WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 | 3 |

«РЕГУЛЯЦИЯ БИОСИНТЕЗА РЕЗВЕРАТРОЛА ГЕНАМИ Сa2+ЗАВИСИМЫХ ПРОТЕИНКИНАЗ В КЛЕТКАХ ВИНОГРАДА АМУРСКОГО VITIS AMURENSIS RUPR. ...»

-- [ Страница 1 ] --

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ

УЧРЕЖДЕНИЕ НАУКИ

БИОЛОГО-ПОЧВЕННЫЙ ИНСТИТУТ

ДАЛЬНЕВОСТОЧНОГО ОТДЕЛЕНИЯ

РОССИЙСКОЙ АКАДЕМИИ НАУК 

На правах рукописи

АЛЕЙНОВА ОЛЬГА АРТУРОВНА

РЕГУЛЯЦИЯ БИОСИНТЕЗА РЕЗВЕРАТРОЛА ГЕНАМИ Сa2+ЗАВИСИМЫХ ПРОТЕИНКИНАЗ В КЛЕТКАХ ВИНОГРАДА

АМУРСКОГО VITIS AMURENSIS RUPR.

03.01.06 – биотехнология (в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель:

к.б.н. Киселёв К.В.

ВЛАДИВОСТОК

СПИСОК СОКРАЩЕНИЙ

ВВЕДЕНИЕ

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Биологически активные свойства резвератрола

1.2. Основные источники резвератрола

1.3. Биосинтез резвератрола и его производных

1.4. Классические биотехнологические приемы увеличения продукции резвератрола в культуре клеток винограда

1.5. Участие ионов Сa2+ в регуляции биосинтеза вторичных метаболитов, кальций-зависимые протеинкиназы (CDPK)

1.6. Характеристика семейства CDPK винограда

1.7. Типы альтернативного сплайсинга растений

ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ

2.1. Клеточные линии и компоненты питательных сред

2.2. Обработка блокатором потенциал-зависимых мембранных Ca2+-каналов, специфическим ингибитором CаМ-подобных протеинкиназ и ионофором Ca2+ А23187

2.3. Выделение нуклеиновых кислот и получение комплементарной ДНК... 2.4. Количественная оценка экспрессии генов STS

2.5. Количественная оценка экспрессии эдногенных генов VaCDPK в нетрансгенных клетках винограда

2.6. Получение полной последовательности генов VaCDPK1a, VaCDPK1e, VaCDPK1d, VaCDPK2a, VaCDPK3c и VaCDPK3a





2.7. Получение трансгенных клеточных линий V. amurensis, сверхэкспрессирующих гены VaCDPK, c помощью агробактериальной трансформации

2.8. Проверка трансгенности полученных клеточных линий винограда........ 2.9. Определение содержания стильбенов в образцах ткани V. amurensis...... 2.10. Получение рекомбинантных белков и анализ их протеинкиназной активности

2.11. Статистическая обработка полученных результатов

ГЛАВА 3. РЕЗУЛЬТАТЫ

3.1. Влияние верапамила на рост, биосинтез резвератрола и экспрессию генов STS и VaCDPK в клеточных линиях V. amurensis

3.2. Влияние специфического ингибитора СаМ-подобных протеинкиназ на рост, биосинтез резвератрола и экспрессию генов STS и VaCDPK в культуре клеток V. amurensis с повышенной продукцией резвератрола

3.3. Влияние ионофора Са2+ на рост, биосинтез резвератрола и экспрессию генов STS и VaCDPK в клеточных линиях V. amurensis

3.4. Характеристики VaCDPK-трансгенных клеточных линий винограда..... 3.4.1. VaCDPK1a-трансгенные клеточные линии винограда

3.4.2. VaCDPK3a-трансгенные клеточные линии винограда

3.4.3. VaCDPK1d-трансгенные клеточные линии винограда

3.4.4. VaCDPK2а-трансгенные клеточные линии винограда

3.4.5. VaCDPK1е-трансгенные клеточные линии винограда

3.4.6. VaCDPK3с-трансгенные клеточные линии винограда

3.5. Протеинкиназная активность полноразмерного белка VaCDPK3a и его укороченных вариантов

ГЛАВА 4. ОБСУЖДЕНИЕ

ВЫВОДЫ

СПИСОК ЛИТЕРАТУРЫ

СПИСОК СОКРАЩЕНИЙ

АНУ – -нафтилуксусная кислота АТФ – аденозинтрифосфат БАВ – биологически активные вещества БАД – биологически активные добавки БАП – 6-бензиламинопурин ВЭЖХ – высокоэффективная жидкостная хроматография ДНК – дезоксирибонуклеиновая кислота кДНК – комплементарная дезоксирибонуклеиновая кислота мРНК – матричная рибонуклеиновая кислота ОТ-ПЦР – обратно-транскрипционная полимеразная цепная реакция Пре-мРНК – предшественник матричной рибонуклеиновой кислоты ПЦР – полимеразная цепная реакция ПЦР РВ – полимеразная цепная реакция в реальном времени РНК – рибонуклеиновая кислота 4CL – кумарат-КоА-4-лигаза C4H – циннамат-4-гидроксилаза [Ca2+]цит – концентрация кальция в цитоплазме CA – кумаровая кислота CaM – кальмодулин CDPK – кальций-зависимая протеинкиназа CI – ионофор Са2+ А CHS – халкон синтаза СоА – коэнзим-А CRKs – CDPK-подобные протеинкиназы DMSO – диметилсульфоксид EGTA – этилен гликоль тетрауксусная кислота JA – жасмоновая кислота MeJA – метилжасмонат PAL – фенилаланин-аммиаклиаза PFP – p-фтор-DL-фенилаланин PR-белки – белки, связанные с патогенезом Phe – фенилаланин SA – салициловая кислота SDRs– прямые короткие повторы нуклеотидов (short direct repeated sequences) SNP – нитропруссид натрия snRNPs – маленькие ядерные рибонуклеопротеиные частицы (small nuclear ribonucleoprotein particles) SOV – ортованадат натрия (Na3VO4) STS – стильбенсинтаза Ser – серин TAL – тирозин-аммиаклиаза Thr – треонин Tyr – тирозин VER – верапамил W7 – специфический ингибитор СаМ-подобных протеинкиназ

ВВЕДЕНИЕ





В настоящее время одним из перспективных и активно развивающихся направлений в биотехнологии является поиск альтернативных источников биологически активных веществ (БАВ). Большинство из этих веществ обладают ценными фармакологическими свойствами и поэтому являются важнейшими компонентами различных лекарственных препаратов.

Виноград содержит ряд БАВ, которые благоприятно воздействуют на организм человека. Среди таких веществ самое известное – это резвератрол (3,5,4’-тригидроксистильбен). Резвератрол обладает антиопухолевой гепатопротекторными свойствами (Kawada et al., 1998: Shankar et al., 2011;

Juhaz et al., 2011; Liu et al., 2011). Также этот стильбен является мощным программированной клеточной гибели и дифференцировки (Denu, 2003).

Резвератрол обнаружен во многих растениях, таких как арахис, клюква, голубика, но наибольшее его содержание характерно для винограда, в том числе и винограда амурского Vitis amurensis Rupr.

формирования. Резвератрол получают из растений горца птичьего Polygonum cuspidatum, что является длительным и затратным процессом, поскольку необходимо вырастить взрослое растение, содержание резвератрола в котором не превышает десятых долей процента от сухой массы клеток. Это объясняет довольно высокую стоимость резвератрола. Клеточные культуры растений имеют определенные преимущества перед традиционным растительным сырьем, так как продукт можно получать независимо от распространения растения, сезона, почвенных и погодных условий.

Преимущества использования клеточных технологий становятся очевидными в свете быстрого истощения естественных сырьевых ресурсов. Однако, содержание БАВ в культурах клеток растений обычно очень низкое, поэтому для промышленного производства БАВ необходимо увеличить биосинтез этих ценных веществ в культуре клеток растений с помощью методов биотехнологии.

Классическими методами индукции синтеза вторичных метаболитов в культурах клеток растений являются селекция и отбор наиболее продуктивных клеточных линий, оптимизация состава питательных сред, разнообразными элиситорами, а также создание с помощью методов генной инженерии клеток, активно продуцирующих БАВ. Для создания генномодифицированных организмов, сверхпродуцирующих резвератрол, необходимо получение информации о молекулярных механизмах регуляции биосинтеза этого стильбена в клетках растений.

В настоящее время регуляторы биосинтеза стильбенов не установлены, но известно, что некоторые вторичные мессенджеры, особенно катионы Са2+, вовлечены в регуляцию биосинтеза стильбенов (Vandelle et al., 2006). У растений основными сенсорами цитоплазматического кальция являются Са2+-зависимые протеинкиназы (CDPK). Показано, что геном двух таксономически далеких видов Oryza sativa и Arabidopsis thaliana включает 31 и 34 гена CDPK соответственно. Это может свидетельствовать о наличии разнообразных функций белков семейства CDPK. Показано, что увеличение накопления фитоалексинов коррелирует с повышением активности CDPK (Ramani and Chelliah, 2007).

Цель и задачи исследования. Цель работы – проанализировать участие кальциевой сигнальной системы в регуляции биосинтеза резвератрола в клетках винограда V. amurensis.

Для достижения этой цели были поставлены следующие задачи:

Исследовать влияние ингибитора Ca2+-каналов плазматической мембраны (верапамил, VER), специфического ингибитора СаМ-подобных протеинкиназ (W7) и ионофора Ca2+ А23187 (CI) на биосинтез резвератрола, экспрессию генов стильбен синтаз (STS) и генов CDPK в культурах клеток V. amurensis, а также на ростовые характеристики клеточных культур V. amurensis.

2. Изучить влияние сверхэкспрессии генов VaCDPK1a, VaCDPK1d, VaCDPK1e, VaCDPK2a, VaCDPK3a и VaCDPK3c на биосинтез резвератрола и накопление биомассы клеточных культур V. amurensis.

VaCDPK3a и его укороченных вариантов VaCDPK3aSF1, VaCDPK3aSF2 и VaCDPK3aSF3, проанализировать их протеинкиназную активность.

транскриптов VaCDPK1e и VaCDPK3a на продукционные характеристики клеточных линий винограда амурского.

Основные положения, выносимые на защиту.

1. В клеточных линиях винограда амурского V. amurensis при добавлении блокатора потенциал-зависимых каналов плазматической наблюдается достоверное уменьшение продукции резвератрола, ингибирование экспрессии генов STS и некоторых генов CDPK. При добавлении ионофора кальция А23187 наблюдается увеличение продукции резвератрола и экспрессии генов STS и CDPK в контрольной культуре клеток.

2. Сверхэкспрессия генов CDPK в клетках V. amurensis по-разному влияет на содержание резвератрола: значительное увеличение содержания резвератрола наблюдается при сверхэкспрессии гена VaCDPK3с, а VaCDPK3a существенно не влияет на содержание резвератрола.

3. Полноразмерный рекомбинантный белок VaCDPK3а обладает Ca2+-зависимой протеинкиназной активностью; его укороченные варианты либо не фосфорилируют гистон H1 (VaCDPK3aSF1), либо обладают Ca2+независимой киназной активностью, не проявляя сродства к катионам Ca2+ (VaCDPK3aSF2 и VaCDPK3aSF3).

4. Сверхэкспрессия VaCDPK3aSF1 не изменяет продукционные характеристики культур клеток винограда. Сверхэкспрессия VaCDPK3aSF2 и VaCDPK3aSF3 достоверно увеличивает прирост сырой биомассы клеток, как и сверхэкспрессия полноразмерного гена VaCDPK3a, в клетках V. amurensis.

Сверхэкспрессия всех коротких вариантов транскрипта VaCDPK1е приводит к увеличению прироста сырой и сухой биомассы клеток относительно векторной и трансгенной по полной форме гена VaCDPK1е клеточных линий винограда V. amurensis.

Научная новизна и практическая значимость.

Впервые изучено влияние ионофора кальция А23187 и антагониста CаМ-подобных протеинкиназ на содержание резвератрола. Показано, что сверхэкспрессия некоторых CDPK в клетках V. amurensis достоверно увеличивает продукцию резвератрола, что напрямую указывает на участие основных сенсоров кальция в биосинтезе этого ценного стильбена.

Полученные результаты могут быть использованы биотехнологическими компаниями для создания генетических конструкций и методических подходов для регуляции клеточного роста и биосинтеза вторичных метаболитов растений. Также результаты диссертационной работы можно использовать для проведения теоретических и практических занятий в университете на биологических факультетах.

Апробация работы и публикации.

