WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 |

«Воздействие фрагментов рибосомных генов, накапливающихся во внеклеточной ДНК, на свойства мезенхимальных стволовых клеток человека ...»

-- [ Страница 1 ] --

ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ

УЧРЕЖДЕНИЕ ВЫСШЕГО ПРОФЕССИОНАЛЬНОГО ОБРАЗОВАНИЯ

МОСКОВСКИЙ ПЕДАГОГИЧЕСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ

На правах рукописи

Чвартацкая Оксана Викторовна

Воздействие фрагментов рибосомных генов, накапливающихся во

внеклеточной ДНК, на свойства мезенхимальных стволовых клеток человека Специальность 03.01.04 биохимия Диссертация на соискание ученой степени кандидата биологических наук

Научный руководитель:

доктор биологических наук, доцент Севастьянова Г.А.

Москва –

ОГЛАВЛЕНИЕ

Принятые сокращения и аббревиатуры………………………… ВВЕДЕНИЕ…………………………………………………………..

ОБЗОР ЛИТЕРАТУРЫ

Биологические свойства и функции внеклеточной ДНК человека……………………………………………………………… Концентрация внеклеточной ДНК в биожидкостях……………….

1.1.1 Размеры фрагментов внеклеточной ДНК………………………….

1.1.2 Модификация оснований внеклеточной ДНК…………………….

1.1.3 Происхождение фрагментов внеклеточной ДНК в организме…..

1.2 Микроокружение внеклеточной ДНК………………………………...

1. Взаимодействие внеклеточной ДНК с 1. клетками…………………………………………………………….... Белки семейства «toll-like» рецепторов (TLR)……………………..

1.4.1 Лиганды для белков TLR9.……………………………………………… 1.4.1.1 TLR9-сигнальный путь и связанные с ним NF-kB-, JNK/p38-, 1. IRF-cигнальные пути.……………………………………..…………. Роль цитокинов в организме………………………...……………....

1.6 Провоспалительные цитокины……………………………………… 1.6. Противовоспалительные цитокины…………………………….…... 1.6. МАТЕРИАЛЫ И МЕТОДЫ……………………………………… Выделение и культивирование мезенхимальных стволовых 2. клеток.………. ……………………………………………………..… Исследование экспрессии клетками поверхностных 2.1. белков.………………………………………………………………... Определение концентрации повторяющейся последовательности 2. ДНК человека в крови………………………………….…………… Конструирование плазмиды п(рДНК).…………………………...

2.3 Выделение РНК из мезенхимальных стволовых 2. клеток………………………………………………………………... Обработка выделенной РНК ДНКазой ……………………….……. 2.4. Определение концентрации РНК……………………...…………….





2.4. Выделение ДНК из мезенхимальных стволовых 2. клеток…………………………………………………………………. Определение концентрации ДНК……………………………….…..

Постановка полимеразцой цепной реакции………………….…….

2. Проведение реакции обратной транскрипции.…………………….

Полимеразная цепная реакция (ПЦР) в реальном времени……… Иммуногистохимия………………………………………………… Связывание антител с NF-kB……………………………………….

Связывание антител с TLR9………………………………………...

2.7. Иммуноферментный анализ секреции цитокинов………………… 2. Иммуноферментный анализ секреции цитокина IL-10…………… Иммуноферментный анализ секреции цитокина TNF…………… 2.8. Определение активности каспазы 3……………………..………….. 2. Статистическая обработка результатов…………………………….. 2. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЯ ……………………………… Рецепторы, отвечающие на действие CG-богатой внеклеточной 3. Определение экспрессии мРНК TLR9 в мезенхимальных 3.1. стволовых клетках, при действии на них вкДНК, модельной 3. мезенхимальных стволовых клетках в ответ на действие Кинетика изменения во времени экспрессии мРНК TLR9 и 3.2. адаптера TLR-сигнального пути – MyD88 в ответ на стимуляцию п(рДНК).…………………………………………………………………… Aктивация NF-kB -, JNK/p38-, IRF- сигнальных путей в ответ на 3.2. стимуляцию мезенхимальных стволовых клеток фрагментами п(рДНК).……………………………………………………..……… Транслокация NF-kB в ядро мезенхимальных стволовых клеток 3.2. при действии фрагментов п(рДНК).…………………………….……..

П(рДНК) стимулирует увеличение количества мРНК цитокинов 3.2. IL10 и TNF…………………………………………..……………...

3. мезенхимальных стволовых клетках при действии модельных фрагментов внеклеточной ДНК…………………………………….. Принятые сокращения и аббревиатуры CpG-ОДН – CpG-содержащие олигонуклеотидные аналоги;

GAPDH – глицеральдегид-3- фосфатдегидрогеназа;

IL – интерлейкин;

IRAK – (от англ. interleukin-1 receptor-associated kinase ) – интерлейкин- рецептор - связанная киназа;

IRF3/7 – фактор, регулирующий транскрипционную активность гена интерферона;

JNK (англ. c-Jun N-terminal kinase; c-Jun N-концевые киназы) - стрессактивируемые протеинкиназы MAPК – митоген активируемая протеинкиназа;

MyD88 – (от англ. мyeloid differentiation primary response gene) – ген миелоидной дифференцировки первичного ответа;

NF-kB (ядерный фактор «каппа-би»; англ. nuclear factor kappa-light-chainenhancer of activated B cells, NF-kB) — универсальный фактор транскрипции PAMP – (от англ. pathogen-associated molecular pattern) –патогенсвязывающий молекулярный паттерн;

real-time PCR – полимеразная цепная реакция в реальном времени;

SDS – додецилсульфат натрия;

SSC – стандартный солевой раствор;

TBP – TATA-связывающий белок;

TCR – Т-клеточный рецептор;

TIR – (от англ. toll-interleukin-1 receptor) – толл-интерлейкин-1 рецептор;

TLR – (от англ. toll-like receptor) – семейство толл-подобных рецепторов;

TNF – фактор некроза опухоли;

АПК – антигенпредставляющие клетки;

вкДНК – внеклеточная ДНК;

гДНК – геномная ДНК;

ГКГ – главный комплекс гистосовместимости;





