рисунок 5).

В последующих циклах амплификации ампликоны служат матрицей для синтеза новых цепей. Таким образом, происходит накопление ампликонов в растворе по формуле 2n, где n-число циклов амлификации. Поэтому, даже если в исходном растворе первоначально находилась только одна двухцепочечная молекула ДНК, то за 30-40 циклов в растворе накапливается около 108 молекул ампликона. Этого количества достаточно для визуальной детекции этого фрагмента методом электрофореза в агарозном геле. Процесс амплификации проводится в специальном программируемом термостате (амплификаторе), который по заданной программе автоматически осуществляет смену температур согласно числу циклов амплификации.

Отжиг праймеров Синтез цепи ДНК Рисунок 5. Схема 2-ой амплификации (реамплификации).

В основном проводят 30-40 циклов ПЦР. Однако, при проведении циклов ПЦР на матрице, выделенной из биологического материала, может происходить накопление неспецифических продуктов. Поэтому для получения более чёткого сигнала целесообразно снизить количество циклов до 25-30 (Viljoen G.T., 2005; Брюханов А.Л., 2012).

2.4.4.2. Полимеразная цепная реакция в реальном времени Полимеразная цепная реакция в реальном времени на сегодняшний день является одной из самых современных модификаций данной реакции.

Отличительной чертой ПЦР в реальном времени является возможность детекции накопления продуктов амплификации непосредственно во время проведения амплификации. Так как кинетика накопления ампликонов напрямую зависит от числа копий исследуемой матрицы, это позволяет проводить количественные измерения ДНК и РНК инфекционных агентов (Lee C. W., 2004).

Полученная информация может быть использована для проведения мониторинга эффективности проводимой терапии, оценки клинического прогноза. В отличие от других методов количественного определения ДНК матрицы в пробе, ПЦР в реальном времени не требует дополнительных манипуляций, связанных с раститровкой ДНК исследуемой пробы или полученных в ходе ПЦР ампликонов, которые усложняют постановку анализа и могут приводить к появлению ложноположительных результатов (Freeman W.M., 1999; Bustin S.A., 2002). Подобный подход позволяет отказаться от стадии электрофореза, что ведет к резкому уменьшению вероятности контаминации исследуемых проб продуктами амплификации, а также позволяет снизить требования, предъявляемые к ПЦР лаборатории (Heid C.A., 1996).

Для выявления продуктов амплификации в режиме реального времени используют ДНК-зонды (Рис.6). В состав ДНК-зонда входит флуоресцентная метка и гаситель флуоресценции. Во время элонгации в ходе ПЦР происходит разъединение флуоресцентной метки и гасителя, что приводит к появлению свечения.

ДНК или РНК инфекционного агента Рисунок 6. Схема проведения ПЦР в реальном времени.

Для постановки ПЦР в реальном времени необходим специальный амплификатор, отличительной особенностью которого является возможность возбуждать и детектировать флуоресценцию, отражающую накопление ампликонов, на каждом цикле амплификации. На сегодня существует немного моделей приборов для ПЦР в реальном времени: это “iQ iCycler” ("Вio-Rаd"), несколько типов "АВI Рrism" ("Аррlied Вiosystems"), “LightCycler" ("Roche"), "SmartCycler" ("Серhеid”), различные модели “DTprime” (ДНК-технология) и другие.

Рисунок 7. Прибор для постановки ПЦР в реальном времени На рисунке 7 представлен прибор ABI Prism 7000 (Applied Biosystems) для выполнения анализов методом полимеразной цепной реакции «в реальном времени».

Интенсивность флуоресценции измеряется, и результат реакции выносится на экран монитора прибора в виде графика зависимости флуоресценции от количества циклов в реакции. Таким образом, за ходом реакции можно следить уже через несколько минут после её начала.

В процессе ПЦР свет от вольфрамово-галогеновой лампы фокусируется одновременно в каждой лунке планшета. Проходя через лунки, свет возбуждает флуоресцентные красители, содержащиеся в образцах. В процессе ПЦР на стадии наращивания цепи в каждой лунке регистрируется сигнал флуоресценции в диапазоне длин волн между 500 и 660 нм.

Система линз, фильтров и дихроических зеркал фокусирует испускаемый флуоресцентный сигнал в камере прибора с зарядовой связью (CCD). Фильтры осуществляют разделение света (в зависимости от длины волны) по определенной схеме в камере CCD. Программное обеспечение прибора регистрирует флуоресцентные сигналы из камеры CCD и осуществляет алгоритмическую обработку данных (Рисунок 8).

Рисунок 8. Схема регистрации флуоресценции Для выявления продуктов амплификации в режиме реального времени используют методику основанную на 5'-экзонуклеазной активности полимеразы (ТаqМаn Аssау). В реакционную смесь добавляют ДНК-зонды, в состав которых входит флуоресцентная метка в 5'-положении и гаситель флуоресценции в З'- положении, а также фосфатная группа в З'- положении.

Эти зонды имеют места посадки внутри амплифицируемой области. Гаситель поглощает испускаемое флуоресцентной меткой излучение, а фосфатная группа в З'- положении блокирует полимеразу.

В ходе ПЦР во время стадии отжига праймеров происходит присоединение ДНК-зонда к комплементарной цепи ДНК, при этом, чем больше продуктов амплификации образуется в ходе ПЦР, тем больше молекул зондов свяжется с соответствующими ампликонами. Во время стадии элонгации полимераза синтезирует комплементарную цепь ДНК и при достижении зонда начинает его расщеплять благодаря наличию 5'экзонуклеазной активности. Таким образом, происходит разъединение флуоресцентной метки и гасителя, что приводит к увеличению детектируемого свечения. Очевидно, что чем больше ампликонов было наработано в ходе ПЦР на данный момент времени, тем интенсивнее будет свечение (Bustin, 2004).

Кинетическая кривая ПЦР в координатах "Уровень флуоресценции — цикл амплификации" имеет сигмоидную форму (рисунок 9). В ней можно выделить три стадии:

1. Стадию инициации, когда ПЦР-продукты еще не детектируется флуоресцентной меткой.

2. Экспоненциальную стадию, в которой наблюдается экспоненциальная зависимость количества флуоресценции от цикла ПЦР.

3. Плато – стадию насыщения.