Результаты работы представлены на XIII Всероссийской молодежной школе-конференции по актуальным проблемам химии и биологии (Владивосток, 2010); X региональной конференции студентов, аспирантов вузов и научных организаций Дальнего Востока России (Владивосток, 2011);

третьем международном симпозиуме «Клеточная сигнализация у растений»

(Казань, 2012); XI региональной конференции студентов, аспирантов вузов и научных организаций Дальнего Востока России (Владивосток, 2012); XIV Всероссийской молодежной школа-конференция по актуальным проблемам химии и биологии (Владивосток, 2012); VIII международном симпозиуме «Фенольные соединения: фундаментальные и прикладные аспекты» (Москва, 2012); V международной школе молодых ученых по молекулярной генетики «Непостоянство генома» (Звенигород, 2012); I Межрегиональной молодежная школе-конференции «Актуальные проблемы биологических наук» (Владивосток, 2013); Х международной конференции «Биология клеток растений in vitro и биотехнология» (Казань, 2013); региональной научно-практической конференции студентов, аспирантов и молодых учёных по естественным наукам (Владивосток, 2014).  Материалы диссертации изложены в 20 публикациях, из них 9 в журналах из списка ВАК.

Структура и объем работы.

Диссертация состоит из введения, 4 глав, выводов и списка литературы.

Работа изложена на 135 страницах, иллюстрирована 32 рисунками и содержит 24 таблицы. Список литературы насчитывает 166 наименований.

Благодарности. Автор искренне благодарит научного руководителя к.б.н. Киселёва К.В. за всестороннюю помощь и поддержку на всех этапах работы, руководителя лаборатории биотехнологии академика Журавлёва Ю.Н. за помощь в подготовке диссертации и ценные консультации в работе. Автор признателен к.б.н. Козыренко М.М., к.б.н.

Дубровиной А.С. и к.б.н. Тюнину А.П. за помощь в подготовке диссертации и работе с культурами клеток растений. Автор искренне благодарит коллектив лаборатории молекулярных основ внутриклеточной регуляции Института физиологии растений им. Тимирязева за всестороннюю помощь и поддержку в проведении работ по белковой химии. Также автор выражает глубокую признательность Маняхину А.Ю. за проведение ВЭЖХ анализов и всем сотрудникам лаборатории биотехнологии БПИ ДВО РАН за поддержку на всех этапах работы. Данная работа выполнена при финансовой поддержке грантов РФФИ (10-04-00189-а, 12-04-33069-мол_вед), РНФ (14-14-00366) и ДВО РАН (10-III-В-06-100, 12-III-В-06-053).

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

1.1. Биологически активные свойства резвератрола С древних времен до настоящего времени, люди прибегают к традиционной медицине, основой которой являются лекарственные растения.

Одним из важных действующих компонентов лекарственных растений являются фитоалексины – естественные БАВ, которые являются ключевым звеном в системе защиты растений от фитопатогенов. Фитоалексины из натуральных продуктов имеют широкий диапазон химических структур, таких как полифенолы, флавоноиды, сапонины и витамины (Vasanthi et al., 2012).

Одним из самых известных полифенолов растений является резвератрол.

Резвератрол привлек внимание ученых, когда в 1992 году Симэном и Кизи показли его присутствие в вине. Представление о благоприятном воздействии красного вина на здоровье человека ясно установлено в средиземноморской диете и явлении «французского парадокса». Понятие «французского парадокса» определено как низкая заболеваемость ишемической болезнью сердца при потреблении в пищу продуктов богатых насыщенными жирами (Feher et al., 2007). Результаты исследований показали, что «французский парадокс» частично связан с действием этанола, присутствующем как в вине, так и в других алкогольных напитках. Этанол вызывает увеличение содержания в крови липопротеинов высокой плотности (Rimm et al., 1996). Однако ученые предположили, что не только этанол способен оказывать защитный эффект, но и какие-то другие, неизвестные на тот момент, составляющие вина (Leger et al., 1979). Позднее многочисленные исследования показали высокую биологическую активность фенольных компонентов вина, большая часть которых имела структуру полифенолов (Soleas et al., 1997). В средиземноморском регионе уровень сердечнососудистых заболеваний один из самых низких в мире. Это связывают с эффектом средиземноморской диеты, характерной особенностью которой является большое потребление арахиса, фисташек, различных ягод, виноградного сока и красного вина. Во всех этих продуктах довольно гликозилированного производного – пицеид (Zamora-Ros et al., 2008).

Поэтому в последние годы резвератрол стал популярной основой для пищевых добавок, используемыми людьми во всем мире (Rahman et al., 2010).

Как показывают исследования, резвератрол может играть значительную роль в предупреждении развития сердечно-сосудистых заболеваний (Kopp et al., 1998). Это обусловлено следующими свойствами резвератрола: во-первых – ингибирование молекул адгезии клетками сосудов (Ferrero et al., 1998;

Rotondo et al., 1998); во-вторых – ингибирование пролиферации гладкомышечных клеток сосудов (Haider et al., 2005; Poussier et al., 2005;

Wang et al., 2006); в-третьих – стимуляция активности эндотелиальной синтазы оксида азота (Chen et al., 1996; Duffy et al., 2003); в-четвертых – ингибирование агрегации тромбоцитов через регуляцию синтеза эйкозаноидов (Wang et al., 2002; Olas et al., 2005; Stef et al., 2006); в-пятых ингибирование процессов окисления липопопротеинов низкой плотности (Fremont et al., 1999; Ungvari et al., 2007). Показано, что препарат Longevinex, на основе резвератрола, снижает уровень холестерина в крови и препятствует развитию ишемии сердца (Juhaz et al., 2011).

В настоящее время установлено, что резвератрол способен благотворно влиять на работу нервной системы высших животных. Так, был проведен ряд экспериментов на приматах, где показано, что добавление резвератрола в пространственной памяти и мыслительных функций (Dal-Pan ey al., 2011). У людей прием резвератрола может, теоретически, уменьшить образование бета-амилоидных бляшек ассоциированных с возрастными изменениями в мозгу. Исследователи предполагают, что одним из механизмов этого процесса является связывание резвератролом ионов меди. Лиу с коллегами (Liu et al., 2011) показали, что резвератрол способствует восстановлению нервных связей в поврежденных участках мозга, благодаря его свойствам – антиоксидантным и, предотвращающим запуск апоптоза. Таким образом, резвератрол помогает восстановить мыслительные способности у неврологических больных или людей преклонного возраста. Также резвератрол улучшает метаболизм нейронов, предотвращает их гибель и препятствует окислению ксантина, тем самым предотвращает развитие ишемии мозга (Draczynska-Lusiak et al., 1998; Li et al., 2010).

Известно, что пролиферация звездчатых клеток, которые играют критическую роль в развитии фиброза печени, усиливается окислительным стрессом. По этой причине вещества, которые способны ингибировать активацию этих клеток, способны предотвращать развитие фиброза печени.

Кавада с коллегами (Kawada et al., 1998) обнаружили, что резвератрол способен ингибировать активацию звездчатых клеток путем нарушения передачи сигнала к пролиферации этим клеткам и экспрессии некоторых белков клеточного цикла.

Вследствие схожести структуры транс-резвератрола и синтетического эстрогена диэтилстильбэстрола (4,4’-дигидрокси-транс-диэтилстильбен), возник вопрос об эстрогенной активности резвератрола. Несмотря на многочисленные исследования, до сих пор остается дискуссионным вопрос, является ли резвератрол агонистом или антагонистом эстрадиола (Aggarwal et al., 2004). Некоторые исследования показывают, что резвератрол обладает выраженной эстрогенной активностью, в то время как другие обнаруживают противоположный эффект (Gehm et al., 1997; Turner et al., 1999; Pozo-Guisado et al., 2004).

В настоящее время показано, что резвератрол, проявляя эстрогенную активность, индуцирует дифференцировку остеобластов, что может быть использовано в профилактике остеопороза (Habold et al., 2011). В перспективе, после проведения более подробных исследований эстрогенной активности резвератрола, возможно использование его для коррекции различных гормональных расстройств, терапии эстроген-зависимых опухолей и некоторых эстроген-зависимых расстройств организма. К примеру, резвератрол благотворно влияет на кожу, стимулируя синтез коллагена и предотвращая его сшивки. Такой эффект объясняется сочетанным антиоксидантным и эстрогенным воздействием резвератрола.

Антиканцерогенные свойства этого вещества были впервые по достоинству оценены учеными, когда Джанг с соавторами (Jang et al., 1997) опухолеобразования, индуцированного арил-гидрокарбон-7,12диметилбензантраценом. С тех пор на научное сообщество обрушился целый шквал сообщений о способности резвератрола влиять на механизмы, регулирующие клеточную пролиферацию и рост (Roemer and MahyarRoemer, 2002; Pervaiz, 2003). Проведено много исследований на различных модельных объектах, показывающих противоопухолевое действие резвератрола (Baur et al., 2006). Показано, что противоопухолевое действие резвератрола in vivo ограничено его низкой проницаемостью в ткани организма (Athar et al., 2007; Baur et al., 2006). Наиболее серьёзные доказательства противоопухолевой активности резвератрола получены для опухолей желудочно-кишечного тракта и кожи, где возможно прямое действие резвератрола, то есть в местах локализации опухоли (Athar et al., 2007). Так, резвератрол (1 мг/кг орально) уменьшал количество и размер опухолей в пищеводе у крыс (Li et al., 2002). В ряде исследований было продемонстрировано профилактическое или сокращающее опухоли действие малых доз резвератрола (0.02-8 мг/кг орально) в случае рака желудка и прямой кишки крыс, вызванных канцерогенами (Athar et al., 2007). У мышей резвератрол предотвращал развитие рака кожи, индуцируемое ультрафиолетовым излучением, но в то же время пероральное введение не оказывало действия на инокулированые клетки меланомы, лейкемию и рак желудка (Gao et al., 2002; Athar et al., 2007). Однако при внутрибрюшинном введении замедлял развитие карциномы Льюиса (Kimura et al., 2001; Athar et al., 2007).

Кроме того, эффективность резвератрола для апоптоза или замедления роста раковых клеток была продемонстрирована на различных клеточных моделях (Roy et al., 2011; Yoon et al., 2011). К примеру, Хе с коллегами (He et al., 2011) показали, что резвератрол предупреждает развитие рака молочной железы, посредством предотвращения альфа-фосфорилирования и активации тропы PI3K/AKT. Также известно о защитных свойствах резвератрола против рака простаты, где резвератрол снижает уровень определенных антигенов (Harada et al., 2011). Кроме того показано, что резвератрол обладает превентивными свойствами против рака поджелудочной железы (Shankar et al., 2011). Резвератрол предотвращает рост, развитие и самовоспроизведение опухолевых клеток, подавляя экспрессию факторов транскрипции, таких как Nanog, Sox-2, c-Myc и Oct-4. Также вызывает апоптоз раковых клеток, индуцируя действие каспазы-3/7. Наконец резвератрол препятствует инвазии и метастазированию (Shankar et al., 2011).

Группа исследователей (Howitz et al., 2003) в журнале «Nature»

опубликовали данные, что резвератрол значительно продлевает срок жизни дрожжей Saccharomyces cerevisiae. Позднее исследования Синклер показал, что резвератрол также увеличивает продолжительность жизни нематод Caenorhabditis elegans и дрозофилы Drosophila melanogaster (Sinclair, 2005).

В 2006 году итальянские ученые (Valenzano et al., 2006) получили первый положительный результат при добавлении резвератрола в пищу позвоночных. Они исследовали рыб вида Nothobranchius furzeri, средняя продолжительность жизни которых 9 недель. Обнаружено, что максимальная доза резвератрола увеличила среднюю продолжительность жизни на 56% по сравнению с контрольной группой. К концу жизни рыбы, употреблявшие резвератрол, показали значительно более высокую общую активность и повышение способностей к обучению. В том же году Баур и Синклеер (Baur and Sinclair, 2006) сообщили, что резвератрол способен противодействовать пагубному воздействию диеты с высоким содержанием жиров в организме мышей. В экспериментах диета с высоким содержанием жиров усугублялась добавлением кокосового масла в стандартный рацион. В эксперименте мыши потребляли примерно на 30% больше калорий, чем контрольные мыши.

Мышей кормили по стандартной диете и по диете с высоким содержанием жира – плюс 22 мг резвератрола на кг массы мышей. У второй группы риск смерти был на 30% ниже, чем у мышей с высоким содержанием жиров в диете без резвератрола. В итоге смертность мышей на диете с повышенным содержанием жира и резвератролом была примерно такой же, как и в контрольной группе с нормальной диетой (Baur et al., 2006).

Многочисленные исследования свидетельствуют о том, что резвератрол обладает антивирусной активностью против ВИЧ-1 (Heredia et al., 2000), вируса простого герпеса (Docherty et al., 1999; Docherty et al., 2004) и антибактериальными свойствами (Chan, 2002), включая подавление роста различных штаммов Helicobacter pylori (Mahady and Pendland, 2000; Daroch et al., 2001; Mahady et al., 2003), противогрибковым действием против таких патогенов, как Plasmopara viticola (Dercks and Creasy, 1989), Botrytis cinerea и Phomopsis viticola (Adrian et al., 1997).