инг-ОДН – ингибирующие олигодезоксинуклеотиды;

ИФА – иммуноферментный анализ;

ИФН – интерферон;

КД – контрольные доноры;

МСК – мезенхимальные стволовые клетки;

НК-клетки – клетки нормальных киллеров;

ОДН – олигодезоксинуклеотиды;

ОНП – однонуклеотидный полиморфизм;

п(рДНК) – фрагменты рибосомной ДНК, встроенные в плазмиду ПЦР – полимеразная цепная реакция;

РАИЛ – рецептор антагонистов интерлейкинов;

СатIII – клонированный фрагмент субфракции сателлита 3;

ТАТА – короткий А-Т-обогащенный участок (типичная последовательность —...ТАТААА...) гена эукариот;

ТКР – Т-клеточный антигенраспознающий рецептор;

ТОрДНК – транскрибируемая область рибосомного повтора человека;

ТФР – трансформирующий фактор роста бета;

ФНО – фактор некроза опухоли ;

ЭДТА – этилендиаминтетрауксусная кислота;

яДНК – ядерная ДНК;

ВВЕДЕНИЕ

Актуальность проблемы Внеклеточная ДНК (вкДНК) в норме присутствует в плазме крови человека и в межклеточном веществе. До сих пор остаются невыясненными вопросы ее происхождения, однако в литературе обсуждаются две главных модели. Первая из них предполагает, что появление вкДНК связано с гибелью клеток в организме, то есть циркулирующая вкДНК в кровотоке – это фрагменты ДНК клеток, подвергшихся апоптозу. В рамках второй модели вкДНК появляется в межклеточном веществе в результате секреции клетками фрагментов ДНК. Показано, что в крови пациентов с различными патологиями концентрации вкДНК существенно возрастают. Поэтому на данный момент наибольший интерес научного сообщества вызывает ее применение в диагностике различных заболеваний.

До недавнего времени предполагалось, что вкДНК не оказывает влияния на клетки организма. Известно, что геномная ДНК млекопитающих не обладает иммуностимулирующим действием, так как содержит незначительное количество неметилированных CpG–мотивов в своем составе, а также включает иммуносупрессорные последовательности. Однако вкДНК существенно отличается от ядерной ДНК (яДНК) по ряду свойств.

Установлено, что вкДНК в отличие от яДНК обогащена повторяющейся последовательностью - транскрибируемой областью рибосомного повтора (ТОрДНК) [Калашникова и соавт., 2006; Костюк и соавт., 2006; Вейко и соавт., 2007], которая аналогично бактериальной ДНК является потенциальным иммуномодулятором, также было показано, что вкДНК и фрагмент ТОрДНК обладает стимулирующим действием на лимфоциты человека [Вейко и соавт., 2006]. Кроме того, отмечено, что активирующее действие ТОрДНК на клетки иммунной системы опосредуется через рецепторы семейства Toll-like, или TLR – (от англ. toll-like receptor) [Вейко и соавт., 2006].

Однако остается не известным, оказывают ли воздействие фрагменты вкДНК на свойства мезенхимальных стволовых клеток.

За последнее время достигнуты большие успехи в изучении биологии стволовых клеток, но остается еще много вопросов, связанных с их взаимодействием с клетками микроокружения, а также ролью различных сигнальных путей в регуляции стволовых клеток. Стволовые клетки неспециализированные клетки, не имеют тканеспецифических маркеров и поддерживают статус недифференцированных клеток. При действии определенных биологических сигналов стволовые клетки способны дифференцироваться в специализированные клетки [Morrison et al., 2006].

Применение эмбриональных стволовых клеток открывает широкие возможности для клинической практики, но вызывает большое количество этических проблем. Поэтому в настоящее время все больше внимания уделяется изучению свойств стволовых клеток из других источников.

Мезенхимальные стволовые клетки (МСК) являются предшественниками клеток мезенхимальной линии, это хрящи, кости, сухожилия, жир, мышцы.

МСК достаточно легко выделяются из костной и жировой тканей, а также из других источников, и быстро растут в лабораторных условиях. Кроме того, мезенхимальные стволовые клетки способны оказывать иммуносупрессорное действие посредством индукции регуляторных Т-лимфоцитов и дендритных клеток [Stagg, 2007]. Эти свойства способствуют применению мезенхимальных стволовых клеток в практической медицине. В то же время не полностью изучена регуляция этих клеток и сигнальные пути, активирующиеся при их взаимодействии с клетками организма, поскольку эти сигнальные пути образуют сложную сеть.

Известно, что стволовые клетки локализованы и функционируют в определенном микроокружении, называемом “нишей” [Morrison et al., 2008].

Нишу образуют клетки микроокружения, продуцирующие факторы роста и другие регуляторные молекулы, и внеклеточный матрикс, представленный базальными мембранами на границе эпителиальных и мезенхимных тканей.

«Ниша» обеспечивает жизнеспособность, самоподдержание и самовоспроизведение стволовых клеток, а также длительное их пребывание в состоянии покоя и дифференциацию дочерних транзиторных клеток, тем самым она защищает стволовые клетки от внешних воздействий [Morrison et al., 2008]. При определенных условиях стволовые клетки могут покидать ниши (процесс мобилизации стволовых клеток), сохраняя жизнеспособность и возвращаться в свои ниши («хоуминг» СК) [Lapidot et al., 2005].

Повреждение ткани стимулирует переход стволовых клеток к пролиферации, поскольку стволовые клетки являются пролиферативным резервом при регенерации ткани [Lehrer et al., 1998]. Свойство стволовых клеток способствовать репарации поврежденных тканей активно используется в практической медицине. В очаг повреждения либо вводятся аутологичные стволовые клетки, либо стимулируются к пролиферации эндогенные стволовые клетки, либо активируется мобилизация стволовых клеток из других источников с помощью ряда цитокинов с их последующей миграцией в зоны повреждения [Daniels, 2007]. Однако процессы, происходящие со стволовыми клетками в очаге повреждения, также остаются малоизученными.