Пороговый цикл – это минимальный уровень флуоресценции, который во всех проведенных с данной парой праймеров реакциях соответствует началу экспоненциальной стадии. Этот показатель важен при количественной оценке проведённой ПЦР в реальном времени (Saunders N.A., 2004).

Относительная интенсивность флуоресценции Химические реагенты:

Агар (Difco), дрожжевой экстракт (Gibco BRL, Life Technologies), триптон (Difco), Bacto-agar (Difco), трис основной (Promega), хлорид магния (Sigma), хлорид натрия (Sigma), соляная кислота (Химмед), глицерин (Merck), агароза (PeqLab, HYBAID-AGS, Sigma), легкоплавкая агароза (Sigma), дезоксинуклеотидтрифосфаты (Promega), тризол (Gibco BRL, Life Technologies), изопропиловый спирт – ректификат (Реахим; Химмед), тритон (ICN), масло минеральное (ESSO), ЭДТА (Promega), метиловый оранжевый (Реахим), бромистый этидий (Serva), силика (Sigma), гуанидинтиоцианат (PeqLab).

Реагенты и наборы для молекулярной биологии:

Маркеры молекулярной массы Плазмида pUC 19, обработанная рестриктазой MspI ДНК фага, обработанная рестриктазами Hind III, EcoRI – Promega Наборы и тест-системы Набор для выделения ДНК из геля (Promega, DNA Purification System, Wizard ).

Набор для выделения плазмидной ДНК (Promega, DNA Purification System, Wizard Plus, SV Minipreps).

Набор для выделения РНК (OOО «Ветбиохим», Россия) pGEM -T and pGEM -T Easy Vector Systems (Promega, США).

Ферменты Taq-полимераза (Promega);

Ревертаза (обратная транскриптаза) M-MLV(AMV) (Promega.ю США);

IRNase («Promega», США);

Клеточные культуры и вирусы.

Клеточные культуры Накопление вирусов гриппа проводили с использованием монослоя клеток MDCK (S.H. Madin and N.B. Darby, 1958, Canine Kidney), как наиболее чувствительной линии в отношении вирусов гриппа А (Richardson J.C.W.

1981), а также на СПФ куриных эмбрионах.

Трансформацию компетентных клеток проводили в клетках E. Coli штамма TOP TEN.

руководителем лаборатории физиологии вирусов ФГБУ «НИИ Вирусологии им. Д. И, Ивановского» Минздрава РФ, академиком РАМН, проф. Н.В.

Кавериным. Штаммы, использованные в данной работе, перечислены в таблице 1.

Использованные в работе штаммы вируса гриппа В (табл. 1) были любезно предоставлены доктором биологических наук, ведущим научным сотрудником лаборатории этиологии и эпидемиологии гриппа ФГБУ «НИИ Вирусологии им. Д. И, Ивановского» Минздрава РФ В.Т. Ивановой.

Новосибирской, Астраханской, Ростовской, Волгоградской областях;

республиках Калмыкия, Бурятия, Тыва; Приморском и Краснодарском крае с середины 2005 по 2008 гг. (таблица 2).

Полевые образцы от птиц представляли собой клоакальные и трахеальные смывы и 10%-ные суспензии внутренних органов (мозг, печень, селезенка). Клоакальные и трахеальные смывы собирались ватной палочкой, после чего экстрагировались в раствор гуанидин тиоцианата и замораживались в жидком азоте.

Характеристика штаммов вируса гриппа А и В, использованных в Сыворотки для исследования: референтные сыворотки от кур, инфицированных вирусом А/H5N1 (LPAI), были предоставленны др. Д. Л.

Суарэсом (USDA Agricultural Research Service (USDA-ARS), South East Poultry Research Laboratory, Атенс, Джорджия, США), а также сыворотки были получены после вакцинации кур инактивированной эмульгированной вакциной против гриппа птиц типа А подтипа H5 «Флупротект H5» производства ФГУП «Ставропольская Биофабрика» (серия 040306).

(www.ncbi.nlm.nih.gov) и ISD (Influenza Sequence Database, www.flu.lanl.gov).

Для подбора синтетических олигонуклеотидов (праймеров) использовали программы PrimerQuest (IDT), Lasergene (версия 6.0), BioEdit (версия 7.00) и Amplify (версия 1.06 Univers. of Wisconsin, Genetics, Madison).

Последовательности олигонуклеотидов для проведения ПЦР и ПЦР в реальном времени представлены в таблицах 3 и 4.

Олигонуклеотидные праймеры для проведения ОТ-ПЦР Последовательность олигонуклеотидов (5' - 3') Название праймера Для обнаружения РНК гена NА вируса гриппа А подтипа H5N

F-N1 CAGAACATTAATGAGTTGTCCT

R-N1 TCTCAGTATGTTGTTCCTCCAA

Для обнаружения РНК гена HА вируса гриппа А подтипа H5N

F-H5 ACAAGGTCCGACTACAGCTT

R-H5 ATTGATTCCAATTTTACTCCAC

Олигонуклеотидные праймеры для проведения ПЦР в реальном Название праймера Последовательность олигонуклеотидов (5' - 3') Для обнаружения РНК вируса гриппа А подтипа Н5 методом ПЦР в

Н-F CACCATCGGAGAATGTCCCAAA

H-R TACCCATACCAACCGTCTACCA

H-Probe FAM-AGGACTGTTTGGAGCCATAGCAGGTTBHQ Для обнаружения РНК вируса гриппа А подтипа N1 методом ПЦР в

N-F GGTTTGAGTCTGTTGCTTGGTC

N-R GCAAGAGCCATTTACACATGCAC

N-Probe FAM-TTGCCATGATGGCACCAGTTGGTT-BHQ Праймеры, использованные для амплификации генов, кодирующих неструктурный белок NS1 вируса гриппа А подтипа H5N1 при синтезе Название Последовательность олигонуклеотидов (5' - 3') Сайт праймера