Мураками с соавторами (Murakami et al., 1992) показали, что резвератрол способен ингибировать желудочную H+/K+-АТФазу, важный фермент для противоязвенной терапии. Известно о способности резвератрола препятствовать локальной гиперпигментации кожи путем изменения активности фермента тирозиназы (Kang et al., 1998), о его протективных свойствах против токсинов, вызванных антропогенными факторами окружающей среды. Данный вид защиты выражается посредством активации арилзамещенного рецептора углеводорода (Singh et al., 2011). Важно отметить, что о биологических свойствах цис-изомера резвератрола известно намного меньше, чем о свойствах транс-резвератрола (Lastra and Villegas, 2005; Orallo, 2006).

Обобщая изложенные данные, необходимо сказать, что резвератрол обладает поразительными по силе и качеству положительными эффектами на функционирование организма и имеет большой потенциал для создания на его основе различных лекарственных средств и биологически активных добавок к пище. На основе резвератрола созданы такие биологически активные добавки: «Longevinex», «OPAC+», «Resveratrol», «Resveratrol synergy», «Revidox», «VITACELL», «Витавин», «Фомидан» и многие другие.

В настоящее время тысячи статей посвящены метаболизму и описанию биологических свойств транс-резвератрола и его производных. Причем, за последнее десятилетие уровень публикаций, описывающих свойства трансрезвератрола, увеличился в 5 раз.

1.2. Основные источники резвератрола Резвератрол обнаружен во многих растениях, таких как арахис, клюква, голубика, гуава, суринамская вишня питанга, манго, сосна Веймутова, тутовое дерево, но наибольшее его содержание характерно для винограда.

Первые упоминания о лекарственных свойствах винограда встречаются ещё до нашей эры: в древней Индии был хорошо известен препарат “Darakchasava”, главным компонентом которого являлся Vitis vinifera (Paul et al., 1999). ВЭЖХ анализ препарата “Darakchasava” показал наличие таких растительных фенолов, как резвератрол и птеростильбен.

Впервые резвератрол был выделен в 1940 (Takaoka and Faculty, 1940) из корней белой чемерицы Veratrum grandiflorum. Более широкое внимание к резвератролу возникло только в 1992 году, когда предположили, что кардиопротективный эффект красного вина может быть связан с присутствием именно резвератрола (Siemann and Ceasy, 1992).

В винограде резвератрол синтезируется в большем количестве, от 0. до 0.12 мг/г сухового веса (Kiselev et al., 2012), прежде всего в кожуре ягод, а также в семенах (Leblank et al., 2008). Количество резвератрола в виноградных шкурках зависит от сорта винограда, его географического происхождения и подверженности грибковой инфекции. Тип давления винограда, количество времени брожения, которое вино проводит в контакте с виноградными шкурками, также имеет прямое значение в конечном содержании резвератрола в полученном вине (табл. 1) (Mattivi et al., 1995, Leblank et al., 2008).

Табл. 1. Содержание резвератрола в вине и виноградном соке разных сортов винограда.

Красное вино (мировой стандарт) 0.20–0. Сок красного винограда (Испания) 0.11–0. Одним из основных источников резвератрола является также арахис. В молодом растении арахиса содержание резвератрола варьирует от 0.02–0. мг/кг, в зрелом растении 0.12–0.13 мг/кг в зависимости от сорта арахиса (Wang et al., 2005).

Американские ученые определили содержание транс-резвератрола и его гликозилированного производного, транс-пицеида, в продуктах американского рынка, содержащих порошок какао-бобов. Среди этих продуктов наибольшее содержание транс-резвератрола было в какаопорошках (0.14–0.28 мг/кг) и несладких шоколадных пирогах (0.11–0. мг/кг). Также в этих продуктах было обнаружено приблизительно в 3–5 раз больше транс-пицеида (Hurst et al., 2008). Таким образом, в какао-порошке приблизительно в 4.5 раза меньше транс-резвератрола, чем в испанском красном вине. В целом, продукты, содержащие какао, занимают третье место по содержанию общего количества транс-резвератрола после красных вин, виноградного сока и арахиса (Hurst et al., 2008).

Известно, что питание, в котором недостаточное количество продуктов с полезными питательными веществами, можно корректировать при помощи БАД. В настоящее время основными поставщиками резвератрола для получения БАД и лекарственных препаратов на мировой рынок являются китайские биотехнологические компании, например, такие как Wuxi Gorunjie Technology Co. и Shanghai DND Pharm Technology Co. Резвератрол получают из выращиваемых растений горца птичьего P. cuspidatum, что является длительным и затратным процессом, поскольку необходимо вырастить взрослое растение, содержание резвератрола в котором не превышает десятых долей процента от сухой массы клеток. Это объясняет высокую цену резвератрола – лиофилизированный порошок 100 мг: 157€; 500 мг: 630€ (по данным Sigma-Aldrich, 2014).

Применение биотехнологических подходов, предлагаемых в данной работе, для производства резвератрола из клеточных культур винограда может позволить значительно снизить себестоимость этого вещества.

Поэтому результаты нашей работы могут представлять интерес как для отечественных, так и для иностранных биотехнологических компаний, занимающихся производством сырья для БАД и лекарственных препаратов, а также производством и поставкой БАД и лекарственных препаратов.

1.3. Биосинтез резвератрола и его производных Хотя механизм действия резвератрола на здоровье человека еще не полностью изучен, этот ценный фитоалексин привлекает большое внимание научной общественности. В растениях резвератрол присутствует в свободной форме (цис- и транс-изомера) и в гликозилированной форме – пицеид (Wang et al., 2010). Биосинтез всех указанных выше форм идет фенилпропаноидным путем (Langcake and Pryce, 1977). Фенилпропаноидный путь является одной из существенных составляющих вторичного метаболизма всех высших растений, в результате которого синтезируется широкий ряд природных фенольных соединений, таких как флавоноиды, лигнины и проантоцианиды.

Биосинтез резвератрола формирует отдельную ветвь фенилпропаноидного пути в близкородственных видах (Wang et al., 2010). Ключевыми ферментами этого пути синтеза вторичных метаболитов считаются фенилаланинаммиаклиаза (PAL), циннамат-4-гидроксилаза (C4H), кумарат-СоА-4-лигаза (4CL), а также стильбенсинтаза (STS) (рис. 1).

Рис. 1. Схема биосинтеза резвератрола (по: Wang et al., 2010). PAL – фенилаланин-аммиаклиаза, C4H- циннамат-4-гидроксилаза, 4CL – кумаратСоА-4-лигаза; STS – стильбенсинтаза, TAL - тирозин-аммиаклиаза.

Ранее было показано существование мультиферментного комплекса, согласующего действие PAL и C4H, контролирующих поток интермедиатов фенилпропаноидного пути (Dixon et al., 1995). Первый фермент PAL фенилпропаноидного пути катализирует дезаминирование фенилаланина, превращая его в коричную кислоту. Фермент C4H осуществляет присоединение гидроксильной группы в пара-положение фенольного кольца коричной кислоты, образуя р-кумаровую кислоту (рис.1). Далее происходит образование тиоэфирной связи между карбоксильной группой р-кумаровой кислоты и коэнзимом-А (СоА) за счет работы фермента 4CL, в результате образуется р-кумарил-СоА (рис.1). р-кумарил-СоА является важным интермедиатом у высших растений, который может быть преобразован в монолигнолы для биосинтеза лигнинов или флавоноидов для биосинтеза антоцианов, или проантоцианов (Wang et al., 2010). В винограде и в других резвератрол-содержащих растениях ключевым ферментом в синтезе резвератрола и его производных является STS. Стильбенсинтаза конденсирует три молекулы малонил-СоА с одной молекулой кумарил-СоА, конечным продуктом этой реакции (С2С7 альдольная конденсация) является резвератрол (Rupprich et al., 1980) (рис. 2).

Рис. 2. Схема реакции конденсации, катализируемой STS по: Rupprich et al., 1980.

В результате процесса конденсации формируется тетракетидный интермедиат (Dixon et al., 1995), который складывается, формируя, таким образом, новую ароматическую кольцевую систему. Промежуточные соединения не могут быть обнаружены прямым путем вследствие их нестабильности. Резвератрол может метаболизироваться, превращаясь, например, в -виниферин (димеризация), птеростильбен (метилирование), пицеид (гликозилирование). Эти фитоалексины также представлены в винограде. Механизмы образования производных резвератрола еще плохо изучены.

Интересно отметить, что гены STS представлены мультигенным семейством. Мультигенное семейство у V. vinifera L., близкородственного вида винограда амурского V. amurensis, представлено 48 генами STS, 32 из которых являются генами с последовательностью ДНК, кодирующей полноразмерный белок STS, 5 генов с неполной и 11 генов являются, вероятно, псевдогенами (Parage et al., 2012). У V. vinifera все 48 генов STS распределены на двух хромосомах – 6 генов STS расположены на десятой хромосоме и 42 гена на шестнадцатой хромосоме (Parage et al., 2012). Также известно, что экспрессия генов STS винограда может быть индуцирована разными типами стресса, таких как патогенные инфекции, воздействие тяжелых металлов или ультрафиолетового света (Chong et al., 2009).

Ключевой фермент фенилпропаноидного пути STS тесно связан с халконсинтазой (CHS), основным ферментов в синтезе соединений, относящихся к типу флавоноидов (Schroёder, 1999). Так, аминокислотные последовательности генов STS и CHS Arachis hypogea обладают 70–75% идентичностью, они различаются только 35 аминокислотными позициями (Schroёder et al., 1988). Филогенетический анализ STS и ее сравнение с CHS показали общее эволюционное происхождение этих ферментов. STS и CHS используют одни и те же субстраты и катализируют те же самые реакции конденсирующего типа, но формируют два разных продукта: простые стильбены и халкон соответственно.  Интересно отметить, что у некоторых бактерий существует упрощенный путь биосинтеза р-кумаровой кислоты, в котором первые два фермента, характерные для растений, замещены одним бактериальным ферментом TAL (Wang et al., 2010) (рис. 1). Такие бактерии используются исследователями в качестве модельных систем для биосинтеза резвератрола (Donnez, 2009).

Таким образом, на сегодняшний день биосинтез резвератрола изучен на достаточном уровне. Активность фенилпропаноидного пути можно регулировать добавлением субстратов ферментов этого каскада реакций, а также при помощи других приемов биотехнологии.

1.4. Классические биотехнологические приемы увеличения продукции резвератрола в культуре клеток винограда К элисситорам продукции вторичных метаболитов в клетках растений причисляют такие вещества, как салициловая кислота (SA), жасмоновая кислота (JA) и ее более активное производное – метилжасмонат (MeJA), отованадат натрия (SOV), нитропруссид натрия (SNP) и другие.

SA причисляют к сигнальным молекулам растений. Это хорошо известный индуктор продукции защитных вторичных метаболитов в растении, хотя и не универсальный (Zhao et al., 2005). Известно, что при воздействии SA на клетки растений активируется синтез PR-белков различных классов, в том числе PAL (важный фермент в синтезе большинства растительных фенольных соединений). Ранее было показано, что при добавлении SA в питательные среды общая продукция резвератрола в культуре клеток винограда возрастала в 2.5 раза (Киселев и др., 2010).

JA и MeJA причисляют к стрессовым фитогормонам. Эти вещества действуют как регуляторы защитного ответа растений, участвуя в функционировании липоксигеназной системы. Показано, что MeJA повысил содержание резвератрола в клетках в 1.5 раза, но суммарная продукция резвератрола при этом существенно не увеличилась из-за значительного ингибирования роста клеток (Kiselev et al., 2007).

Об эффекте SOV, общего ингибитора фосфатаз, на синтез вторичных метаболитов в культуре клеток растений известно немного. Тассони с соавторами (Tassoni et al., 2005) сообщают, что SOV стимулировал продукцию цис-резвератрола суспензионной культурой клеток V. vinifera cv.

Barbera. По данным экспериментов лаборатории биотехнологии БПИ ДВО РАН, SOV ингибировал прирост биомассы в клеточной культуре V. amurensis, но на содержание резвератрола не повлиял. За счет этого продуктивность культуры снизилась в 1.3 раза (Kiselev et al., 2007).

Известно, что SNP, донор NO, способен индуцировать работу NOсинтазной сигнальной системы (Тарчевский, 2002). Показано, что генерация NO связана с индукцией аккумуляции многих вторичных метаболитов клеточными культурами растений (Zhao et al., 2005). Также было показано, что SNP ингибировал прирост сырой и сухой биомассы культуры клеток V более чем в два раза, при этом содержание резвератрола увеличилось более чем в 4 раза. Несмотря на значительное ингибирование роста культуры, суммарная продукция резвератрола клетками возросла в 2 раза (Kiselev et al., 2007).

Биосинтез резвератрола идет фенилпропаноидным путем. PAL – первый фермент в этом пути, катализирует дезаминирование фенилаланина (Phe), превращая его в коричную кислоту. Поэтому присутствие Phe – важный фактор для биосинтеза стильбенов. Вероятно, увеличение продукции резвератрола растительными клетками можно добиться стимулированием работы фенилпропаноидного пути. Ранее нами было показано, что добавление Phe в питательные среды культуры клеток винограда ингибировало прирост сырой биомассы. Содержание резвератрола в клетках винограда при добавлении Phe достоверно увеличилось в 6–15 раз. Таким образом, суммарная продукция резвератрола в культуре клеток винограда при добавлении Phe достоверно увеличилась в 8.5 раз (Киселев и др., 2013).