Целью настоящей работы является изучение влияния внеклеточной ДНК и ее фрагментов на мезенхимальные стволовые клетки, посредством моделирования in vitro ситуации, когда эндогенные мезенхимальные стволовые клетки, мигрирующие из ниши в очаги повреждения, или мезенхимальные стволовые клетки, введенные в организм с целью терапии, контактируют с ГЦ-богатой вкДНК, которая в норме и при патологии содержится в плазме крови.

Для достижения этой цели были поставлены следующие задачи:

Отработать адекватные условия культивирования МСК, полученных Выявить рецепторы в МСК, которые активируются в ответ на Изучить сигнальные пути, участвующие в ответе МСК на действие модельного ГЦ-богатого фрагмента вкДНК;

Проследить, какие механизмы выживаемости активируются в МСК при контакте с ГЦ-богатыми фрагментами вкДНК;

Научная новизна. Впервые было показано активирующее действие вкДНК и ГЦ-богатого фрагмента (ТОрДНК) на мезенхимальные стволовые клетки человека, сопровождающееся усилением синтеза РНК и высокой продукцией цитокинов IL10 и TNF. Стимулирующее действие вкДНК и ТОрДНК на мезенхимальные стволовые клетки человека реализуется посредством активации рецепторов семейства «toll-like» (в частности TLR9), которые узнают ГЦ-богатые последовательности ДНК. Установлено, что плазмида (п(рДНК)), содержащая в своем составе фрагменты ТОрДНК, активирует в мезенхимальных стволовых клетках TLR9-сигнальный путь и связанные с ним NF-kB-, JNK/p38-, IRF-cигнальные пути.

Научно-практическая значимость работы. В последнее время терапия стволовыми клетками приобретает все более актуальное значение для лечения заболеваний, сопровождающихся дегенерацией тканей. Массовая гибель клеток, пересаженных в очаг поражения тканей, остается серьезной проблемой в транспланталогии. Для того, чтобы повысить жизнеспособность пересаживаемых мезенхимальных стволовых клеток, проводят предварительную обработку клеток, в частности, TNF [Yao et al., 2009] или синтетическими олигонуклеотидами (ГЦ-ОДН) [Tomchuck et al., 2008].

Эффективность этой предварительной обработки в значительной степени зависит от активации NF-kB и его транслокации в ядро [Yao et al., 2009].

Полученные данные указывают на то, что культивирование мезенхимальных стволовых клеток с ГЦ-богатой плазмидой п(рДНК) в низких концентрациях (50 нг/мл) в течение короткого времени вызывает стимуляцию TLR9, что приводит к активации и транслокации NF-kB в ядро. П(рДНК) может быть использована для предварительной обработки культуры пересаживаемых мезенхимальных стволовых клеток, наряду с предлагаемой обработкой стволовых клеток синтетическими ГЦ-ОДН для стимуляции TLR9.

ЛИТЕРАТУРНЫЙ ОБЗОР

Биологические свойства и функции внеклеточной ДНК человека История изучения биологии циркулирующих нуклеиновых кислот ведет свое начало с 1948 года, когда исследователи Мендель и Метаис впервые обнаружили их в плазме крови человека. С тех пор нуклеиновые кислоты были обнаружены как в различных циркулирующих жидкостях в организме животных, так и в межклеточном веществе в тканях, а также в средах культивирования различных клеток растений [Gahan et al., 2008]. Этот факт был подтвержден также на бактериях и клетках растений [Peters and Pretorius, 2011]. Фрагменты ДНК, которые были выделены из жидкостей организма, принято называть внеклеточной ДНК (вкДНК), экстрацеллюлярной ДНК, внехромосомной ДНК, ДНК плазмы, cell-free DNA, circulating DNA [Gahan et al., 2008; Peters and Pretorius, 2011]. Особое внимание уделяется вкДНК после того, как современные методы позволили провести анализ первичной структуры очень маленьких фрагментов ДНК.

Отдельное внимание уделяется совершенствованию методов анализа фрагментов измененной ДНК опухоли, которые циркулируют в крови пациента, или ДНК плода, частицы которой можно обнаружить в крови матери. ВкДНК используется как маркер патологии при аутоиммунных заболеваниях, диабете, травмах, инсультах, инфарктах миокарда и т.д.

Вопросу использования феномена вкДНК в диагностике различных заболеваний посвящено много работ и обзоров (обзор [Tong et al., 2006]). Для того, чтобы понять влияние вкДНК на жизненноважные процессы организма, необходимо изучить свойства вкДНК и характер взаимодействия фрагментов вкДНК с клетками организма.

К свойствам вкДНК относят следующие характеристики: концентрация фрагментов в биожидкости, наличие однонитевых разрывов цепи и длина фрагментов, изменение последовательностей во вкДНК по сравнению с геномной ДНК, модификация функциональных групп ДНК.

1.1.1 Концентрация внеклеточной ДНК в биожидкостях Внеклеточная ДНК является нормальной составляющей крови и может быть обнаружена в плазме крови любого человека. Однако уровень ДНК в образцах плазмы крови здоровых людей довольно низкий. Его оценки сильно различаются в зависимости от способа измерения и выборки доноров.

Обычно значения нижней границы диапазона близки – около 3,6-5 нг/мл [Suzuki et al., 2008], однако в некоторых исследованиях наблюдается существенный разброс данных, например, 1,8-36 нг/мл [Gahan and Stroun, 2010].

На данный момент считается перспективным направлением исследований изучение диагностического значения концентраций вкДНК.

При патологических состояниях концентрация вкДНК, как правило, значительно увеличивается [Umetani et al., 2006; Zhong et al., 2006].

Отмечены колебания концентрации вкДНК при инфарктах. При остром инфаркте концентрация вкДНК значительно растет по сравнению с нормой (от 36,3±23,8 нг/мл до 511±398 нг/мл), и изменение ее концентрации коррелирует с изменениями количества традиционных маркеров инфаркта, например, тропонина. Впрочем, в этом исследовании не учитывался размер поврежденной области, что может объяснить широкий разброс данных.