NS-F TGACACCATGGTAATGGATTCCAACACTG NcoI

NS-R TATTTGGATCCACTTTTGGCTCAATTGTTC BamHI

Вортекс “Fisons” (UK), твердотельный термостат “Гном” (ДНКТехнология), источник питания “Эльф” (ДНК-Технология), настольные микроцентрифуги “Eppendorf”, центрифуга с охлаждением RC2-B (Sorvall), прибор для проведения горизонтального электрофореза в агарозном геле (OOO Хеликон), вакуумный насос (Gast), генератор льда AF100 (Scotsman), низкотемпературный холодильник (Nuare), водный термостат “Bromma” (LKB), амплификатор Терцик (ДНК-Технология), термостат воздушный ТС1/20 (СПУ), ультрафиолетовый трансиллюминатор, фотокамера для съемки гелей Polaroid, холодный шкаф “Bromma” (LKB), механические пипетки переменного объема Gilson, Eppendorf, автоклав настольный Sanyo, дистиллятор (СПУ), холодильник - Stinol, система для очистки воды Milli Q (Millipore, USA), электронные настольные весы 1219МР (Sartorius), дозатор со сменными насадками и переменным объемом Multipipette plus (Eppendorf), магнитная мешалка ММ-5 (СССР), орбитальная напольная качалка G10 (New Brunswick, USA), PH-метр 420A+ (Thermo Orion, USA), прибор для учёта результатов ИФА “Multiscan PLUS”, цифровой фотоаппарат Olimpus.

Расходные материалы и лабораторная посуда: пробирки на 0,6 мл тонкостенные для ПЦР (QSP, Greiner), 1.6 мл и 2 мл микроцентрифужные пробирки с градуировкой (Greiner, Eppendorf), микронаконечники на 0,5- мкл (Greiner), микронаконечники на 0,1-2,5 мкл (Greiner), микронаконечники на 1-200 мкл желтые (Greiner), желтые с фаской (Treff), наконечники на 100мкл голубые (Greiner), микронаконечники с фильтром на 1-20, 1-200 и 100-1000 мкл (QSP), насадки к дозатору Eppendorf на объемы 1 мл, 2,5 мл и мл, до пластиковые пробирки с завинчивающейся крышкой на 15 и 50 мл (Greiner), культуральные флаконы (Greiner), чашки Петри 90 мм (Greiner), центрифужные пробирки Nalgene, стеклянная лабораторная посуда с градуировкой и пластиковыми завинчивающимися крышками Scott Duran, конические колбы на 100, 250 и 500 мл, мерные цилиндры на 50, 250, 500 и 1000 мл, 96-луночные планшеты для ИФА (ВНИИ-Медполимер, Labsystems), фотопленка листовая PalopanPro100 (Polaroid).

Выделение РНК из культуральных и полевых образцов.

Выделение РНК из культуры клеток и полевых образцов проводили с использованием неорганического сорбента (SiO2).

К 300 мкл образца добавляли 600 мкл раствора L6 (лизирующий буфер с гуанидинтиоционатом) и инкубировали при комнатной температуре в течение 10 минут при равномерном перемешивании на шейкере. Затем центрифугировали 5 минут, 13000 об/мин, переносили надосадочную жидкость (если формировался осадок) в чистые пробирки и добавляли 40 мкл сорбента, тщательно перемешивали и снова инкубировали 10 минут при комнатной температуре на шейкере. Центрифугировали 30 секунд, об/мин при, удаляли надосадок. Затем промывали осадок сорбента с РНК раза 200 мкл раствора L2 (промывочный буфер), и 2 раза 70% этанолом.

Осадок подсушивали в течение 10 минут при 560С и элюировали РНК с сорбента 30-40 мкл воды, обработанной диэтилпирокарбонатом (Гребенникова Т.В., 2005).

Проведение ОТ-ПЦР.

Реакция проводилась в конечном объёме 65 мкл. Реакционная смесь содержала 5 мкл РНК, 10 мМ Tris-HCl (pH 9,0 при 25C), 50 мM KCl, 0,1% Triton X-1000, 0,25 мМ MgCl2, 0.25 мM каждого dNTP, по 10 pmol каждого праймера, 0,5 мкл IRNase, 0,25 ед. Taq-полимеразы, 50 ед. MMLV-ревертазы.

Объём доводили водой до 25 мкл. К ПЦР смеси добавляли 40 мкл минерального масла.

Температурные условия проведения реакции:

Анализ результатов ОТ-ПЦР.

Анализ фрагментов ДНК проводили методом электрофореза в агарозном геле. В 1% гель вносили по 7,5 мкл продуктов ПЦР (или по 1-2 мкл очищенной плазмидной ДНК) при длине фрагмента более 1000 пар нуклеотидов, в 2% - при длине фрагмента менее 1000 пар нуклеотидов.

Электрофорез проводили с использованием Трис-ацетатного буфера, содержащего бромистый этидий в концентрации 0,4 – 0,5 мкг/мл, при напряженности электрического поля 10 – 15 В/см в течение 30 минут. Гели просматривали в ультрафиолетовом свете с длинной волны 254 нм.

Проведение ПЦР в реальном времени.

Реакция проводилась в конечном объёме 25 мкл. Реакционная смесь содержала 5 мкл РНК, 4 мкл 10-кратного TAE-буфера буфера с 0,25 мМ MgCl2, 0.25 мM каждого dNTP, по 10 pmol каждого праймера, 10 pmol зонда 0,5 мкл IRNase, 0,25 ед. Taq-полимеразы, 50 ед. MMLV-ревертазы. Объём доводили водой до 25 мкл.

Температурные условия проведения реакции:

Анализ результатов ПЦР в реальном времени.

Результаты ПЦР в реальном времени автоматически выводились на экран монитора компьютера в виде графика зависимости интенсивности флуоресценции от порогового цикла.

Базовую линию выбирали как среднее значение флуоресценции в широком диапазоне циклов до появления репортерной флуоресценции (т.е.

до начала детекции экспоненциальной фазы). При выборе диапазона игнорировали циклы, находящиеся вне экспоненциальной фазы, в которых наблюдались скачки флуоресценции.

За пороговый уровень выбирали минимальный уровень флуоресценции, который во всех проведенных с данной парой праймеров реакциях соответствует началу экспоненциальной фазы.

Конструирование генно-инженерных положительных контролей Для получения генно-инженерного контроля ПЦР был использован фирменный вектор pGEM T-Easy (Promega, США).

Для получения генноинженерного положительного контроля использовали пары праймеров, разработанные для диагностических тестсистем (см. Материалы и методы). Названия пар праймеров представлены в таблице 6.