Также нами был проанализирован уровень экспрессии генов PAL и STS в культуре клеток винограда при добавлении Phe. Мы считаем, что Phe напрямую активирует фенилпропаноидный путь через достоверное увеличение экспрессии генов PAL (PAL2 и PAL3) и генов STS (всех кроме STS7) (Киселев и др., 2013).

Известно, что отбор клеток, устойчивых к фторфенилаланину (PFP), аналогу Phe, может приводить к аккумуляции больших количеств ароматических соединений культивируемыми растительными клетками (Quesnel and Ellis, 1989). PFP – это антиметаболит, который способен включаться в структуру клеточных белков вместо аминокислоты Phe, нарушая их структуру и функции. При селекции на средах с добавлением PFP клетки с низким содержанием нормальной аминокислоты начинают поглощать из среды PFP и погибают. Клетки, в которых синтез вторичных метаболитов фенилпропаноидного пути активирован, в меньшей степени зависят от экзогенного Phe. Таким образом, при выращивании каллусов на среде, содержащей PFP, происходит отбор клеток, в которых работа фенилпропаноидного пути более активна. Так ранее было показано, что продукция резвератрола в клетках винограда, отобранных в результате трехмесячной селекции культуры винограда на средах с добавлением PFP в концентрации 100 мг/л, возросла в 11 раз по сравнению с контрольной культурой клеток винограда (Kiselev et al., 2007).

Последним ферментом в биосинтезе резвератрола и его производных в фенилпропаноидном пути является STS, который конденсирует три молекулы малонил-СоА с одной молекулой кумарил-СоА, конечным продуктом этой реакции является резвератрол. Кумарил-СоА образуется в результате формирования ферментом C4H тиоэфирной связи между карбоксильной группой СА и Со-А. Поэтому добавление СА активирует, вероятно, последние этапы биосинтеза резвератрола. Ранее нами было показано, что добавление СА в питательные среды для культивирования клеточных линий винограда достоверно увеличила продукцию резвератрола в клетках винограда в 16 раз (Shumakova et al., 2011). Проанализировав уровень экспрессии генов PAL и STS в культуре клеток винограда при добавлении СА, мы предположили, что СА активирует только последние стадии биосинтеза резвератрола, так как добавление СА в питательные среды достоверно не активирует экспрессию генов PAL, а выборочно увеличивает экспрессию генов STS (Shumakova et al., 2011).

В последнее время к классическим методам индукции вторичных метаболитов в культуре клеток растений относят также агробактериальную трансформацию онкогенами rol. Растительные онкогены rol располагаются в центральных районах TL-области Т-ДНК Ri-плазмиды Agrobacterium rhizogenes агропинового типа. Кодирующие последовательности генов rol являются уникальными и не имеют высокой гомологии к каким-либо известным генам. На сегодняшний день большинство исследователей склоняется к тому, что белок rolB способен изменять чувствительность клеток растений к ауксинам, обладает Tyr-фосфатазной активностью и локализован в плазматической мембране трансформированных клеток растений (Filippini et al., 1996; Altamura, 2004). Мориучи с соавторами (Moriuchi et al., 2004) сообщили о ядерной локализации RolB, что увеличивает вероятность того, что этот белок способен выполнять функцию транскрипционного коактиватора/медиатора.

метаболитов в трансформированных клетках растений (Bulgakov, 2008). К повышенному биосинтезу некоторых групп вторичных метаболитов культурами клеток растений ведет как трансформация диким штаммом A. rhizogenes, так и интеграция отдельных генов семейства rol в геном растения (Bulgakov, 2008). Показан стимулирующий эффект трансформации геном rolB на биосинтез антрахинонов в трансгенных клеточных культурах Rubia cordifolia (Bulgakov et al., 2002). Кроме того, увеличение содержания антрахинонов в клетках R. cordifolia коррелировало с увеличением экспрессии ключевого фермента биосинтеза этих веществ изохоризмат синтазы (ICS) и с экспрессией гена rolB (Shkryl et al., 2008). Трансформация генами rolB и rolC из A. rhizogenes увеличила продукцию резвератрола в клеточных линиях V. amurensis (Kiselev et al., 2007; Dubrovina et al., 2009;

Dubrovina et al., 2010). Трансформация геном rolB увеличила уровень продукции резвератрола в 100 раз в сравнении с контролем. В rolBтрансгенных клеточных культурах V. amurensis с повышенным уровнем продукции резвератрола, уровень продукции резвератрола упал в 27 раз в сравнении с первоначальным уровнем после 2.5 лет субкультивирования культуры (Dubrovina and Kiselev, 2012). В качестве возможных причин данного снижения уровня продукции резвератрола могли выступать:

накопление нуклеотидных мутаций в составе промотора и протеинкодирующей частях трансгена rolB, повышение числа клеток с отсутствующим или низким уровнем экспрессии трансгена, а также эпигенетические механизмы супрессии транскрипционной активности трансгена (Dubrovina and Kiselev, 2012).

Таким образом, эксперименты с MeJA, SOV, SA и SNP подтверждают результаты других авторов о том, что высокая продукция резвератрола и его производных культурами клеток растений не может быть обеспечена обработкой элиситорами (Ku et al., 2005; Tassoni et al., 2005). Вероятно, что низкая продукция резвератрола нетрансформированными клетками винограда не связана с низким пулом предшественников резвератрола в исследуемых клетках, поскольку добавление Phe и СА в культуральные среды и селекция клеток винограда на средах, содержащих PFP, были малоэффективны. Кроме того, высокое содержание резвератрола, наблюдаемое в rolB-трансгенной культуре клеток винограда, показывает, что запас предшественников резвератрола в клетках достаточен для синтеза вторичных метаболитов фенилпропаноидного пути.  Исходя из этого, можно предположить существование регуляторного механизма, который способен контролировать синтез резвератрола клетками растений в условиях среды без какого-либо стрессового воздействия.

1.5. Участие ионов Сa2+ в регуляции биосинтеза вторичных метаболитов, кальций-зависимые протеинкиназы (CDPK) Для создания организмов, активно продуцирующих резвератрол, необходимо изучить молекулярные механизмы регуляции биосинтеза этого стильбена. На сегодняшний день сигнальные пути, регулирующие биосинтез стильбенов, полностью не изучены, но установлено, что несколько вторичных мессенджеров, особенно Са2+, вовлечены в регуляцию биосинтеза стильбенов (Vandelle et al., 2006). Ионы кальция являются одним из наиболее важных элементов в системе внутриклеточной сигнализации растений (Trewavas and Malho, 1998; Roos, 2000). Кальций, как вторичный посредник, является эффективным регулятором метаболических процессов во всех клетках, где существуют системы, реагирующие на изменение его концентрации. Основные внутриклеточные мишени для ионов Сa2+ – различные Сa2+-связывающие белки, одни из которых сами меняют свою активность, а другие опосредуют эффект этого катиона на различные молекулярные мишени (Медведев, 2005).

Основными элементами в системе кальциевой сигнальной системы растений являются различные типы Сa2+-каналов, Сa2+-АТФазы, Сa2+/Н+обменники, Сa2+-связывающие белки и Сa2+-регулируемые ионные каналы (рис. 3).

Рис. 3. Схема формирования и передачи кальциевого сигнала в растительной клетке (по: Медведев, 2005): Ca2+цит – концентрация ионизированного кальция в цитоплазме; СаМ – кальмодулин; CDPK - Сa2+зависимая протеинкиназы.

Процесс распространения сигнала по цитоплазме обеспечивается последовательной активацией/ингибированием Сa2+-каналов и Сa2+-насосов эндоплазматического ретикулума, что обуславливает прохождение кальциевого импульса за счет повышения/снижения концентрации ионов Сa2+ в цитоплазме (Bootman et al., 2002). Усиление единичного Сa2+-сигнала эндомембран через активацию других вторичных посредников, модификацию элементов цитоскелета и, главным образом, взаимодействие кальция с Сa2+-связывающими белками. В последнем случае образуется Сa2+белковый комплекс, в котором происходят значительные изменения конформации белковой молекулы, вследствие чего молекула приобретает способность транслировать сигнал далее, что приводит к инициации Сa2+зависимых физиологических процессов (рис. 3).

последовательность – «EF-рука», которая с высокой специфичностью связывает ионы Сa2+ (Roberts and Harmon, 1992). Сa2+-связывающие белки, содержащие «EF-руки», отвечают на увеличение концентрации ионов Сa2+ двумя путями. Белки первой группы, например, парвальбумин и кальбиндин, не подвергаются значительным конфармационным изменениям при связывании с Сa2+ и функционируют как Сa2+-буферы или Сa2+-переносчики.

Ко второй группе белков «EF-руки» относят Сa2+-сенсоры, которые после связывания с ионами подвергаются серьезным конформационным изменениям, что придает им способность взаимодействовать с другими белками (Roberts and Harmon, 1992; Zielinski, 1998).

Кальциевые сенсоры условно делят на 4 типа: кальмодулин (СаМ), Сa2+зависимые протеинкиназы (CDPK) и другие белки, содержащие и не содержащие «EF-руку» (Zielinski, 1998). Считают, что у растений большая часть ферментативной активности, которая стимулируется кальцием, связана именно с CDPK (White and Broadley, 2003). CDPK обнаружены только в растениях и простейших, и не найдены ни в дрожжевых, ни в животных клетках (Harmon et al., 2001; Cheng et al., 2002). CDPK принадлежат к одной из групп Ser/Thr-протеинкиназ эукариотческих клеток. В молекуле CDPK имеются протеинкиназный домен, а также аналогичный СаМ регуляторный (автоингибиторный) домен, содержащий четыре Сa2+-связывающие «EFруки», который подавляет активность фермента в отсутствии ионов Сa2+.

При связывании кальция с CDPK происходит снятие автоингибирования и активирование фермента (Harmon et al., 2001). Каталитический домен CDPK консервативных каталитических субдоменов (I, II, III, IV, V, VIa, VIb, VII, VIII, IX, X, XI), которые формируют единую каталитическую структуру (Hanks and Hunter, 1995). Известно, что каталитические субдомены I–IV формируют NH2-терминальный участок киназного домена протеинкиназ, который в основном участвует в правильной ориентации и закреплении молекулы АТФ. COOH-терминальный участок каталитического домена формируется из VIа–XI каталитических субдоменов, которые связывают субстрат и инициируют перенос остатка фосфорной кислоты с АТФ на субстрат. Каталитический субдомен V непосредственно образует сайт катализа (Hanks and Hunter, 1995).

Таким образом, CDPK представляют собой особый тип Сa2+-сенсора, который не только связывает Сa2+, но также обладает протеинкиназной активностью. Активность CDPK может регулироваться не только ионами Сa2+, но и процессами фосфорилирования/дефосфорилирования, некоторыми фосфолипазами, 14-3-3 белками. Присоединение миристиновой кислоты (14:0) к глицину N-конца (за счет образования ковалентной связи) облегчает взаимодействие CDPK с мембранами (Harmon et al., 2001; Cheng et al., 2002).

Поэтому CDPK могут находиться не только в растворимой форме в цитоплазме, но также быть связанными с мембранами, хроматином и цитоскелетом.

Показано, что у A. thaliana эти 34 гена распределены по всем хромосомам (Cheng et al., 2002). По-видимому, это может свидетельствовать о выполнении разных CDPK различных функций. Белками мишененями цитоплазматической мембраны, калиевые и анионные каналы замыкающих клеток устьиц, аквапорины и др.), ферменты (сахарофосфатсинтаза, фосфатидилинозитолкиназа, PAL и др.), факторы транскрипции, белки контролировать процессы роста, развития, углеродный и азотный метаболизм, процессы мембранного транспорта, экспрессию стрессиндуцируемых генов, систему защитных реакций от патогенов (Harmon et al., 2001; Cheng et al., 2002).

Показано, что обработка клеточных культур Nicotiana tabacum и Catharanthus roseus ингибитором СаМ-подобных протеинкиназ W7 и общим ингибитором Ser/Thr протеинкиназ стауроспорином привела к ингибированию биосинтеза фитоалексинов (Vogeli et al., 1992; Preisig and Moreau, 1994; Ramani and Chelliah, 2007). Кроме того, увеличение накопления фитоалексинов коррелирует с повышением активности CDPK, при этом наблюдали индуцибельные и конститутивные формы CDPK (Ramani and Chelliah, 2007). Показано, что мишенью для некоторых изоформ CDPK, например для AtCPK1, является PAL (Cheng et al., 2002). Также одной из мишеней CDPK является локализованная в мембране НАДФН-оксидаза, главный источник активных радикалов кислорода (таких как H2O2 и O2-), которые активируют вторичный метаболизм (Xing et al, 2001; Kobayashi et al., 2007).