Концентрация вкДНК может служить хорошим критерием для прогноза отдаленных последствий инфаркта миокарда. По сравнению с контрольной группой (пациенты, не имевшие осложнений), где концентрация составила 475-530 пг/мкл, в группах, где развились осложнения, она была больше: пг/мкл у пациентов с развившейся позднее сердечной недостаточностью;

1000 пг/мкл у пациентов, у которых позже повторился инфаркт; 1350 пг/мкл у пациентов с последующей остановкой сердца и 725 пг/мкл у пациентов, повторно поступивших через 6 месяцев после первой госпитализации [Butt and Swaminathan, 2008].

Что касается онкологических заболеваний, на данный момент измерение концентрации вкДНК в крови не позволяет отличить рак от других заболеваний; однако увеличение ее концентрации однозначно свидетельствует о развитии болезни, а снижение – о выздоровлении или ремиссии [Gahan and Swaminathan, 2008].

Помимо этого, изучалось участие вкДНК в развитии асептического воспаления, например, при интенсивной физической нагрузке. В группе покоя концентрация вкДНК составила 18,01 пг/мкл, после бега на длинную дистанцию она возросла до 334,4 пг/мкл, но уже через два часа упала практически до исходного значения – 30,44 пг/мкл [Butt and Swaminathan, 2008]. Таким образом, даже у здорового человека концентрация вкДНК в крови может существенно колебаться.

Показано также нахождение фетальной вкДНК в плазме материнской крови; однако она меньше по размерам (300 п.н., в то время как материнская 300 п.н.). В настоящее время делаются попытки диагностировать по вкДНК, выделенной из материнской крови, как материнские заболевания (преэклампсия, замедление внутриматочного развития), так и болезни плода (резус-несовместимость, -талассемия).

Производятся попытки с помощью метилированных специфических маркеров фетальной ДНК диагностировать анеуплоидию. Параллельно налаживается технология ранней диагностики пола [Gahan and Swaminathan, 2008].

Таким образом, поиск применения вкДНК крови в диагностике является активно развивающимся направлением. И несмотря на то, что на данный момент большинство оценок носит количественный характер, уже найдены некоторые основные корреляции и делаются попытки качественной диагностики конкретных заболеваний [Gahan and Swaminathan, 2008].

1.1.2 Размеры фрагментов внеклеточной ДНК С самого момента открытия циркулирующей ДНК исследователей интересовал вопрос: насколько она похожа на геномную ДНК по структуре и составу? Ожидалось, что обнаружение каких-либо структурных особенностей вкДНК позволит судить о ее происхождении и роли в организме, а также будет способствовать развитию диагностических технологий.

Было установлено, что вкДНК двухцепочечная и представляет собой фрагменты длиной от 180 до 10 000 н.п. [Anker et al., 1975]. При этом короткие фрагменты преобладают, средняя их длина в образцах крови здоровых людей составляет 176 н.п. [Suzuki et al., 2008].

ГЦ-состав вкДНК также отличает ее от геномной ДНК. ВкДНК значительно обогащена ГЦ-парами, аналогично бактериальной ДНК [Malinovskaya et al., 2010], в особенности 5' и 3'-концы фрагментов [Suzuki et al., 2008]. При этом содержание АТ-богатых последовательностей снижено [Malinovskaya et al., 2010], процент ГЦ-пар составляет примерно 53,7% [Suzuki et al., 2008]. Показано, что при сердечно-сосудистой патологии, при аутоиммунных заболеваниях и при действии внешних источников излучения содержание маркерных ГЦ-последовательностей в составе вкДНК плазмы крови может увеличиваться в несколько раз [Malinovskaya et al., 2010].

Вероятно, это происходит благодаря высокой устойчивости ГЦ-богатых фрагментов к двунитевой фрагментации при накоплении однонитевых разрывов, вносимых нуклеазами крови [Veiko et al., 2010].

В том, что касается сравнения смыслового состава геномной ДНК и вкДНК, мнения авторов расходятся. Исследование вкДНК из крови здоровых людей, проведенное в 2009 году, показало, что соотношение количества всех функциональных элементов генома в вкДНК и геномной ДНК было примерно 1. Это указывает на то, что нуклеом по набору последовательностей в целом отражает геном; наибольший разброс в соотношениях между индивидуальными донорами наблюдался для белоккодирующих последовательностей, нетранслируемых областей и псевдогенов [Beck et al., 2009]. В то же время, секвенирование и RQ-PCR недостоверно показали равную встречаемость в нуклеоме всех частей генома. Это может быть связано как с индивидуальными особенностями транскрипции, так и с различиями в транспорте и выведении отдельных фрагментов вкДНК.

Однако это может свидетельствовать и о целенаправленном характере выделения ДНК в кровь.

Также существует множество данных о том, что онкогенные мутации и амплификации отдельных генов, изменения в области микросателлитов, а также эпигенетические модификации, как, например, метилирование ДНК, могут быть обнаружены в циркулирующей вкДНК. При этом утверждается, что они схожи с таковыми, обнаруживаемыми в опухолевой ткани раковых больных. Это сходство позволяет некоторым авторам предположить, что циркулирующая вкДНК, вероятно, происходит из клеток первичной опухоли [Van der Vaart and Pretorius, 2008].

1.1.3 Модификация оснований внеклеточной ДНК В литературе практически нет информации относительно содержания модифицированных фрагментов в составе вкДНК. Ожидаемо, что в составе вкДНК содержатся окисленные основания ДНК, так как окислительный стресс – явление, часто встречающееся в организме, особенно при патологических состояниях. Наличие фрагментов, содержащих окисленные основания во вкДНК, было показано иммуноферментными методами.

Оказалось, что при ревматоидном артрите в синовиальной жидкости и сыворотке определяются основания окисленной ДНК. Модифицированные основания в составе вкДНК были обнаружены и у здоровых доноров в следовых количествах. Показано, что под действием вкДНК в клетках эндотелия развивается окислительный стресс, образуются двунитевые разрывы ДНК [Ermakov et al., 2011], активируются системы репарации (похожие результаты также получены на лимфоцитах – [Ermakov et al., 2009]), увеличиваются экспрессия эндотелиальной и индуцибельной NOcинтаз и синтез оксида азота (аналогичные данные получены для первичной культуры гранулярных клеток мозжечка крысы – [Efremova et al., 2010]), снижаются активность каталазы и каспазы-3 [Костюк и др., 2010]. Было также обнаружено, что добавление интактной ДНК клеток в среду культивирования эндотелиоцитов в условиях окислительного стресса, вызванного экзогенным действием перекиси водорода, значительно увеличивало окислительный стресс. Этот эффект можно объяснить окислительной модификацией ДНК активными формами кислорода и азота в процессе культивирования клеток в присутствии перекиси водорода и вторичным действием на клетки этой окисленной ДНК, усиливающей окислительный стресс [Veiko et al., 2010].