Олигонуклеотидные праймеры для создания рекомбинантных плазмид Рекомбинантная Названия праймеров плазмида Положительный контроль для обнаружения гена Н вируса гриппа А подтипа H5N1 методом ПЦР Положительный контроль для обнаружения гена N вируса гриппа А подтипа H5N1 методом ПЦР Положительный контроль для обнаружения гена Н вируса гриппа А подтипа H5N1 методом ПЦР в реальном времени Положительный контроль для обнаружения гена N вируса гриппа А подтипа H5N1 методом ПЦР в реальном времени Наработанные фрагменты вырезали из геля и выделяли с использованием набора для очистки ПЦР-продуктов (Promega) по методике производителя.

Реакционная смесь содержала 5 – 7 мкл фрагмента ДНК, 0,5 – 1 мкл вектора, 1 мкл лигазы Т4, 1 мкл буфера. Реакционную смесь инкубировали в течение 10 – 12 часов при 160С (Маниатис Т., 1984.).

Получение компетентных клеток.

Свежую колонию клеток Е.Coli пересевали вольфрамовой петлёй (стерильно) и растили в течение ночи при 370С в режиме качания. Далее производили посев ночной культуры в 200мл среды LB и инкубировали культуру при 370С на качалке, контролируя величину оптической плотности культуры. Оптическую плотность определяли на спектрофотометре при =600 нм, по достижении середины логарифмической фазы роста оптическая плотность составляет 0,4-0,6. Затем культуру быстро переносили в центрифугированием на центрифуге “Beckman” при 1000g ( 3000 об/мин.) в течение 10 минут при +40С. К осадку добавляли 0,1М CaCl2 (1/2 начального объёма). Клетки ресуспендировали и инкубировали во льду 30 минут, затем центрифугировали при 1000g в течение 10 минут при +4 0С. Тщательно удаляли супернатант. Клетки ресуспендировали в 2 мл 0,1М CaCl 2 c 15% полипропиленовые пробирки и хранили при –700С.

Трансформация (электропарация) компетентных E. coli.

Для трансформации был использован штамм TOP TEN. Выполнение работы включало в себя следующие этапы:

Размораживание на льду компетентные клетки Добавление к клеткам плазмиды в количестве 0,5-2мкл (в зависимости от ее концентрации) Аккуратный перенос смесь клеток с плазмидой в пробирку для электропарации, стараясь избежать пузырьков в жидкости.

Помещение пробирки в электропаратор и установка напряжения (для пробирки с толщиной стенки 2 мм – 2500, а для 1 мм – 1800).

Проводение электропарации.

Добавление среды LB (600мкл) в пробирку. Перенос жидкости из пробирки для электропарации в пробирку типа «Eppendorf».

Инкубация 1-1,5 часа при 370С, и высеивание клетки на чашки Петри по 200мкл (LB amp100).

Инкубация чашек Петри в термостате при 37 0 С в течение ночи.

Рестриктный анализ.

Для проведения рестриктного анализа реакция проводилась в конечном объеме 20 мкл. Реакционная смесь содержала 5-10 мкл очищенного амплификата, 1 мкл рестриктазы, 2 мкл соответствующего 10х буфера (для рестриктаз SalI и SpeI – buffer D (Promega), EcoRI и XhoI - buffer Y+/Tango 2* (Fermentas)). Объем доводили водой до 20 мкл. Реакция инкубировалась час, при 370С.

рекомбинантной плазмиды.

Массовую концентрацию С (мкг/ мл) раствора рекомбинантной плазмиды определяли спектрофотометрически на спектрофотометре «Biophotometr». В кювету для спектрофотометра помещали 50 мкл деионизованной воды и 2 мкл рекомбинантной плазмиды. Смесь аккуратно пипетировали для полного перемешивания. Кювету помещали в ячейку прибора. Измерения осуществляли в соответствии с инструкцией для пользователя.

массовой по формуле:

n (молекул/мкл) молекулярная концентрация плазмиды;

С (г/мкл) массовая концентрация плазмиды в растворе;

NA = 6,022 1023 (молекул/моль) число Авогадро;

Xп. н. = число пар нуклеотидных оснований (п. н.) в составе плазмиды;

M1 п. н. = 660 (г/моль) средняя молярная масса 1 п. н.

Приготовление стандартных растворов рекомбинантной плазмиды для количественной ПЦР в реальном времени Для приготовления стандартных растворов брали 9 пластиковых пробирок на 1,5 мл, маркировали их цифрами и наливали в каждую из них по 90 мкл деионизованной воды. В 1-ю пробирку добавляли 10 мкл концентрированной референтной плазмиды известной концентрации (определена спектрофотометрически), раствор тщательно пипетировали.

Отбирали 10 мкл полученного в 1-й пробирке раствора и вносили его во 2-ю пробирку, пипетировали. Отбирали 10 мкл полученного во 2-й пробирке раствора и вносили его во 3-ю пробирку, пипетировали. Таким образом, последовательно перенося по 10 мкл свежеприготовленного раствора из пробирки с предыдущим номером в пробирку с последующим, готовили разведений рекомбинантной плазмиды с амплифицируемым фрагментом вируса.

Статистическая обработка результатов Анализ и статистическую обработку результатов проводили с использованием программы «Microsoft Excel», входящую в пакет программ «Microsoft office, 2007». Обработку данных ПЦР в реальном времени проводили с помощью программного обеспечения «RealTime_PCR v 7.3»

детектирующего амплификатора ДТ-96 (НПО «ДНК-Технология», Россия).

Синтез рекомбинантного неструктурного белка NS1 вируса гриппа А подтипа H5N1 в прокариотической системе экспрессии.

Для получения и последующего клонирования гена, кодирующего белок NS1 вируса гриппа А подтипа H5N1 при синтезе его в прокариотической системе экспрессии, использовали праймеры, представленные в таблице 5.

Температурные условия проведения реакции для синтеза кДНК участка РНК гена NS1 вируса гриппа А подтипа H5N1 :

Продукт ПЦР встраивали в вектор pET32b+ (“Novagen”, США) по имеющимся в полилинкере соответствующим сайтам рестрикции. Данный вектор содержит последовательность, кодирующую шесть гистидиновых остатков - (His)6, а также содержит тиоредоксиновый домен (trx).