1.6. Характеристика семейства CDPK винограда Семейство генов CDPK широко представлено у всех высших растений и предположительно имеет древнее происхождение (Harmon et al., 2000). У A.

thaliana 34 белка CDPK образуют монофиличное семейство, которое делится на четыре подсемейства (Hrabak et al, 2003). Но даже у этого хорошо изученного растения, только для нескольких форм CDPK определены их функции (Boudsocq et al., 2012).

Представители семейство Vitacea появились примерно 60 миллионов лет назад, сформировав представителей рано-дивергирующего клада Rosids и его сестринских кладов Eurosids I и II (Jansen et al., 2006). Геном V. vinifera содержит много триплицированных генов и синтетических блоков (Jaillon et al., 2007). Предполагают, что предковый гексаплоидный геном V. vinifera был получен в ходе аллоплоидизации двух предковых геномов (Perazzolli et al., 2012). Также трипликация могла появиться в результате отделения группы Monocots и Eudicots до образования Eurosids (Jaillon et al., 2007).

В секвенированнном на данный момент геноме V. vinifera найдено генов VvCDPK. Все гены VvCDPK имеют канонические домены, то есть имеют протеинкиназный домен, автоингибиторный и СаМ-подобный каталитический домен. Кроме того, в V. vinifera также обнаружены 7 CDPKподобных протеинкиназ (CDPK-ralated kinases CRKs). CRKs отличаются тем, что СаМ-подобный каталитический домен имеет низкую консервативность EF-рук (Lindzen and Choi, 1995). Семнадцать генов VvCDPK распределены на 12 из 19 хромосом V. vinifera (Jaillon et al., 2007) (рис. 4).

Рис. 4. Схематическое изображение расположения генов VvCDPK по хромосомам V. vinifera по: Chen et al., 2013.

аминокислот. Также как и у A. thaliana, белковые продукты генов VvCDPK у V. vinifera подразделяются на четыре подсемейства (A, B, C, D) и на 12 групп подсемейств (рис. 5).

Рис. 5. Филогенетическое дерево (по: Chen et al., 2013), демонстрирующие эволюционные отношения семейства VvCDPK (Vv) с представителями CDPK A. thaliana (At) и Amborella trihopoda (Atr).

Типичные представители подсемейства D содержат в своей нуклеотидной последовательности 12 экзонов, в то время как представители других подсемейств содержат 7–9 экзонов. Для VvCDPK подсемейства А характерно наличие интрона между триплетами в области, кодирующей домен EF-рук, в то время как в подсемействе B интрон делит триплет GGG между нуклеотидами в позиции 1402+1403 и 1404. Такая инсерция является консервативной для подсемейства B, и она не создает сдвига рамки считывания, в отличие от последовательности подсемейства А. Также, для VvCDPK подсемейства С характерно наличие интрона в области Nтерминального домена (Chen et al., 2013).

Ранее, была смоделирована третичная структура каждой VvCDPK винограда на основе гомологии с CDPK Taxoplasma gondii (Wernimont et al., 2010). Как известно, зная третичную структуру белка, можно с помощью методов биоинформатики предсказать гипотетические функции белка.

Например, третичная структура VvCDPK2 (рис. 6) открывает возможный механизм ингибирования или активирования представленной киназы предполагаемая триада аминокислот, состоящая из двух аминокислотных автоингибиторного домена (рис. 6). Все 17 CDPK винограда имеют такую локализацией (Chen et al., 2013).

Рис.6. Третичная структура VvCDPK2 винограда (по: Chen et al., 2013).

Центр киназного домена показан в левой части изображения с двумя аминокислотными остатками E и D, и выделен красным цветом;

автоингибиторный домен выделен пурпурным цветом; СаМ-подобный каталитический домен отмечен голубым.

Известно, что формы CDPK обладают тканеспецифичной экспрессией.

Так показано, что VvCDPK4– VvCDPK4 и VvCDPK8 сильно экспрессируются в пыльце винограда. Кроме того, VvCDPK4 и 6 также экспрессируются в тычинках и на ранних стадиях развития цветка, в то время как экспрессия VvCDPK8 также была обнаружена в вегетативных и репродуктивных органах. Однако VvCDPK5 экспрессируется только в пыльце и тычинках (Fasoli et al., 2012). Другая группа генов VvCDPK, таких как VvCDPK2, VvCDPK3 и VvCDPK11, экспрессировалась во всех тканях и на всех стадиях развития V. vinifera. Это может свидетельствовать о том, что представленная группа генов может относится к группе генов «домашнего хозяйства» (Chen et al., 2013). Интересно отметить, что другие формы VvCDPK сильно экспрессировались во многих органах и частично экспрессировались в пыльце (VvCDPK13 и VvCDPK17), или в пыльце и тычинках (VvCDPK1, VvCDPK10 и VvCDPK14) (Chen et al., 2013).

В лаборатории биотехнологии БПИ ДВО РАН была проанализирована частота встречаемости различных транскриптов генов VaCDPK в клеточных линиях винограда амурского, отличающихся разным содержанием резвератрола (Dubrovina et al., 2009). Для этого клонировали и секвенировали аминокислотных последовательностей генов CDPK V. amurensis в программе BioEdit гены CDPK разделились на три подсемейства, которые получили представлено несколькими транскриптами (выделено 15 отдельных транскриптов). Также было показано, что транскрипты различных форм генов VaCDPK условно подразделяются на три типа: сильно-, средне- и слабоэкспрессирующиеся (Dubrovina et al., 2009). Во всех клеточных линиях V. amurensis чаще экспрессировались транскрипты VaCDPK1a и VaCDPK3a.

К среднеэкспрессирующимся формам VaCDPK отнесли VaCDPK1d и VaCDPK2a. Интересно отметить, что слабоэкспрессирующиеся транскрипты генов CDPK, такие как VaCDPK1b, CDPK1c, CDPK1e, CDPK3b и CDPK3c, были обнаружены только в культуре клеток винограда с высоким содержанием резвератрола (Dubrovina et al., 2009). Белковые продукты, перечисленных выше форм транскриптов VaCDPK имели каноническую аминокислотную структуру. Помимо классических VaCDPK, в клеточных линиях винограда, преимущественно в клетках с повышенным содержанием резвератрола, встречались необычные «длинные» и «короткие» транскрипты.

В кДНК rolB-трансгенных клеточных культурах V. amurensis были найдены длинные транскрипты CDPK. Все последовательности длинных транскриптов (VaCDPK1-L1-a, VaCDPK1-L1-b, VaCDPK1-L2-b и VaCDPK1L3) содержат 35 дополнительных нуклеотидов в последовательности VII каталитического субдомена. (Dubrovina et al., 2009). В данном случае была исключена возможность аномалий прохождения легирования, клонирования или амплификации транскриптов группы VaCDPK1-L, так как одни и те же модификации (VaCDPK1-L1-a и VaCDPK1-L2-b) были обнаружены в кДНК разных культур клеток V. amurensis (Dubrovina et al., 2009). Кроме того, в геноме V. vinifera обнаружена последовательность (номер доступа в ГенБанк AM427019) с высокой степенью гомологии (97–99%) к транскриптам VaCDPK1-L1-a и VaCDPK1-L1-b. Также известно несколько примеров инсерций в области киназного домена некоторых киназ животных (Wei et al., 2007; Laudadio et al., 2008).

Кроме длинных транскриптов CDPK, в кДНК rolB-трансформированных клеточных культур V. amurensis были найдены короткие транскрипты CDPK, в последовательности Ser/Thr-киназного домена которых отсутствует участок длиной 48, 63 или 114 нуклеотидов: VIII каталитический субдомен и половина IX в VaCPK1a-S2, VI каталитический субдомен в VaCPK3a-S1 и часть VIII каталитического субдомена в VaCPK3a-S2. Рамка считывания при этом не сбивается. Нуклеотидные последовательности VaCPK1a-S2, VaCPK3a-S1 и VaCPK3a-S2 идентичны последовательностям VaCPK1a и VaCPK3a, за исключением отсутствующих нуклеотидов (Dubrovina et al., 2009). Короткие транскрипты CDPK ранее были найдены и у других видов растений, например, в кДНК rolB- и rolC-трансгенных культур клеток Panax ginseng обнаружены транскрипты PgCDPK1as и PgCDPK2ds (Киселев и др., 2008), а также в rolABC-культуре клеток Eritrichium sericeum – транскрипт EsCDPK1a-s. В данном случае также была исключена возможность аномалий прохождения легирования, клонирования или амплификации, так как, с одной стороны, количество отсутствующих нуклеотидов во всех случаях кратно трем, а также один и тот же вид модификаций (VaCDPK3a-S1) был получен в разных клеточных культурах V. amurensis (Dubrovina et al., 2009).

С другой стороны, известно несколько случаев подобных изменений последовательностей киназных доменов для некоторых киназ растений и животных (Xiong and Yang, 2003; Kurihara et al., 2007).

На сегодняшний день пока не понятна природа образования и функции таких необычных транскриптов. Вероятно, образование «коротких»

транскриптов является продуктом канонического или неканонического альтернативного сплайсинга, либо являются артефактом реакции обратной транскрипции при использовании нетермоустойчивой ревертазы.

1.7. Типы альтернативного сплайсинга растений Пре-мРНК сплайсинг, наряду с созреванием мРНК, экспортом мРНК из ядра и трансляцией мРНК, является важным механизмом регуляции экспрессии генов на посттранскрипционном уровне. Большое число и разнообразие сплайсинга пре-мРНК количественно и качественно влияет на популяцию мРНК различных генов. Пре-мРНК растений, как и других последовательностей – интронов, которые обычно удаляются, и кодирующих последовательностей – экзонов, которые в ходе сплайсинга объединяются и образуют зрелую мРНК. Сплайсинг пре-мРНК является важным этапом в процессинге пре-мРНК, который включает 5'-кэпирование и 3'полиаденилирование (Dubrovina et al., 2013). Альтернативный сплайсинг – это процесс, при котором кодирующие и некодирующие последовательности гена перегруппировываются различными способами с помощью сплайсосом в различных сайтах сплайсинга. Таким образом, возникают несколько вариантов транскриптов мРНК из одной и той же пре-мРНК (Reddy, 2007). В свою очередь, транскрипты мРНК являются предшественниками структурно и функционально различных белков, тем самым увеличивают состав протеома растений, используя при этом ограниченное количество генов. В настоящее время альтернативный сплайсинг подразделяют на канонический и неканонический.

В ходе канонического сплайсинга пре-мРНК, сплайсосома – подвижный комплекс РНК и белков, вырезает некодирующие последовательности РНК и сшивает кодирующие РНК последовательности вместе (Hoskins and Moore, 2012). Сплайсосома состоит из нескольких маленьких ядерных рибонуклеопротеиных частиц (small nuclear ribonucleoprotein particles snRNPs) и белковых факторов, которые узнают специфические последовательности 5' и 3' сайтов сплайсинга, важных для производства зрелой РНК. В растениях, как и во всех эукариотах, сплайсосома узнает консервативные динуклеотиды на концах интронов. В основном интроны начинаются с пары нуклеотидов GT на 5' конце – донорный сайт, и заканчиваются парой нуклеотидов AG на 3' конце – акцепторный сайт (Lorkovic et al., 2000; Reddy, 2007). Отмеченные таким образом интроны относят к основному классу U2-типа сплайсосом. Иногда также встречаются интроны (1% у A. thaliana и человека), которые относят к типу U спайсосом. Такие интроны часто начинаются с AT и заканчиваются AC парой нуклеотидов. Намного реже, в пре-мРНК сплайсинге встречаются сайты GC-AG или GT-GG донорно-акцепторных пар. Стоит отметить, что все представленные выше пары динуклеотидов встречаются в большинстве всех случаев сплайсинга и служат как сплайсинг-специфичные знаки (Dubrovina et al., 2013).

Канонический альтернативный сплайсинг подразделяют на типы: 1 – обычный сплайсинг, при котором вырезаются только интроны (рис. 7а); 2 – сохранение интрона, при котором один или несколько интронов не вырезаются (рис. 7б); 3 – вырезание экзона, при котором вместе с интронами удаляется один или несколько экзонов (рис. 7в); 4 – альтернативное 5' или 3' вырезание сайта экзона, при котором удаляется интрон с 5' или 3' частью находящегося с ним экзона (рис. 7г); 5 – выборочное вырезание экзона, при котором вырезаются все интроны и выборочно тот или иной экзон (рис. 7д) (Dubrovina et al., 2013).

Рис. 7. Типы канонического альтернативного сплайсинга пре-мРНК в растениях. Экзоны отмечены серым, темно серым и черным. Интроны отмечены горизонтальной сплошной линией. Прерывистая линия демонстрирует участки, которые вырезаются при каноническом альтернативном сплайсинге. а) бычный сплайсинг; б) сохранение интрона; в) вырезание экзона; г) альтернативное 5' или 3' вырезание; д) выборочное вырезание экзона (по: Dubrovina et al., 2013).