1.2 Происхождение фрагментов внеклеточной ДНК в организме Происхождение вкДНК является на данный момент одним из самых спорных аспектов ее биологии. До сих пор не существует общепринятой точки зрения по этому вопросу. Отчасти это может быть объяснено противоречивостью получаемых результатов, отчасти – недостаточным количеством исследований в этом направлении.

Многие гипотезы происхождения вкДНК были отметены довольно быстро. Так, предполагалось, что ее источниками могли быть вирусы (вирусы Эпштейна-Барра, гепатита В и т.д.), однако это не объясняло появления вкДНК в крови здоровых людей. В качестве альтернативной гипотезы предлагалась секреция ДНК клетками в ходе терминальной дифференцировки. Но при росте опухоли так же сильно растет концентрация вкДНК, в то время как терминальной дифференцировки не наблюдается [Van der Vaart and Pretorius, 2008]. На данный момент обсуждаются две основные гипотезы: клеточная гибель и целенаправленная секреция.

Гипотеза клеточной гибели предполагает, что вкДНК, обнаруживаемая в крови, образуется в результате распада клеток, погибших в результате некроза или апоптоза [Malinovskaya et al., 2010].

Большая часть авторов склоняются к тому, что источником вкДНК являются именно апоптотические клетки. Это связано с тем, что, как было сказано выше, вкДНК представляет собой фрагменты, аналогичные тем, которые появляются при расщеплении геномной ДНК в ходе апоптоза (т.н.

«нуклеосомная ДНК) [Choi et al., 2005]. Расщепление происходит сначала на большие (50-300 т.н.п.) фрагменты, а затем на олиго- или мононуклеосомы (180-200 н.п.) с помощью эндогенных Ca2+-, Mg2+-зависимых ядерных предположительно, благодаря прочным электростатическим ДНК-гистонным взаимодействиям. На электрофореграмме они выглядят как «нуклеосомная лесенка» («ladder pattern»), и аналогичная картина наблюдается при электрофорезе фракции вкДНК [Butt et al., 2008]. В отличие от апоптоза, при некрозе осуществляется спонтанное, неспецифическое и неполное расщепление ДНК. Показано, что в результате некроза образуются фрагменты размером более 10 т.п.н. [Van der Vaart et al., 2008]. Также последовательностям, что объясняется специфичностью ДНКазы II, действующей при апоптозе.

происхождения вкДНК. Так, например, известно, что большая часть апоптотических тел поглощается соседними клетками и фагоцитами, и ДНК, таким образом, полностью расщепляется на нуклеотиды лизосомальной ДНКазой II. Поэтому существует вероятность, что фрагменты ДНК, высвобожденные из клеток в результате апоптоза, полностью удаляются из межклеточной среды еще до выхода в кровоток. Также показано, что совместное культивирование макрофагов с некротическими клетками приводит к высвобождению ДНК в среду, и этот процесс носит дозозависимый характер. В то же время, кокультивирование с апоптотическими клетками приводит к уменьшению количества вкДНК [Choi et al., 2005].

В рамках второй гипотезы предполагается, что вкДНК может выделяться живыми клетками как нормальная составляющая их метаболизма [Malinovskaya et al., 2010]. Термин «метаболическая ДНК» был введен Stephen Pelc в 1968 году. Используя метод авторадиографии с Н3-тимидином, он показал наличие синтеза ДНК в неделящихся клеточных популяциях (так, например в кардиомиоцитах). Он предположил, что новосинтезированная ДНК играет метаболическую роль, используется для транскрипции, но быстро изнашивается и заменяется новой [Gahan et al., 2008]. Это согласуется с данными других авторов, которые утверждают, что человеческие лимфоциты выделяют ДНК-содержащий комплекс in vitro при стимуляции фитогемаглютинином. Отмечается также, что процесс высвобождения ДНК не связан с клеточной смертью и регулируется гомеостатическими механизмами [Anker et al., 1975; Rogers et al., 1972]. Даже при отсутствии гибели клеток в культуре, вкДНК обнаруживается в среде культивирования. Также отмечено, что лимфоциты в культуре выделяют вкДНК до тех пор, пока ее концентрация не достигнет некоторого порога, вне зависимости от длительности инкубации. Эта ДНК преимущественно новосинтезированная. Также было показано, что электрофореграмма этой секретируемой вкДНК похожа на апоптотическую ДНК [Van der Vaart et al., 2008].

Целенаправленная секреция характерна для делящихся и покоящихся клеток, но не для мертвых или умирающих. Она была показана для нормальных и патологических клеток бактерий, растений, амфибий, птиц, приматов и даже человека [Gahan et al., 2008]. Более того, на многочисленных объектах (растения, сперматозоиды животных, клетки млекопитающих) был показан следующий эффект: при длительном охлаждении часть ДНК теряется, однако она восстанавливается при возвращении к оптимальной температуре. Полагают, что эта лабильная фракция ДНК и является истинной метаболической ДНК [Gahan et al., 2008].

Таким образом, для лабильной фракции ДНК характерны следующие признаки: а) она синтезируется как в пролиферирующих, так и в дифференцированных клеточных популяциях; б) в обоих типах популяций ее количество изменчиво; в) она имеет меньший молекулярный вес, чем стабильная фракция (3-5 х 105 дальтон); г) ее синтез сопряжен с различными метаболическими процессами, характерными для данной ткани [Gahan et al., 2008].

На данный момент остается вероятным, что оба процесса (как гибель клеток, так и целенаправленная секреция) вносят определенный вклад в формирование общего пула вкДНК.