Продукция рекомбинантного белка NS1 вируса гриппа А подтипа H5N1.

Очищенную рекомбинантную плазмиду pET32b+, содержащую ген NS1, использовали для химической трансформации штамма BL21trxB(DE3)pLysS.

Бакмассу осаждали центрифугированием и использовали для выделения рекомбинантных белков.

Очистка рекомбинантного белка NS1методом металло-хелатной аффинной хроматографии (МХАХ).

Рекомбинантный белок очищали из биомассы клеток E. coli на NI-NTA агарозе (Qiagen, США) в нативных и денатурирующих условиях по модифицированной методике фирмы-производителя.

Нативные условия очистки Клеточную массу лизировали охлажденным буферным раствором, содержащим 20 мМ Трис-HCL + 300 мМ NaCl + 10мМ имидазол + 0,1% тритон X100 + 1мМ PMSF, рН 8,0 из расчета 20 мл на 1 г сырой биомассы.

Лизат дезинтегрировали ультразвуком, 6 раз по 10 сек с интервалом 10 сек (на ультразвуковом гомогенизаторе Sonifier Model 250/450, США), и центрифугировали 60 мин при 10 000 об/мин. Супернатант смешивали с NiNTA агарозой, уравновешенной фосфатно-солевым буферным раствором [ФСБ: (20 мМ Na2HPO4–NaH2PO4)+ 150 мМ NaCl], рН 8,0). Смесь инкубировали при 40С и перемешивании в течение 16 часов.

Очистку белков проводили после перенесения Ni-NTA агарозы в хроматографическую колонку размером (1х10)см. Агарозу последовательно отмывали от избытка белка трис-буферным раствором (ТБР: 20 мМ трис-НСl + 300 мМ NaCl + 1 мМ PMSF), рН 8,0; содержащим 10, 20 и 50 мМ имидазола, контролируя процесс по оптической плотности элюатов ( = нм), регистрируемой самописцем. Продукт элюировали в одну пробирку трис-буферным раствором, содержащим 250мМ имидазола.

Денатурирующие условия очистки Клеточную массу лизировали охлажденным буферным раствором [ мМ трис-НСl + 300 мМ NaCl + 6 М Gu-HCL + 10 мМ имидазол + 1 мМ PMSF, рН 8,0] из расчета 20 мл на 1 г сырой биомассы. Далее производили те же операции, что и при очистке белков в нативных условиях, но во все буферные растворы добавляли 6М мочевину (Johnson R.D., 1995).

Иммунохимическую активность в каждой фракции определяли методом непрямого ИФА и иммуноблоттинга со специфическими моноклональными антителами (мкАТ).

Степень чистоты полученных препаратов проверяли методом SDSэлектрофореза в 12% полиакриламидном геле (ПААГ).

Концентрацию белка в растворах определяли с использованием коммерческого набора “Micro BCA Protein Assay Kit” фирмы “PIERCE” (США).

очищенного рекомбинантного белка, разведенного 0,1 М карбонатнобикарбонатным буфером (КББ) рН 9.5. Планшет инкубировали 18 час при 4оС, после чего удаляли избыток антигена пятикратной отмывкой ФСБТ (0, М фосфатный буфер, 150 мM NaCl, 0,1% твин-20, pH 7,4). Свободные участки пластика блокировали 1% Top Block (Yuro, Швейцария) в ФСБТ ( час при 370С), удаляли блокирующий раствор и вносили в лунки 0,1 мл мкАТ в растворе ФСБТ + 0,5% бычьего сывороточного альбумина. Планшет инкубировали 1 час при 370С, промывали ФСБТ и добавляли 0,1 мл меченых пероксидазой антител к иммуноглобулину G человека в растворе ФСБТ + 0,5% бычьего сывороточного альбумина (“Sigma”, США). Через 1 час инкубации при 37оС отмывали планшет ФСБТ и вносили в лунки 0,1 мл субстратного раствора перекиси водорода с 3,3',5,5'-тетраметилбензидином (ТМB, “МДЛ”, Россия). Инкубировали 20 мин при комнатной температуре и останавливали реакцию добавлением 0,1 мл 1M H2SO4. Интенсивность окраски в лунках определяли на спектрофотометре с вертикальным лучом (Multiscan MCC, Flow, Англия) при 450 нм (А450).

Наличие в исследуемой сыворотке антител к гену NS1 определяли антителами, величину которого вычисляли по формуле - (А450 ИСср) - среднее (из двух повторов) арифметическое значение оптической плотности (А450) для каждой исследуемой сыворотки (ИС);

- (А450 К+ср) – среднее (из двух повторов) арифметическое значение оптической плотности (А450) для проб К+ А450 К-ср ) - среднее (из двух повторов) арифметическое значение оптической плотности (А450) для проб К- (Mateo C., 2001).

Иммуноблоттинг.

На первом этапе проводят электрофоретическое разделение сложной смеси биологических макромолекул в присутствии додецилсульфата натрия.

Затем осуществляют собственно электрофоретический перенос разделённых белков из геля на твёрдую подложку. Наконец, перенесённые белки выявляют на полученной таким образом блоте с помощью непрямого иммуноферментного анализа.

4.1. Разработка тест-системы для обнаружения и дифференциации РНК вируса гриппа А подтипа Н5N1 методом ПЦР.

4.1.1. Подбор праймеров, оптимизация условий проведения ПЦР.

Учитывая большую вариабельность генома вируса гриппа типа А, при его обнаружении необходимо использовать праймеры, соответствующие наиболее консервативным участкам вирусного генома. Основой для поиска мест посадок праймеров стало сопоставление нуклеотидных последовательностей гена гемагглютинина и нейраминидазы всех вирусов гриппа, находящихся в базе данных. Всего использовали более нуклеотидных последовательностей геномов вирусов гриппа.

требования: специфичность праймеров для всех последовательностей вирусов подтипа H5N1, отсутствие мест посадки праймеров на последовательности вирусов других подтипов. В качестве дополнительных критериев, определяющих пригодность праймеров, учитывались следующие:

отсутствие дупликсов праймеров и отжига их друг на друга, отсутствие мест ложной посадки на матрицы геномов различных штаммов вируса гриппа А и родственных вирусов. Этим критериям удовлетворяют все отобранные праймеры.