Неканонический альтернативный сплайсинг – это альтернативный сплайсинг, при котором происходит не только вырезание интронов, но и различные вырезание или нарушение целостности экзонов не по классическим последовательностям динуклеотидов, которые были описаны выше. К неканоническому альтернативному сплайсингу относят: 1 – вырезание экзонов и участков экзонов (рис. 8а); 2 – делеция внутри экзона (рис. 8б); 3 – создание химерных мРНК, в которых объединяются две разные молекулы мРНК (рис. 8в); 4 – сдвиг рамки считывания, который происходит из-за сохранения интрона (рис. 8д) (Dubrovina et al., 2013).

Рис. 8. Типы неканонического альтернативного сплайсинга пре-мРНК в растениях. Экзоны отмечены серым, темно серым и черным. Интроны отмечены горизонтальной сплошной линией. Прерывистая линия демонстрирует участки, которые вырезаются при неканоническом альтернативном сплайсинге. а) вырезание экзонов и участков экзонов; б) делеция внутри экзона; в) создание химерных мРНК; г) - сдвиг рамки считывания (Dubrovina et al., 2013).

Сайты неканонического сплайсинга обычно представлены короткими повторяющимися последовательностями 4–8 нуклеотидов (short direct repeated sequences, SDRs) и сильно отличаются от классических знаков узнавания сплайсосом U2 и U12. Недавние исследования показали, что SDRs растений очень богаты G и С нуклеотидами, и преимущественно представлены GC, CG, CC и GG нуклеотидами (Niu et al., 2010). Стоит отметить, что на сегодняшний день пока не установлена универсальная последовательность SDRs. Показано, что SDRs являются необходимым элементом неканонического альтернативного сплайсинга (Niu et al., 2010;

Luo et al., 2007; Lin et al., 2010).

Недавние полногеномные исследования показали, что альтернативный сплайсинг широко распространен в растениях. Так полногеномное картирование транскриптома A. thaliana показало, что около 42% (Filichkin et al., 2010) генов, содержащих в своей последовательности интроны, были подвержены альтернативному сплайсингу. Предполагают, что альтернативный сплайсинг большого числа генов играет важную роль в ответе и устойчивости растений на стрессовые воздействия (Filichkin et al., 2010; Iida et al., 2004; Ali and Reddy, 2008; Mastrangelo et al., 2012; Carvalho et al. 2013). Известно, что альтернативному сплайсингу подвергаются различные транскрипты генов, белковые продукты которых вовлечены в разнообразные сигнальные пути. Альтернативному сплайсингу подвергаются транскрипты генов транскрипционных факторов, убиквитин-лигаз и различных защитных генов (Druillennec et al. 2012). На сегодняшний день остается неясным вопрос, как альтернативный сплайсинг регулирует активность и функции протеинкиназ растений, которые, как известно, являются ключевым звеном в передачи сигнала в клетке. Известно только несколько примеров альтернативного сплайсинга Ser/Thr-протеинкиназ растений (Nishiyama et al. 1999; Kawasaki et al. 1999; Xiong and Yan, 2003;

Castells et al. 2006; Kurihara et al. 2007; Koo et al. 2007; Lin et al. 2010). В настоящее время показано, что альтернативному сплайсингу подвергаются только два гена CDPK растений. Нишияма с коллегами (Nishiyma et al., 1999) показали, что транскрипт гена CDPK печеночника (Hepaticae) имеет два идентичных соседних экзона, которые в результате альтернативного сплайсинга образуют две мРНК. Кавасаки с коллегами (Kawasaki et al., 1999) показали, что были независимо транскрибированы две разные РНК на двух независимых локусах SPK-A и SPK-B на разных хромосомах риса и объединены в один транскрипт. Пока неизвестно, подвергаются ли транскрипты генов мультигенного семейства CDPK альтернативному сплайсингу. Ранее, сотрудниками нашей лаборатории были найдены и описаны несколько необычных транскриптов гена VaCPK3a в rolB– трансгенной культуре клеток винограда амурского (Dubrovina et al. 2009).

Также были найдены и описаны необычные транскрипты гена VaCPK1е (Dubrovina et al. 2009). Показано, что транскрипт VaCPK1е подвергался классическому альтернативному сплайсингу по каноническим сайтам сплайсинга 5’GT и 3’AG, в результате чего образовывались изоформы у которых отсутствуют ключевые субдомены каталитического центра. Также было показано, что необычные короткие транскрипты генов VaCPK3а и VaCPK1е с, у которых отсутствовали внутренние домены, сайты канонического сплайсинга, и, которые, возможно, подвергались необычным пост-транскрипционным изменениям посредством SDRs. До сих пор неизвестно, обладают ли белковые продукты подобных транскриптов киназной активностью, и какую функцию они могут выполнять в клетке.

Поэтому, в данной работе одной из задач является установить влияние полноразмерных и укороченных белковых продуктов генов VaCDPK на продукцию резвератрола в клетках V. amurensis.

ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ

2.1. Клеточные линии и компоненты питательных сред В работе мы использовали клеточные линии V. amurensis с разным содержанием резвератрола: от низкого (0.004% от сухой массы клеток) в контрольной клеточной линии V2 до относительно высокого (до 0.5% от сухой массы клеток) в rolB-трансгенных клеточных линиях. Каллус V2 был получен в 2002 году из молодого стебля взрослого дикорастущего растения V. amurensis Rupr. (Vitaceae), которое было собрано на Дальнем Востоке (юг Приморского края) и определено в отделе ботаники Биолого-почвенного института ДВО РАН. Трансгенные по гену rolB клеточные линии VB1 и VB были получены в результате независимых трансформации суспензионной культуры V2 штаммом Agrobacterium tumefaciens GV3101/pMP90RK (Kiselev et al., 2007), несущим векторную конструкцию pPCV002-CaMVB (Spena et al., 1987). В конструкции ген rolB находится под контролем 35S промотора вируса мозаики цветной капусты 35S CaMV (Spena et al., 1987). Конструкция также несет ген устойчивости к канамицину nptII под контролем нопалинсинтазного промотора.

Для проведения экспериментов на клеточных линиях винограда мы использовали WБ/A агаризованную питательную среду (Kiselev et al., 2009) с добавлением 0.5 мг/л 6-бензиламинопурина (БАП) и 2.0 мг/л нафтилуксусной кислоты (АНУ), которую разливали в пробирки 20020 мм по 15 мл. Интервал субкультивирования составлял 35–40 дней в темноте при 24±1oС.

Также для характеристики VaCDPK-трансгенных клеточных линий винограда V. amurensis, а именно, внешнего вида, прироста сырой и сухой биомассы, содержания и продукции резвератрола, мы осуществляли пассаж трансгенных клеток винограда на агаризованную питательную среду WБ или WА, либо на питательную среду, не содержащую фитогормонов W0.

2.2. Обработка блокатором потенциал-зависимых мембранных Ca2+каналов, специфическим ингибитором CаМ-подобных протеинкиназ и ионофором Ca2+ А Ингибитор кальциевых каналов плазматической мембраны – верапамил (VER, ICN Pharmaceuticals, Швейцария), растворяли в дистиллированной воде и добавляли в питательные среды до измерения pH среды (исходный раствор 100 мг/мл). Рабочая концентрация 0.75 мМ. Эта концентрация была использована, так как ранее полученные результаты свидетельствуют, что данная концентрация является наиболее подходящей для ингибирования биосинтеза резвератрола в клетках винограда (Dubrovina et al., 2009).

Специфический ингибитор СаМ-подобных протеинкиназ W7 (Tocris bioscience, Бристоль, Великобритания) растворяли в диметилсульфоксиде (DMSO) и добавляли в питательные среды после автоклавирования до конечной концентрации 100 M (исходный раствор 10 мг/мл). Ранее было показано, что данная концентрация является оптимальной, при которой растительные клетки обладают способностью делиться (Kiselev et al., 2010).

Ионофор кальция (CI, A23187, Sigma, Сент-Луис, США) растворяли в этаноле и добавляли до конечной концентрации 1 M и 10 M (Kiselev et al., 2012).

2.3. Выделение нуклеиновых кислот и получение комплементарной ДНК Тотальную РНК выделяли из клеточных линий винограда при помощи метода с использованием LiCl, оптимизированного для работы с тканями растений, богатыми вторичными метаболитами (Bekesiova et al., 1999) с небольшими модификациями (Kiselev et al., 2009). Комплементарную ДНК (кДНК) получали, используя 1–3 мкг тотальной РНК, с помощью набора для обратной транскрипции (Силекс M, Москва, Россия). Для проведения обратно-транскрипционной полимеразной цепной реакции (ОТ-ПЦР) использовали 50 мкл реакционной смеси, содержащей 10-кратный ОТ буфер, по 0.24 мM каждого из 4 dNTP, 0.2 мкM олиго-(dT)15 праймера, 200 единиц активности M-MLV-полимеразы (Силекс M, Москва, Россия). Реакцию проводили при 37°C в течение 1–2 часов. Образцы полученных продуктов (0.5 мкл) были затем амплифицированы при помощи ПЦР.

2.4. Количественная оценка экспрессии генов STS Для количественного анализа экспрессии генов STS использовали полимеразную цепную реакцию с детекцией результатов в реальном времени (ПЦР РВ). ПЦР РВ для генов был выполнен согласно методике, описанной Гиулиетти и его коллегами (Giulietti et al., 2001). Геноспецифичные пары праймеров и TaqMan пробы представлены в табл. 2. Дизайн праймеров для ПЦР РВ был выполнен с помощью программы Primer Premier 5.0., кДНК амплифицировали с помощью Real-time PCR Kit (Синтол, Москва, Россия), использовали iQ5 амплификатор с функцией ПЦР РВ (Bio-Rad Laboratories, Inc., США) с программным обеспечением Optical system software v.2.0.

Подробно условия описаны в ранее опубликованной работе (Shumakova et al., 2011) Табл. 2. Праймеры и TaqMan пробы, которые использовались для ПЦР РВ генов STS и актина V. amurensis VaSTS

5'–ACAACCTCCGGTGTAGAAATGCCCGGT

5'–CCTTCTAACCGATGTTTCAAGA

(EU659862) VaSTS

5'–CACCCTTGATGGTACAACAT ACCCTTCTAACTGATGTTTCAAGGCCTAAGAGATT

(EU659863)

5'–GTCAGCCTAAATCGAAGATCAC

VaSTS

5'–CCTCAGGTGTAGAAATGCCTGGTGCAG

5'–TCTTCTAACAGATGGTTCGAGG

(EU659864) VaSTS

5'–TGGTGCAGATTATAAACTCGCTAATCTCTT

(EU659865)

5'–CCTCGAACCATCTGTTAGAAGA

VaSTS

5'–TGCATAGCACCCTTGATGGTACAACATTA

(EU659866) VaSTS

5'–AGATTATAAACTCGCTAATCTTTTAGGCCTCG

5'–CATCACTCTTCTAACAGATGG

(EU659867) VaSTS

5'–TCAGCCAAAGTCCAAGATCACCCACCTT

(EU659868)

5'–TGCATAGCACCCTTGATGGTACAACATCACTCT

VaSTS (GQ443746)

5'–GGCAGCCTAAGTCCAAGATTA

VaSTS

5'–TCACCTTGTATTTTGTACTACCTCGGGAGT

(GU266256) VaSTS

5'–TGCTCTGAGATCACCGTTGTTACATTCCGT

(GU266257) 2.5. Количественная оценка экспрессии эдногенных генов VaCDPK в нетрансгенных клетках винограда Большое количество генов CDPK и отсутствие на первых этапах работы информации о нуклеотидных последовательностях этих генов для V. amurensis не дало возможность применить в первую очередь такие стандартные молекулярно-биологические методы, как ПЦР с использованием специфических праймеров и ПЦР с детекцией результатов в реальном времени (ПЦР РВ). Поэтому, для первых экспериментов мы анализировали секвенирования полученных клонов (Киселев и др., 2008). Преимущество данного подхода заключается в том, что изучается экспрессия всего мультигенного семейства, поэтому можно определить долю экспрессии каждого гена в суммарной экспрессии генов семейства. Кроме того, есть возможность описать экспрессию новых генов, неизвестных ранее.

разработанными на основе сравнения аминокислотных последовательностей генов CDPK разных подсемейств из разных видов растений (номера доступа в ГенБанке AF363784, AF072908, AB236787, D87707, AF418563, AF090835, AY312268, X96723, NM_106132, NM_101746, AY138479, AC097277, AY394009, U20626, AJ344154, AB042550, D84408, AY704444, AB051809, AB051808, AY247754, AY072802, U90262, U08140). Прямой праймер 5’GGW GGW GAR YTY TTY GA и обратный праймер 5’-TCD GCC CAR AAD GG DGG фланкируют продукт 362 п.н., Ta = 54oС, время элонгации 22 с.

Полученные ампликоны CDPK были выделены из геля при помощи набора Glass Milk (Силекс, Москва) и клонированы в вектор pTZ57R/T согласно протоколу фирмы-производителя (Fermentas, Вильнюс, Литва).

Клонированные ПЦР-продукты CDPK были получены с использованием универсальных М13 праймеров и секвенированы с использованием Big Dye Terminator Cycle Sequencing Kit (Perking-Elmer Biosystems, Остин, США), следуя протоколу и рекомендациям изготовителя. После очистки этанолом последовательности были идентифицированы на ABI 3130 Genetic Analyser (Perking-Elmer Biosystems, США).