ДНК может присутствовать в крови как в растворе, так и в связанном виде. Структуры, с которыми она связана, относятся к гистоновым, везикулярным или ассоциированным с другими макромолекулярными комплексами.

Фрагментированная на нуклеосомы ДНК часто присутствует в ядрах нормальных клеток. В последнее время растет количество данных о том, что гистоны могут проходить сквозь плазматические мембраны и могут быть обнаружены в различных клеточных органеллах. Эта способность взаимодействиями; она может быть по-разному выражена у разных гистонов.

Следовательно, гистоны можно рассматривать как комплексы, участвующие в транспорте ДНК. Помимо этого, обнаружены корреляции между транспортировки ДНК с помощью гистонов.

Везикулярные ДНК-содержащие структуры можно разделить на три группы: апоптотические тельца, микрочастицы и экзосомы. Микрочастицы отделяются в ходе апоптоза, в процессе формирования апоптотических телец. Экзосомы образуются в результате слияния плазматической мембраны с внутриклеточными везикулами. Была прослежена их миграция в кровотоке на длительные расстояния; они были также обнаружены и в других жидкостях, как моча и спинномозговая жидкость. Сигнализация через экзосомы осуществляется посредством их слияния с другими клетками и передачи таким образом их содержимого. Показано нахождение в них мРНК и микроРНК, некоторые авторы также утверждают, что в них может находиться и ДНК. Однако существует мнение, кто вклад экзосомной ДНК в общее количество вкДНК незначителен по сравнению с некротической и апоптотической.

макромолекулярных комплексов. Так, многими авторами было показано регулируемое высвобождение новосинтезированного ДНК-РНКлипопротеинового комплекса, содержащего также ДНК-зависимые ДНК- и РНК-полимеразы [Gahan et al., 2008]. Этот комплекс назвали виртосомой.

Также было показано, что этот комплекс выделяется целиком как делящимися, так и дифференцированными клетками. ДНК в составе виртосом двухцепочечная и схожа с геномной ДНК. Ее размеры – 450- п.н. На культуре лимфоцитов было показано, что виртосомы выделяются до культивирования; дальше выделение прекращается. Предполагают существование двух механизмов поддержания постоянной концентрации: а) наличие обратной связи, с помощью которой клетка «узнает» о концентрации виртосомной ДНК в среде; б) существование баланса между секрецией виртосом клетками и их поглощением соседями [Gahan et al., 2010].

комплексами предполагает также ассоциацию с определенными ферментами (полимеразами). Это делает вероятным существование внеклеточного синтеза ДНК. Однако на данный момент не высказано никаких конкретных предположений о его механизмах и функциях. Тем не менее, некоторые данные подтверждают его наличие, например, с помощью включения во вкДНК меченых нуклеотидов [Anker et al., 1975].

И, наконец, вкДНК была обнаружена связанной с поверхностью клеток крови; полагают, что она находится в процессе проникновения внутрь.

Однако учитывая гипотезу активной секреции, можно предположить, что ДНК на поверхности клеток является их секретом [Gahan and Swaminathan, 2008]. Однако существует гипотеза о том, что эндогенная ДНК на поверхности клеток защищает их от действия экзогенной ДНК, блокируя большую часть сайтов связывания. ДНК связывается с большим количеством белков, однако аффинность этих взаимодействий низкая; никакой специфичности в последовательностях до сих пор выявить не удалось [Mal’shakova et al., 2008].

Таким образом, вкДНК может присутствовать в крови в разных формах. До сих пор неизвестно, какая из форм преобладает и как это соотношение регулируется. Однако наличие большого количества вкДНКсвязанных частиц и комплексов затрудняет процесс определения истинной концентрации вкДНК в крови. Помимо этого, усложняются методики выделения вкДНК в связи с необходимостью очищать ее от примесей или, напротив, сохранять исходную конформацию. И, наконец, неизвестно, какая из форм является актуально действующей и насколько примеси во фракции вкДНК модулируют ее эффект. Все эти вопросы требуют дальнейшего решения и новых исследований.

1.4 Взаимодействие внеклеточной ДНК с клетками В начале 70-х годов прошлого века выяснено, что фрагменты ДНК взаимодействуют с поверхностью клеток и способны проникать внутрь клетки. Позднее было показано, что вкДНК практически полностью связывается с поверхностью клетки и возможно ее десорбировать путем обработки растворами трипсина или ЭДТА. Обнаружено, что при онкологической патологии значительно увеличивается концентрация вкДНК в плазме крови. При изучении в опытах in vitro взаимодействия вкДНК, десорбированной с клеточной поверхности, и меченой ДНК фага лямбда с клетками крови выявлено, что вкДНК и ДНК фага образуют прочные комплексы с клеточной мембраной (константа диссоциации для ДНК фага М, 10-8М).

попадают внутрь клетки и распадаются до олигонуклеотидов, ингибитором данного процесса является циклогексимид. Впервые высказано предположение, что на клеточной поверхности присутствуют рецепторы, которые способны к образованию комплексов с вкДНК и способствуют ее эндоцитозу и авторами был выделен ДНК-связывающий белок с молекулярной массой 30 кДа. Ученые предположили, что вкДНК, десорбированная с клеточной поверхности, содержит в своем составе гораздо больше ГЦ – пар, чем ядерная ДНК [Siess et al., 2004].

За последнее время были идентифицированы и выделены многие белки, которые могли бы связываться с вкДНК. В большинстве случаев это комплексообразованию с ДНК на клеточной поверхности. В качестве лигандов для ДНК-связывающихся белков клеточной мембраны во многих работах использовались олигонуклеотиды с разной последовательностью и их активированные производные. Большой интерес вызывает работа [Siess et al., 2004], авторы которой идентифицировали новый белок массой 130 кДа, находящийся на поверхности клеточной мембраны и способный связывать вкДНК (MNAB - membrane-associated nucleic acid-binding protein). Ген данного белка находится на 9 хромосоме и экспрессируется как в здоровых, так и в раковых клетках.