последовательностей гена НА различных штаммов вируса гриппа А подтипа H5N1. Отмечены сайты посадки олигонуклеотидных праймеров, использованных в тест-системе ПЦР.

В результате реакции обратной транскрипции и амплификации синтезируется отрезок генома гена Н размером 184 п.н.

последовательностей гена NА различных штаммов вируса гриппа А подтипа H5N1. Отмечены сайты посадки олигонуклеотидных праймеров, использованных в тест-системе ПЦР.

В результате реакции обратной транскрипции и амплификации синтезируется отрезок генома гена N размером 213 п.н.

4.1.2. Определение специфичности ПЦР тест-системы.

референтных штаммах вируса гриппа, полученных из коллекции ФГБУ «НИИ Вирусологии им. Д. И, Ивановского» Минздрава РФ (таблица 1).

Результаты проведения ПЦР с использованием разработанной тест-системы представлены на рисунке 12.

Результаты исследования эпидемических штаммов вируса гриппа, выделенных от людей, показали, что с помощью разработанной тест-системы можно выявить геном вируса гриппа А подтипа N1. Специфичность тестсистемы также была проверена с эпидемическими и эталонными штаммами вируса гриппа А, выделенными от животных, в том числе и от птиц. Показано наличие РНК вируса гриппа А подтипа Н5 в эталонных штаммах А/Mallard/Pensylvania/10218/84 и А/Grebe/Novosibirsk/29/05, а также РНК вируса гриппа А подтипа N1 в эталонных штаммах A/WSN/33, A/FPV/Росток и А/Grebe/Novosibirsk/29/05. При обнаружении РНК вируса гриппа А подтипа N положительные результаты были получены с эпидемическими штаммами А/СССР/90/77 (Н1N1) и A/WSN/33 (Н1N1), хранившимися в замороженном состоянии длительное время (несколько лет при перекрестных реакций с вирусами других семейств (Paramyxoviridae, Coronaviridae, Birna Viridae).

Рисунок.12. Детекция РНК вируса гриппа А подтипа H5 и N1.

Треки 1-26 – результаты анализа образцов, содержащих вирусы гриппа А и В, треки М – маркер молекулярного веса «GeneRuler 100 bp». Номера треков совпадают с порядковыми номерами вирусов, представленных в таблице 1.

Также с помощью разработанной тест-системы были протестированы штаммов вируса гриппа А с различными титрами в РГА (таблица 7).

Референтные штаммы вируса гриппа А с различными титрами в РГА.

R Крачка/Ю.А./61 СССР/90/77 № R ДК/Приморье/2621/01 PR/8/34 клон./адапт H5N (реассортант) (22/2) Молекулярного Рисунок 13. Детекция РНК вируса гриппа А подтипа N1.

Треки 1-6 – результаты анализа референтных штаммов вируса гриппа А.

представленных в таблице 6.

Результаты ПЦР показали, что положительный результат получали только при наличии гемагглютинина 5 типа и нейраминидазы 1 типа в различных титрах. ПЦР с использованием других подтипов вируса гриппа А показала отрицательный результат. На рисунке 13 пример электрофореза после проведения ПЦР на матрице гена нейраминидазы. Видно, что положительный результат получен в случае детекции вируса гриппа А подтипа N1.

4.1.3. Определение чувствительности ПЦР тест-системы Для определения чувствительности разработанного метода использовали образец вируса A/Grebe/Novosibirsk/29/05 с начальным титром 105 ЭИД50/мл.

Далее готовили серию последовательных десятикратных разведений образца вируса.

Затем проверяли в ПЦР на наличие РНК вируса гриппа А подтипа Н (рисунок14) и N1 (рисунок 15).

Рисунок 14. Детекция РНК вируса гриппа А подтипа Н5.

1. Исходный Вирус гриппа А/Н5N1 (105 ЭИД50/мл). 2-6. разведения вируса гриппа А/Н5N1 от 104 ЭИД50/мл до 1 ЭИД50/мл.

Рисунок 15. Детекция РНК вируса гриппа А подтипа N1.

1. Исходный вирус гриппа А/Н5N1 (105 ЭИД50/мл). 2-6. разведения вируса гриппа А/Н5N1 от 104 ЭИД50/мл до 1 ЭИД50/мл.

Исходя из полученных результатов можно говорить о том, что предел обнаружения РНК вируса гриппа подтипа Н5 составляет 102 ЭИД50/мл, а предел обнаружения РНК вируса гриппа А подтипа N1 – 103 ЭИД50/мл.

4.1.4. Конструирование генно-инженерного положительного контроля Для синтеза «положительного» контроля на вирус гриппа А подтипа Н5N1 были использованы праймеры, разработанные ранее для этой тестсистемы. Матрицей для синтеза специфических фрагментов был A/Grebe/Novosibirsk/29/05. Фрагмент гена НА вируса гриппа А подтипа H5N размером 184 п.н. и фрагмент гена NА вируса гриппа А подтипа H5N размером 213 п.н клонировали в плазмиду pGEM-T Easy.

После трансформации компетентных клеток E.coli проводили скрининг клонов методом ПЦР, чтобы обнаружить присутствие плазмиды со специфичным фрагментом. Также было проведено секвенирование полученных вставок. Последовательности, полученные в результате A/Grebe/Novosibirsk/29/05.

Сравнение показало, что нуклеотидные последовательности вставок на 100% совпадают с нуклеотидными последовательностями вируса, использованного для изготовления «положительных» контролей.

Массовую концентрацию плазмид определяли спектрофотометрически при длине волны =260 нм. Среднее значение концентраций рассчитывали по результатам 6-ти измерений (табл. 8). Плазмиды в десятикратных разведениях использовались в качестве матрицы при постановке ОТ-ПЦР.

Массовые и молекулярные концентрации рекомбинантных плазмид Концентрация выделенных рекомбинантных плазмид pGEM-H5 и pGEMN1 оказалась равна 0,2 мкг/мкл и 0,205 мкг/мкл соответственно. Данная концентрация соответствует количеству ДНК, равному 5,7107 молекул/мкл для плазмиды pGEM-H5 и 5,8107 молекул/мкл для плазмиды pGEM-N1.