Полученные нуклеотидные последовательности генов CDPK V. amurensis сравнивали c известными последовательностями этих генов из других организмов в программе NCBI BLAST. Номера секвенированных фрагментов CDPK, депонированных в ГенБанк: VaCDPK1a (EU305622), VaCDPK1as (EU643699), VaCDPK1b (EU643694), VaCDPK1c (EU643695), VaCDPK1d (EU305623), VaCDPK1e (EU643696), VaCDPK2a (EU309795), VaCDPK3a (EU309796), VaCDPK3as (EU643697), VaCDPK3b (EU643693), VaCDPK3c (KC488322), VaCDPK3d (KC488323), VaCDPK1-L1 (EU327878).

Экспрессию отдельных генов CDPK оценивали количественно, основываясь на данных секвенирования о количестве клонов каждого транскрипта в исследуемых пробах и данных о суммарной экспрессии генов, полученных с помощью вырожденных праймеров. Относительные единицы рассчитывали по формуле: нормализованная к экспрессии гена актина V. amurensis суммарная экспрессия генов CDPK % клонов каждого гена / 100 (Киселев и др., 2008).

В последующих работах экспрессию наиболее часто встречаемых форм генов CDPK определяли количественно. Для количественного анализа экспрессии генов CDPK использовали ПЦР РВ, которая была выполнена согласно методике, описанной Гиулиетти с коллегами (Giulietti et al., 2001).

Геноспецифичные пары праймеров и TaqMan пробы для генов CDPK, и генов «домашнего хозяйства» глицероальдегид-3-фосфат-дегидрогиназы (VaGADPH) и актина VaAktin1 представлены в табл. 3. Дизайн праймеров для ПЦР РВ был выполнен с помощью программы Primer Premier 5.0.

кДНК амплифицировали в 20 мкл реакционной смеси, содержащей 1TaqMan буфер В, 2.5 мМ MgCl2, 250 мкМ dNTP, 1 единицу активности Taq ДНК полимеразы, 15 нг кДНК и 0.25 мкМ каждого из праймеров (Синтол, Россия). Амплификацию проводили при следующих условиях: 2 мин при 95oC, затем 50 циклов 95oC 10 с и 62 oC 25 с. Использовали iQ5 амплификатор с функцией ПЦР РВ (Bio-Rad Laboratories, Inc., США) с программным обеспечением Optical system software v.2.0 (Dubrovina et al., 2009).

Экспрессия генов «домашнего хозяйства» VaActin1 и VaGAPDH (номер использованы в качестве эндогенного контроля в измерении экспрессии. Эти гены были выбраны в предыдущих исследованиях, как наиболее подходящие референс-гены (Reid et al., 2006). TaqMan-пробы для генов VaActin и VaGAPDH были мечены флуоресцентным красителем FAM на 5’-конце и гасителем люминесценции RTQ-1 на 3’-конце (Синтол, Россия). TaqManпробы для генов CDPK были мечены флуоресцентным красителем ROX на 5’-конце и гасителем люминесценции RTQ-1 на 3’-конце (Синтол, Россия).

Табл. 3. Праймеры и TaqMan-пробы, которые использовались для ПЦР РВ генов CDPK, актина и глицеральдегид-3-фосфатдегидрогеназы V. amurensis.

VaCDPK1a 5'–CGGCGAAAGGTAGTTATTCC

5'–CCCATAAAATGACAAACATGAACCACGGTCACA

(EU305622) VaCDPK1d 5'–TCAGGGGCATTACTCTGAGA

5'–TCACACCCATGAAATGGCAGATATGGACAACA

5'–TGCTTCATCCTTGCTGGACAA

(EU305623)

5'–CTACATAGTAAGCACTCCCAA CACCTTCCCTTCTTCAATGAAAACTGACAATCCAAA'

(EU643696) VaCDPK1-L 5'–CTTAATGGTGAGTCAAGGTGA

5'–TCACTGTTGAAAGCCACGGATTTTGAACTCTCTG

5'–GTCCAAAACATGAGAAAGATCG

(EU327878)

5'–CCATAATTCCGCTTGAGGAC TTCTCTGAAATTGTTGGAAGTCCTTATTACATGGCTCC

(EU309795) VaCDPK3a 5'–CCGAGAACTTCTTGTTTGATACC

5'–TGAGGACGCTGCTCTCAAGGCCACTGATTT

5'–CTCTGGTGCAACATAGTAGGGAC

(EU309796) VaАctin1 5'–GTATTGTGCTGGATTCTGGTGAT

5'–TCACACTGTGCCAATTTATGAAGGTTATGCCCT

5'–AGCAAGGTCAAGACGAAGGATAG

(DQ517935)

5'–CAC TGA AGA TGA TGT TGT TTC C

GAPDH

5'–AGA CTT CAT CGG TGA CAA CAG GTC CAG CAT

(GU585870) 2.6. Получение полной последовательности генов VaCDPK1a, VaCDPK1e, VaCDPK1d, VaCDPK2a, VaCDPK3c и VaCDPK3a Для получения полной последовательности генов VaCDPK1a, VaCDPK1e, VaCDPK1d, VaCDPK2a, VaCDPK3c и VaCDPK3a использовали пары праймеров представленные в табл. 4. Эти праймеры были подобраны на основе известных последовательностей генов CDPK V. amurensis. Размер всех ПЦР-продуктов полных последовательностей генов VaCDPK был длиной около 1500 пн (Ta=54oС, время элонгации 90 с).

Табл. 4. Праймеры для получения полной последовательности VaCDPK, актина и V. amurensis.

Ген VaCDPK Специфические праймеры для получения полной

5'–ATGGGTTTCTGCTTCTCCAG, 5'–TCTCTGCTTCMACTCGGTATC

VaCDPK1а

5'–ATGGGTTGTTTTAGCAGTAAG, 5'–AAATAGCTTGACTGGCGGTT

VaCDPK1d

5'–ATGGGTATTTGTCTAAGCAAA, 5'–CTAAAAAACCTTCAATCCCTG

VaCDPK1e 5'–ATGGGGAACTGTTGCAGAT, 5'–TTACTCATTCCCCAAGTTTAG VaCDPK2a

5'–ATGAAGAAATCGTCCGCAGGA;5'– GTTTGTCAAGCGCATATCTGG

VaCDPK3a

5'–ATGGGGAACACATGTGTAGGA, 5'–TTAGGTTATTTTGTATCCCTTCTT

VaCDPK3c Полученные ампликоны генов VaCDPK были выделены из геля при помощи набора Glass Milk (Силекс, Москва) и клонированы в вектор pTZ57R/T согласно протоколу фирмы-производителя (Fermentas, Вильнюс, Литва). Клонированные ПЦР-продукты генов VaCDPK были секвенированы с использованием Big Dye Terminator Cycle Sequencing Kit (Perking-Elmer Biosystems, Форстер, Канада), следуя протоколу и рекомендациям изготовителя. После очистки этанолом пробы были секвенированы на ABI 3130 Genetic Analyser (Perking-Elmer Biosystems, США). Полученные нуклеотидные последовательности генов V. amurensis сравнивали с ранее секвенированной последовательностью гена ACPK1 из близкородственного вида V. vinifera в программе NCBI BLAST. Выравнивание участков генов (http://www.mbio.ncsu.edu/BioEdit/bioedit.html). Затем сравнили выведенные аминокислотные последовательности VaCDPK с ранее известными белками из Arabidopsis thaliana и из V. vinifera.

Схожим методом получения полной последовательности VaCDPK из кДНК клеток винограда, получены несколько коротких вариантов транскриптов VaCDPK1е и VaCDPK3a: VaCDPK1еSF1, VaCDPK1еSF2, соответственно. Для получения коротких вариантов генов VaCDPK1е и VaCDPK3a были использованы те же праймеры, что и для получения полной последовательности данных генов (табл. 3). Полученная аминокислотная последовательность VaCDPK1еSF1 содержала только N-терминальный домен; VaCDPK1еSF2 – N-концевой участок, 63% киназного домена, домен связывания с кальцием и С-концевой участок; VaCDPK1еSF3 – N-концевой участок, 33% киназного домена, домен связывания с кальцием и С-концевой участок (рис. 9). Выведенная аминокислотная последовательность VaCDPK3aSF1 содержала только N-концевой участок и 35% Ser/Treпротеинкиназного домена; VaCDPK3aSF2 – N-концевой участок и 90% киназного домена; VaCDPK3aSF3 – N-концевой участок, 65% киназного домена, 95% домена связывания с кальцием и С-концевой участок (рис. 9).

Рис. 9. Схематическое изображение структуры полноразмерных белков VaCDPK3a, VaCDPK1е и их укороченных вариантов: VaCDPK3aSF1, VaCDPK3aSF2, VaCDPK3aSF3, VaCDPK1еSF1, VaCDPK1еSF2, VaCDPK1еSF3.

сверхэкспрессирующих гены VaCDPK, c помощью агробактериальной трансформации Для трансформации культуры клеток винограда амурского V2, мы амплифицировали с кДНК ткани винограда амурского полноразмерные транскрипты VaCDPK1a, VaCDPK1d, VaCDPK2a, VaCDPK3c VaCDPK1e, VaCDPK3a и укороченные варианты двух последних генов – VaCDPK1еSF1, VaCDPK3aSF3, используя геноспецифичные пары праймеров (табл. 4).

Полученные ампликоны генов VaCDPK были выделены из геля при помощи набора Glass Milk (Силекс, Москва) и клонированы в вектор pTZ57R/T согласно протоколу фирмы-производителя (Fermentas, Вильнюс, Литва).

Затем, используя пару праймеров (табл. 5), содержащие в своей последовательности сайты рестрикции для соответствующих рестриктаз, мы амплифицировали полные последовательности VaCDPK1a, VaCDPK1d, VaCDPK2a, VaCDPK3c VaCDPK1e, VaCDPK3a, и укороченные варианты двух последних генов VaCDPK1еSF1, VaCDPK1еSF2, VaCDPK1еSF3, VaCDPK3aSF1, VaCDPK3aSF2, VaCDPK3aSF3.

Табл. 5. Праймеры и рестриктазы для получения бинарных векторов. В последовательности праймеров жирным подчеркнутым шрифтом отмечены сайты рестрикции.

5' – ACTCGAGCTCATGGGTTTCTGCTTCTCCAG

VaCDPK1a

5'– TCGAGGATCCTTATCTCTGCTTCACTCGGTATC BamHI

VaCDPK1e;

5'– GCTCGAGCTCATGGGTATTTGTCTAAGCAAA

VaCDPK1eSF1;

5'–TCGAGGATCCCTAAAAAACCTTCAATCCCTG

VaCDPK1eSF

5'– GCTCCTCGAGATGGGTTGTTTTAGCAGTAA

VaCDPK1d

5'– TCGAGGATCCAAATAGCTTGACTGGCGGT BamHI

5'– GCTCGAGCTCATGGGGAACTGTTGCAGAT

VaCDPK2a

5'– TCGAGGTACCTTACTCATTCCCCAAGTTTAG KpnI

VaCDPK3a;

5'– GCTCGAGCTCATGAAGAAATCGTCCGCAGGAG

VaCDPK3aSF1;

5'– TCGAGGATCCGTTTGTCAAGCGCATATCTGGT

VaCDPK3aSF

5'– GCTCCTCGAGATGGGGAACACATGTGTAGGA

VaCDPK3c

5'– TCGAGGATCCTTAGGTTATTTTGTATCCCTTCTT BamHI

В последовательности праймеров жирным подчеркнутым шрифтом отмечены сайты рестрикции.

В качестве матриц использовали предварительно полученные генетические конструкции pTZ57-VaCDPK. Полученные ПЦР-продукты перенесли по соответствующим сайтам рестрикции (табл. 5) в вектор pSAT (Tzfira et al., 2005), используя представленные в табл. 5 рестриктазы (СибЭнзим, Новосибирск, Россия). В конструкции pSAT1 гены VaCDPK находились под контролем двойного 35S промотора вируса мозаики цветной капусты (35S CaMV). Затем, мы перенесли кассету, содержащую тот или иной ген VaCDPK, из pSAT1 в вектор pZP-RCS2-nptII (Tzfira et al., 2005), используя сайт для рестрикции рестриктазы PalA I (СибЭнзим, Новосибирск, Россия). Далее генетические конструкции pZP-RCS2-VaCDPK были перенесены в агробактерии A. tumefaciens GV3101.

трансформировали полученными штаммами агробактерий по методике описанной ранее (Kiselev et al., 2007). После трансформации каллусы культивировали в течение 5 месяцев в присутствии 250 мг/л цефотаксима для подавления роста агробактерий. Отбор трансгенных клеток проводили при помощи селекции на канамицине (15–20 мг/л) в течение 3 месяцев.