1.4.1 Белки семейства «toll-like» рецепторов (TLR) Существенные изменения свойств вкДНК в сравнении с яДНК, прежде всего, накопление в составе вкДНК ГЦ – богатых последовательностей, в частности, ТОрДНК, способствует предположению, что в эндоцитозе и в связывании фрагментов вкДНК принимают участие белки, которые входят в семейство «toll-like» рецепторов (TLR). Белки данного семейства играют важную роль в запуске ответа врожденной и приобретенной иммунной системы организма на патогены. Первой на вторжение патогенов реагирует врожденная иммунная система. Сигнал опасности исходит от молекул патогенов - «молекулярные паттерны» - PAMP (pathogen-associated molecular pattern). Способность организма бороться с опасными патогенными микроорганизмами и вирусами заключается в активации TLR при контакте с PAMP различного происхождения. Сбои в системе регуляции активации TLR могут приводить к развитию многих заболеваний, включая рак, астму и атеросклероз.

У человека гены TLR локализованы на хромосомах 1,3,4,9 и Х (рис.1).

Рисунок 1. Схема локализации рецепторов TLR на клеточной мембране и внутри клетки (Majewska M. et al., 2006).

Рецепторы TLR можно условно разделить на три класса:

1 - распознающие липиды (TLR 1,2,4,6 и 10);

2 - распознающие белковые лиганды (TLR5 и TLR11);

3 – распознающие лиганды вирусной природы TLR (TLR3,7,8, и 9).

TLR3 распознает двунитевые РНК, которые продуцируют многие вирусы при репликации. Однонитевую РНК вируса, а также синтетический аналог гуанозина распознают TLR7 и TLR8. TLR9 взаимодействует с ДНК поверхности клеточной мембраны (TLR 1, 2, 4, 5, 6). Рецепторы, идентификация лигандов и активация соответствующих сигнальных путей [Tobias et al., 2005].

Анализируя природу PAMP, активирующих рецепторы TLR, мы пришли к выводу, что ГЦ - богатые фрагменты вкДНК, которые накапливаются в биожидкости человека в норме и, особенно, при патологии, могут распознаваться белком TLR9, в связи с этим, данному рецептору мы уделили пристальное внимание.

В основном TLR9 экспрессируется тканями, принимающими участие в иммунном ответе организма, такими как: лимфоузлы, костный мозг, кератиноцитами [Andersen et al., 2006; Lebre et al., 2006], клетками бронхиального эпителия [Mayer et al., 2007], кардиомиоцитами [Boyd et al., 2006] и стволовыми клетками. Также, линией клеток 3T3-F442A было доказано, что TLR9 экспрессируется и адипоцитами [Khazen et al., 2007].

В 1990-х годах американскими исследователями во главе с A. Krieg, обнаружена взаимосвязь между иммуностимулирующим действием ДНК на B - клетки и присутствием в ДНК мотивов, содержащих неметилированные ГЦ-динуклеотиды [Krieg et al., 1995]. Иммуностимулирующую активность бактериальной ДНК обусловливает присутствие в ее составе неметилированных ГЦ-мотивов, в отличие от геномной ДНК позвоночных, которая содержит значительно меньше неметилированных ГЦдинуклеотидов. ДНК или синтетические олигонуклеотиды, обогащенные неметилированными ГЦ-мотивами, и обладающие выраженным стимулирующим действием на иммунную систему, принято называть иммуностимулирующими ГЦ-ДНК.

Также, несомненно, в роли лигандов для TLR9 могут выступать отдельные фрагменты вкДНК человека. При анализе последовательностей ТОрДНК выяснилось, что встречаемость ГЦ - повторов близка к бактериальной ДНК, тогда как количество ГЦ - повторов в геномной ДНК млекопитающих в 20 раз ниже, чем в последовательности ТОрДНК.

Большинство ГЦ-повторов в ТОрДНК человека не метилировано. В пределах фрагмента ТОрДНК рибосомного повтора, содержащего 13 314 п.н., приходятся суммарно более ста мотивов TCGTCG и GTCGTT [Krieg et al., 1995], которые обеспечивают связывание ДНК с TLR9. Например, при анализе последовательностей ДНК в области нетранскрибируемого спейсера, которые по ГЦ-составу похожи на геномную ДНК, на 30 т.п.н. встречается около 30 аналогичных мотивов. Следовательно, ТОрДНК по составу повторяющихся последовательностей напоминает бактериальную ДНК, она обогащена ГЦ – повторами, способными взаимодействовать с TLR9. Кроме транскрибируемой области рДНК в составе геномной ДНК человека встречаются еще ГЦ – обогащенные неметилированные последовательности.

К примеру, промоторная область многих генов включает неметилированные «ГЦ – островки» (они состоят в среднем из 1 т.п.о.), свойства которых сходны с ТОрДНК и они, возможно, накапливаются во вкДНК.

1.5 TLR9-сигнальный путь и связанные с ним NF-kB-, JNK/p38-, IRFсигнальные пути TLR9 – это гликопротеидный трансмембранный рецептор I типа. У человека TLR9 включает в себя 1 032 аминокислоты. На N–конце полипептидной цепи содержится сигнальный пептид (остатки 1-25), это внеклеточный высоковариабельный фрагмент, который содержит повторы, полипептидная цепь включает трансмембранный домен (остатки 819-836) и фрагмент, находящийся внутри клетки и содержащий высококонсервативную TIR (Toll-Interleukin (IL)-1 resistance) область. Именно TIR фрагмент отвечает на действие молекул сигнальных путей. Данный участок содержит сто пятьдесят аминокислот и включает три высококонсервативных домена.

Инициация передачи сигнала через TLR9 происходит только при образовании комплекса белка TLR9 с ГЦ - ДНК.

Одним из важных моментов в активации рецепторов, находящихся в эндосомах клетки (такие как TLR3, TLR7, TLR8 и TLR9), является перемещение лигандов из внеклеточного пространства в эндосомы посредством эндоцитоза, либо совместно с вирусной инфекцией [Wagner et al., 2006]. К примеру, обработка in vitro ГЦ - олигонуклеотидами активирует TLR9-позитивные макрофаги и дендритные клетки. Стимулирующая активность теряется, когда цитозиновые остатки в олигонуклеотидах метилируются, либо инвертирован внутренний динуклеотид с CG на GC [Krieg, 2002]. Однако если данные олигонуклеотиды заключить внутрь липосом, которые способствуют сохранению комплекса лиганда с TLR9 и стимулируют эндосомальную транслокацию, то снова наблюдается индукция синтеза цитокинов, опосредуемая TLR9 [Yasuda et al., 2005; Wagner et al., 2006].