После измерения концентрации готовили серию разведений плазмид (от 10 - до 10-10). В качестве матрицы при постановке ОТ-ПЦР использовали серию разведений исходных плазмид. (Рисунок 16,17). Таким образом, были получены генно-инженерные положительные контроли, представляющие собой бактериальную плазмиду со вставкой фрагмента гена HА и гена NА вируса гриппа А подтипа Н5N1.

Рисунок 16. Результаты ПЦР на матрице серии последовательных разведений рекомбинантной плазмиды pGEM-H Трек 1. Исходная рекомбинантная плазмида (5,7107 молекул/мкл) Треки 2 –10. - разведения рекомбинантной плазмиды (5,7 106 – 5, молекул/мкл).

Рисунок 17. Результаты ПЦР на матрице серии последовательных разведений рекомбинантной плазмиды pGEM-N Трек 1. Исходная рекомбинантная плазмида (5,8107 молекул/мкл) Треки 2 –10. - разведения рекомбинантной плазмиды (5,8 106 – 5, молекул/мкл).

На основе представленных данных разработана «Тест-система для обнаружения и дифференциации вируса гриппа А подтипа H5N1 методом ПЦР». Проведены испытания разработанной тест-системы, совместно с Всероссийским государственным Центром качества и стандартизации лекарственных средств для животных и кормов (ФГБУ «ВГНКИ») и разработан пакет разрешительных документов: СТО 42418073-0001-20076262199 и Инструкция по применению тест-системы, утвержденные в Министерстве Сельского хозяйства РФ. Данная тест-система запатентована и имеет сертификат соответствия № РОСС RU.ФВ01.Н26634.

4.2. Разработка тест-системы для обнаружения вируса гриппа А подтипа 4.2.1. Подбор праймеров, оптимизация условий проведения ПЦР.

Олигонуклеотидные праймеры для проведения ПЦР в реальном времени были подобраны на основе сравнительного анализа геномов различных штаммов вируса гриппа А подтипа H5N1.

температурами плавления (Tm). Температура плавления праймеров различалась не более чем на 10С. Температуру отжига праймеров вычисляли по упрощенной формуле: (4GC+2AT)-50C, где АТ – суммарное содержание нуклеотидов А и Т, GC – суммарное содержание нуклеотидов G и C в праймере. Расчетная температура отжига составила 570С. При выборе оптимальных праймеров обращали внимание на то, чтобы их температуры плавления различались не более чем на 20С, а Tm зонда была на 100С выше Tm праймеров. Для системы детекции были использованы излучатель флуоресцентного сигнала FAM и гаситель BHQ1.



Pages:   || 2 | 3 |
 
Похожие работы:

«КРЕТЕНЧУК ОКСАНА ФЕДОРОВНА РАЗРАБОТКА НОВЫХ ПРЕПАРАТОВ НА ОСНОВЕ МОНОКЛОНАЛЬНЫХ АНТИТЕЛ ДЛЯ ДИАГНОСТИКИ ХОЛЕРНЫХ ВИБРИОНОВ О1, О139 СЕРОГРУПП УСКОРЕННЫМИ МЕТОДАМИ 03.01.06 – биотехнология (в том числе бионанотехнологии) Диссертация на соискание...»

«УДК 579.695+579.66’112.3+663.14 КИРИЦА ЕЛЕНА НАПРАВЛЕННЫЙ СИНТЕЗ КАРОТИНОИДОВ У ДРОЖЖЕЙ И ПЕРСПЕКТИВА ИХ ИСПОЛЬЗОВАНИЯ 03.00.23 - БИОТЕХНОЛОГИЯ Диссертация на соискание ученой степени доктора биологии Научный руководитель : Усатый А. С., Доктор хабилитат биологии, конф. исследователь Автор: Кирица Елена Кишинев СОДЕРЖАНИЕ ВВЕДЕНИЕ.. 1. КАРОТИНОИДНЫЕ ПИГМЕНТЫ – БИОЛОГИЧЕСКИЕ ФУНКЦИИ И ПЕРСПЕКТИВА ИСПОЛЬЗОВАНИЯ. 1.1. Микроорганизмы...»

«Кулаков Сергей Сергеевич Очаговое усыхание Pinus sylvstris на юге Красноярского края в результате воздействия корневых патогенов Диссертация на соискание ученой степени кандидата биологических наук по специальности 03.02.08 – Экология Научный руководитель, доктор биологических наук, профессор И.Н. Павлов Красноярск 2014 1 СОДЕРЖАНИЕ Введение.. 1 Современное...»

«Вакурин Алексей Александрович Хромосомная изменчивость и дифференциация близких таксонов мелких млекопитающих на примере представителей родов Cricetulus, Tscherskia и Ochotona 03.02.04 – зоология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : д.б.н., с.н.с. Картавцева Ирина Васильевна Владивосток –...»

«Федосеева Лариса Абрамовна Экспрессия ключевых генов ренин-ангиотензиновой системы у гипертензивных крыс НИСАГ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научные руководители: д.б.н., проф. А.Л.Маркель д.б.н., проф. Г.М.Дымшиц Новосибирск 2  ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ..................»

«Сафиуллина Регина Ринатовна ЦИАНОБАКТЕРИАЛЬНО-ВОДОРОСЛЕВЫЕ ЦЕНОЗЫ ЧЕРНОЗЕМА ОБЫКНОВЕННОГО ПОД РАСТЕНИЯМИ-ФИТОМЕЛИОРАНТАМИ В ЗАУРАЛЬЕ РЕСПУБЛИКИ БАШКОРТОСТАН 03.02.13 – Почвоведение 03.02.01 – Ботаника Диссертация на соискание ученой степени кандидата биологических наук Научные...»

«СИЛУЯНОВА ЭЛИНА ВЛАДИМИРОВНА ЭВОЛЮЦИОННАЯ ИЗМЕНЧИВОСТЬ ВИРУСОВ ГРИППА А(H3N2) и В в ПЕРИОД 2003-2013 гг. в РФ. 03.02.02-вирусология 03.01.03 – молекулярная биология ДИССЕРТАЦИЯ на соискание учной степени кандидата биологических наук Научные руководители: доктор медицинских наук Бурцева Е.И. кандидат...»