2.8. Проверка трансгенности полученных клеточных линий винограда Трансгенность полученных линий была доказана по наличию вставки гена nptII с помощью праймеров 5'-GAG GCT ATT CGG CTA TGA CTG и 5'ATC GGG AGC GGC GAT ACC GTA по условиям описанным ранее (Kiselev et al., 2007). Отсутствие сигнала после ПЦР на ген virB2 служило доказательством того, что агробактерий не было в анализируемых пробах.

ПЦР на ген virB2 проводили с использованием праймеров 5'-AAT GCG CGT

GAT ATC GAG CTG CG и 5'-ATA CTA CCG CCA GTG AGC GTT TGG.

Для количественного анализа эндогенной – внутриклеточной экспрессии гена, трансгенной – экспрессии дополнительной вставки гена, и тотальной – суммарной экспрессии внутриклеточного и дополнительной вставки гена VaCDPK, использовали метод ПЦР РВ, по методике, описанной Гиулиетти с соавторами (Giulietti et al., 2001). Тотальную РНК выделяли по методике, описанной ранее (Dubrovina et al., 2013). кДНК получали с помощью набора для синтеза первой цепи кДНК с олиго(дТ) праймерами (Силекс, Москва, Россия) с модификациями (Kiselev et al., 2013b). Тотальную экспрессию генов VaCDPK определяли с помощью пары праймеров, подобранных к последовательности киназного домена VaCDPK. Эндогенную экспрессию определяли используя пару праймеров, комплементарных к концу последовательности киназного домена и к последовательности 3' нетранскрибируемой области (3'UTR) известной кДНК гена. Экспрессию дополнительной вставки гена VaCDPK определяли, используя пару праймеров, подобранных к концу белок кодирующей последовательности гена VaCDPK и к последовательности CaMV 35S терминатора, находящегося в бинарной конструкции pZP-RCS2-nptII-VaCDPK. Геноспецифичные пары праймеров представлены в табл. 6.

Табл. 6 Праймеры для определения суммарной, эндогенной экспрессии и экспрессии трансгена VaCDPK.

определения тотальной определения эндогенной определения экспрессии

5'CGGCGAAAGGTAGTTATTCC 5'GAATGGGGGATGAAGCGACT

5'GAATGGGGGATGAAGCGACT

VaCDPK1a 5'TTCTCAGGCTTCAAGTCCCT 5'GAGAGACTGGTGATTTTTGCG

5'TTAAACTTATCTCTGCTTCCAC

5'GTCAATAGGCACAAGCTCGA

5'ATGCGCTTTTGAAGGCAACA

VaCDPK1e; 5'GTCAATAGGCACAAGCTCGA 5'GAGAGACTGGTGATTTTTGCG

5'CTACATAGTAAGCACTCCCAA

5'CTGTGCCGAGTGCAACAGAAA

5'ATGGCAATGGAACGATTGAC

5'TCAGGGGCATTACTCTGAGA



Pages:   || 2 | 3 |
Похожие работы:

«Курашев Антон Сергеевич АНТЭКОЛОГИЯ АЛЬПИЙСКИХ РАСТЕНИЙ СЕВЕРО-ЗАПАДНОГО КАВКАЗА Специальность 03.02.01 – ботаника Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель, д.б.н., профессор В.Г. Онипченко Москва, 2012 г. ОГЛАВЛЕНИЕ Введение Глава 1. Цветение и опыление растений как предмет экологических исследований 1.1. Антэкология...»

«Захаров Алексей Борисович Дендроиндикация загрязненности окружающей среды урбанизированных территорий на примере искусственных популяций сосны обыкновенной (Pinus sylvestris L.) Балахнинской низменности 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель :...»

«Крышень Кирилл Леонидович БИОХИМИЧЕСКИЕ МЕХАНИЗМЫ КОРРЕКЦИИ ОСТРОГО ВОСПАЛЕНИЯ ЛИПИДАМИ ПЕЧЕНИ ТРЕСКИ 14.03.06 – фармакология, клиническая фармакология 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата биологических наук Научные руководители: Доктор медицинских наук, Макарова М.Н. Доктор химических наук, профессор Дадали В.А. Санкт-Петербург ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ГЛАВА 1. ЛИТЕРАТУРНЫЙ...»

«ПОЛЬШАКОВ Владимир Иванович СПЕКТРОСКОПИЯ ЯМР ВЫСОКОГО РАЗРЕШЕНИЯ В ИЗУЧЕНИИ МОЛЕКУЛЯРНОГО МЕХАНИЗМА ДЕЙСТВИЯ ЛЕКАРСТВЕННЫХ ПРЕПАРАТОВ. 03.00.04 – биохимия Диссертация в виде научного доклада на соискание ученой степени доктора химических наук Москва - 2000 Официальные оппоненты : Доктор химических наук, профессор В.Г. Граник Член-корреспондент РАН, доктор химических наук, профессор С.Н. Кочетков Доктор химических наук,...»

«Старков Алексей Иннокентьевич ЭКОЛОГИЯ ДАУРСКОЙ ПИЩУХИ (OCHOTONA DAUURICA PALLAS, 1776) В ЮГО-ЗАПАДНОМ ЗАБАЙКАЛЬЕ Специальность 03.02.08 — Экология (биологические науки) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : канд. биол. наук Н.Г. Борисова Улан-Удэ - 2014 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. Глава ФИЗИКО-ГЕОГРАФИЧЕСКАЯ...»

«НОСАЧ Екатерина Сергеевна Микробиологические аспекты диагностики хламидийных и микоплазменных пневмоний у лиц молодого возраста в закрытых коллективах. 03.02.03 – микробиология АВ ТОР ЕФЕР АТ диссертации на соискание ученой степени кандидата медицинских наук Владивосток 2014 Диссертация выполнена в государственном бюджетном образовательном учреждении высшего профессионального образования Тихоокеанский государственный медицинский университет Министерства здравоохранения...»

«ЯРЫМОВА ИННА АЛЕКСАНДРОВНА МИНЕРАЛЬНАЯ ВОДА КАК РЕГУЛЯТОРНЫЙ ФАКТОР ФУНКЦИОНАЛЬНОЙ АКТИВНОСТИ ЖЕЛУДКА ПРИ ИММОБИЛИЗАЦИОННОМ СТРЕССЕ 03.00.13 – физиология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор В.И. Гриднева Томск – 2003 2 Список сокращений АДГ - антидиуретический гормон АКТГ - адренокортикотропный гормон АТФ - аденозинтрифосфат ВИП - вазоактивный...»

«Цатурян Людмила Дмитриевна Функциональное состояние сердечно-сосудистой системы организма детей с учетом их конституциональных особенностей 03.00.13 – физиология 14.00.09 – педиатрия диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор Бутова О.А. доктор медицинских наук, профессор Калмыкова А.С. Ставрополь – ОГЛАВЛЕНИЕ Стр. Список сокращений Введение Глава 1....»

«УДК 632. 954: 631.417 Анисимова Марина Анатольевна ДЕТОКСИЦИРУЮЩАЯ СПОСОБНОСТЬ ПОЧВ И ВЫДЕЛЕННЫХ ИЗ НИХ ГУМИНОВЫХ КИСЛОТ ПО ОТНОШЕНИЮ К ГЕРБИЦИДАМ (Специальность 03.00.27-почвоведение) Диссертация на соискание ученой степени кандидата биологических наук Научные руководители: кандидат биологических наук, доцент Г.Ф. Лебедева кандидат химических наук, старший научный сотрудник И.В. Перминова...»

«ВОСКРЕСЕНСКАЯ Екатерина Александровна Новые подходы к микробиологическому мониторингу популяций Yersinia.pseudotuberculosis и лабораторной диагностике псевдотуберкулеза 03.02.03 – микробиология Диссертация на соискание ученой степени доктора биологических наук Научный консультант : Заслуженный деятель науки РФ доктор медицинских наук профессор...»

«Симакова Мария Николаевна ХАРАКТЕРИСТИКИ СТРУКТУРЫ И СВОЙСТВА БЕЛКОВ СИСТЕМ ИНФИЦИРОВАНИЯ БАКТЕРИОФАГОВ Т4 И PHIKZ И НЕКОТОРЫХ МЕМБРАННЫХ БЕЛКОВ 03.01.02 – биофизика ДИССЕРТАЦИЯ на соискание ученой степени кандидата физико-математических наук Научный руководитель : доктор химических наук Мирошников Константин Анатольевич Москва СОДЕРЖАНИЕ ВВЕДЕНИЕ...»

«УДК 575.174.015.3:616.12.008.331.1 БУЛГАКОВА ИРИНА ВИКТОРОВНА ВОВЛЕЧЕННОСТЬ ПОЛИМОРФИЗМА ГЕНОВ СИГНАЛЬНОГО КАСКАДА АРИЛГИДРОКАРБОНОВОГО РЕЦЕПТОРА И БИОТРАНСФОРМАЦИИ КСЕНОБИОТИКОВ В РАЗВИТИЕ ГИПЕРТОНИЧЕСКОЙ БОЛЕЗНИ И ЕЕ ОСЛОЖНЕНИЙ Диссертация на соискание ученой степени кандидата медицинских...»

«Вознийчук Ольга Петровна ПРОСТРАНСТВЕННАЯ СТРУКТУРА И ОРГАНИЗАЦИЯ НАСЕЛЕНИЯ НАЗЕМНЫХ ПОЗВОНОЧНЫХ ЦЕНТРАЛЬНОГО АЛТАЯ 03.02.04 – зоология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор Ю.С. Равкин Горно-Алтайск – ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. ГЛАВА 1. ИСТОРИЯ...»

«ДЕНИСОВА Яна Евгеньевна КЛИНИКО-ГЕНЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ ХРОНИЧЕСКОЙ ИСТИННОЙ ЭКЗЕМЫ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель: доктор медицинских наук, профессор Чурносов Михаил Иванович Белгород – 2014 СОДЕРЖАНИЕ Стр. ВВЕДЕНИЕ..5- ГЛАВА 1. Обзор литературы 1.1.Молекулярные механизмы этиопатогенеза истинной экземы.10- 1.2....»

«Блащинская Оксана Николаевна БАРЬЕРНЫЕ СВОЙСТВА ДРЕВЕСНОГО РАСТИТЕЛЬНОГО ПОКРОВА (сосна обыкновенная и береза повислая) УРБАНИЗИРОВАННОЙ ТЕРРИТОРИИ (на примере города Ангарска Иркутской области) Специальность 03.02.08. – Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель – доктор биологических наук, доцент...»

«Федосеева Лариса Абрамовна Экспрессия ключевых генов ренин-ангиотензиновой системы у гипертензивных крыс НИСАГ 03.02.07 – генетика ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научные руководители: д.б.н., проф. А.Л.Маркель д.б.н., проф. Г.М.Дымшиц Новосибирск 2  ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ..................»

«НОВИКОВ Сергей Геннадьевич ЭКОЛОГИЧЕСКАЯ ОЦЕНКА ЗАГРЯЗНЕНИЯ ТЯЖЁЛЫМИ МЕТАЛЛАМИ ПОЧВ УРБАНИЗИРОВАННЫХ ТЕРРИТОРИЙ ПО КАТЕГОРИЯМ ЗЕМЛЕПОЛЬЗОВАНИЯ (НА ПРИМЕРЕ Г. ПЕТРОЗАВОДСКА) Специальность 03.02.08 – экология ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук научный руководитель: доктор сельскохозяйственных наук, профессор Федорец Наталия Глебовна...»

«ПЛОТНИКОВ ВАДИМ АЛЕКСЕЕВИЧ МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКИЙ АНАЛИЗ И БИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА ПОЛЕВЫХ ИЗОЛЯТОВ ВИРУСА ЛЕЙКОЗА ПТИЦ, ЦИРКУЛИРУЮЩИХ НА ТЕРРИТОРИИ РОССИЙСКОЙ ФЕДЕРАЦИИ Специальность 03.02.02 - вирусология ДИССЕРТАЦИЯ На соискание ученой степени кандидата биологических наук Научный руководитель доктор биологических наук, профессор Алипер Т. И. Москва- ОГЛАВЛЕНИЕ...»

«АНИСИМОВ Андрей Павлович Молекулярно-генетические механизмы образования и функциональная значимость капсулы Yersinia pestis 03.00.07 - микробиология Диссертация на соискание ученой степени доктора медицинских наук Саратов, Оболенск - 1999 2 СОДЕРЖАНИЕ Стр. ПЕРЕЧЕНЬ СОКРАЩЕНИЙ, УСЛОВНЫХ ОБОЗНАЧЕНИЙ, СИМВОЛОВ,...»

«ДЕМЕНТЬЕВА Наталья Евгеньевна КОЛИЧЕСТВЕННЫЕ И КАЧЕСТВЕННЫЕ ХАРАКТЕРИСТИКИ СУБПОПУЛЯЦИЙ ВИЧ В КРОВИ И СПИННОМОЗГОВОЙ ЖИДКОСТИ 03.02.02 – вирусология ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научный руководитель : академик РАН, доктор медицинских наук, профессор Н.А.Беляков Научный консультант : доктор биологических наук...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.