«ПЛОТНИКОВ ВАДИМ АЛЕКСЕЕВИЧ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ И БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА ПОЛЕВЫХ ИЗОЛЯТОВ ВИРУСА ЛЕЙКОЗА ПТИЦ, ЦИРКУЛИРУЮЩИХ НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ Специальность 03.02.02 - вирусология ДИССЕРТАЦИЯ На соискание ученой степени кандидата биологических наук Научный руководитель доктор биологических наук, профессор Алипер Т. И. Москва- ОГЛАВЛЕНИЕ...»

«НОВИКОВ Сергей Геннадьевич ЭКОЛОГИЧЕСКАЯ ОЦЕНКА ЗАГРЯЗНЕНИЯ ТЯЖЁЛЫМИ МЕТАЛЛАМИ ПОЧВ УРБАНИЗИРОВАННЫХ ТЕРРИТОРИЙ ПО КАТЕГОРИЯМ ЗЕМЛЕПОЛЬЗОВАНИЯ (НА ПРИМЕРЕ Г. ПЕТРОЗАВОДСКА) Специальность 03.02.08 – экология ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук научный руководитель: доктор сельскохозяйственных наук, профессор Федорец Наталия Глебовна...»

«Подсвирова Ирина Александровна Микробиологический мониторинг патогенов гнойновоспалительных заболеваний в хирургических отделениях и в отделении реанимации и интенсивной терапии в многопрофильном стационаре 03.02.03 – микробиология Диссертация на соискание учёной степени кандидата медицинских наук...»

«Бухарина Наталья Сергеевна ВИЗУАЛИЗАЦИЯ И МОНИТОРИНГ АКТИВНОСТИ ЦИТОХРОМА P450 BM3 С ИСПОЛЬЗОВАНИЕМ АТОМНО-СИЛОВОЙ МИКРОСКОПИИ Специальность 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор Ю.Д. Иванов Москва –...»

«ДЕМАКОВА Наталья Александровна ИЗУЧЕНИЕ РОЛИ ПОЛИМОРФНЫХ ВАРИАНТОВ ГЕНОВ ЦИТОКИНОВ В ФОРМИРОВАНИИ ГИПЕРПЛАСТИЧЕСКИХ ПРОЦЕССОВ ЭНДОМЕТРИЯ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель : доктор медицинских наук, профессор Чурносов Михаил Иванович Белгород – СОДЕРЖАНИЕ Стр. ВВЕДЕНИЕ..5- ГЛАВА 1. Обзор литературы..11- 1.1. Молекулярные...»

«Жданова Оксана Леонидовна Математическое моделирование естественной эволюции структурированных биологических популяций и эволюционных последствий промысла Специальность 03.01.02 – биофизика Диссертация на соискание ученой степени доктора физико-математических наук Научный консультант чл.-корр. РАН, профессор Фрисман Е.Я....»

«ЧИСТЯКОВА АННА АЛЕКСАНДРОВНА Оптимизация технологии получения иммуногенного мембранного протеина B r u c e l l a a b o r t u s в растительных клетках 03.00.00 - Биологические наук и Диссертация на соискание академической степени доктора PhD Члены консультационной комиссии: Научный руководитель : д.м.н., проф. Алмагамбетов К.Х. Научный консультант : Prof. Dr. Heribert Warzecha Республика Казахстан Астана,...»

«МИРОШНИЧЕНКО ЮЛИЯ АЛЕКСАНДРОВНА СОСТОЯНИЕ МУКОЗАЛЬНОГО БАРЬЕРА РЕПРОДУКТИВНОГО ТРАКТА И УРОВЕНЬ АДИПОКИНОВ У ЖЕНЩИН ПРИ ФИЗИОЛОГИЧЕСКОЙ БЕРЕМЕННОСТИ Специальность: 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель : доктор...»

«Никитенко Елена Викторовна МАКРОЗООБЕНТОС ВОДОЕМОВ ДОЛИНЫ ВОСТОЧНОГО МАНЫЧА 03.02.10 – гидробиология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель : доктор биологических наук, Щербина Георгий Харлампиевич Борок – 2014 СОДЕРЖАНИЕ ВВЕДЕНИЕ ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ ГЛАВА 2. ФИЗИКО–ГЕОГРАФИЧЕСКАЯ ХАРАКТЕРИСТИКА РАЙОНОВ ИССЛЕДОВАНИЯ...»

«ДЖАМБЕТОВА ПЕТИМАТ МАХМУДОВНА ГЕНЕТИЧЕСКИЕ ПОСЛЕДСТВИЯ ЗАГРЯЗНЕНИЯ ОКРУЖАЮЩЕЙ СРЕДЫ НЕФТЕПРОДУКТАМИ В ЧЕЧЕНСКОЙ РЕСПУБЛИКЕ 03.02.07 – генетика Диссертация на соискание ученой степени доктора биологических наук Научные консультанты: доктор биологических наук, профессор Сычева Л.П.; доктор биологических наук Рубанович А.В. Грозный –  ...»

«Тишкова Антонина Сергеевна ИССЛЕДОВАНИЯ МОРФОЛОГИЧЕСКИХ ОСОБЕННОСТЕЙ ХРУСТАЛИКА ГЛАЗА С ДИАБЕТИЧЕСКОЙ И ВОЗРАСТНОЙ КАТАРАКТАМИ 03.01.02 – биофизика 14.01.07 – глазные болезни Диссертация на соискание ученой степени кандидата медицинских наук Научные руководители:...»

«Доан Хоанг Жанг БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ НЕКОТОРЫХ ПРЕДСТАВИТЕЛЕЙ РОДА MOMORDICA L. (CUCURBITACEAE) ПРИ ИНТРОДУКЦИИ В УСЛОВИЯХ БЕЛГОРОДСКОЙ ОБЛАСТИ Специальность: 03.02.01 – ботаника ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный...»

«СОКОЛОВА ЕКАТЕРИНА АНАТОЛЬЕВНА МИКРОБИОЛОГИЧЕСКИЕ АСПЕКТЫ ВНУТРИУТРОБНЫХ ПНЕВМОНИЙ С РАЗЛИЧНЫМ ИСХОДОМ 03.02.03 – микробиология ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор Э.С. Горовиц, доктор медицинских наук, профессор Г.Г. Фрейнд Пермь – ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ.....»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.