Во время образования комплекса внешнего фрагмента TLR, имеющего вид подковы, с лигандом, остальная часть молекулы белка подвергается изменениям, которые ведут к активации пути передачи сигнала от периферии клетки к ядру. Домены белков TLR, локализованные внутри клетки, взаимодействуют только со свойственными именно им адаптерными белками. Сигнал к ядру клетки от периферии, передающийся посредством TLR, осуществляется при участии четырех адаптеров. Они включают последовательности, подобные TIR домену [Vogel et al., 2003] (рис. 2).

Рисунок 2. Адаптеры, содержащие TIR область у млекопитающих Death, Мyr, Sam - терминальные домены адаптерных молекул. (Vogel et al., 2003).

На схеме перечислены адаптерные молекулы в порядке их открытия:

MyD88 (myeloid differentiation factor 88) дифференцировки 88; TIRAP (TIR domain-containing adapter protein) – адаптерный белок, включающий TIR домен, иначе называемый Mal (MyD adapter-like) - MyD88-адаптер подобный белок; TRIF (TIR domain-containing adapter inducing interferon (IFN)-I) - адаптерный белок, включающий TIR домен, индуцирующий синтез интерферона I, или TICAM-1 (TIR domaincontaining adapter molecule-1) и TIRP (TIR-containing protein), или TRAM (TRIF-related adapter molecule), или TICAM-2 [Vogel et al., 2003].

Активируется MyD88 после взаимодействия рецептора с C-концевым TIR доменом и способствует передаче сигнала через DD домен (death domain) киназам семейства IRAK (IL-1R-associated kinase) на N-конце (рис.3). Многие TLR-зависимые ответы клеток врожденного иммунитета зависят от MyD88.

Однако нокаутные мыши по MyD88 (MyD88 knockout mice) демонстрируют сохранение эффекта активации TLR3 и TLR4, что говорит о существовании не зависимых от MyD88 путей передачи сигнала, несмотря на то, что у данных мышей клеточный ответ на CpG -ДНК через TLR9 остался полностью зависимым от MyD88 [Vogel et al., 2003]. Предположение о существовании как MyD88-зависимого, так и MyD88-независимого путей передачи сигнала подтвердили последующие работы.

TIRAP/Mal обладает C-терминальным TIR доменом, однако у него отсутствует N-терминальный домен DD. Обнаружено, что при передаче сигнала TIRAP/Mal и MyD88 взаимодействуют друг с другом [Fitzgerald et al., 2001; Majewska et al., 2006], но в то же время, показано, что при передаче сигнала посредством рецепторов TLR5, 7, 8 и 9 TIRAP/Mal участия не принимает.

Активация TRIF/TICAM-1, имеет место при передаче сигналов при участии рецепторов TLR3 и TLR4 [Hoebe et al., 2003; Oshiumi et al., 2003;

Yamamoto et al., 2002]. TRIF/TICAM-1 – является более крупным белком в сравнении с MyD88 и TIRAP/Mal, он включает в состав 712 аминокислот, тогда как MyD88 - 296, и TIRAP/Mal включает в себя 235 аминокислот.

TRIF/TICAM-1 приводит к активации NF-kB, но только активация TRIF/TICAM-1, в отличие от MyD88 или TIRAP/Mal, заканчивается экспрессией генов рецепторов ИФН типа I [Barchet et al., 2005; Li et al., 2005;

Seya et al., 2005]. Обнаружено, что TRIF является обязательным для активации независимых от MyD88 путей передачи сигнала посредством TLR3 и TLR4 [Yamamoto et al., 2002; Basu et al., 2003; Jiang et al., 2003].

TRAM/TIRP/TICAM- гомологичной TRIF/TICAM-1. TRAM/TIRP/TICAM-2 взаимодействует c TLR4, TIRAP и TRIF, однако не способен связываться с TLR3 [Bin et al., 2003; Fitzgerald et al., 2003; Oshium et al., 2003].

Среди разных TLR используются вариации перечисленных адаптеров [Vogel et al., 2003; Akira et al., 2004; Palsson-McDermott et al., 2004]. После активации рецепторов внутриклеточная передача сигнала ведет за собой комплексообразование TIR домена с несколькими внутриклеточными адаптерами передачи сигнала [Tobias et al., 2005] (рис. 3).

Рисунок 3. Путь передачи сигналов определенный для каждого TLR, ассоциированный между человеческими TLR и соответствующими адаптерами [Seya et al., 2005; Tobias et al., 2005].

Вероятно, что три адаптера используются не всеми TLR: TRIF, TRAM и Mal/ TIRAP/ TICAM-2. MyD88, четвертый, используется всеми TLR, исключая TLR3. Комбинация взаимодействия различных TLR с различными адаптерными молекулами активирует каскад киназ, что в конечном счете, ведет к активации комплекса определенных генов [Vogel et al., 2003].

MyD88 играет ключевую роль при прохождении сигнала через TLR при действии ГЦ- ДНК [Janssens et al., 2002; Tobias et al., 2005; Seya et al., 2005] (рис. 4). При активации TLR9 лигандом, MyD88 в комплексе с остальными адаптерами, типа Маl, действует на киназы семейства IRAK (ILR-ассоциированных серин/треониновых протеинкиназ). В комплексе IRAK 1 ассоциирован с Toll-интерактивным белком (Tollip), MyD88, и TRAF (фактор некроза опухоли фактор 6). Фосфорилирование IRAK 4 инициирует Рисунок 4. Сигнальные пути, активирующиеся при проведении сигнала через TLR9. MyD88 (myeloid differentiation factor 88 - миелоидный фактор дифференцировки 88) – адаптерная молекула, которая используется TLR для проведения сигнала; IRAK (IL-1R-associated kinase) и TRAF6 (TNF receptor-associated factor 6) – киназный комплекс; (IRF-7 – interferon regulatory factor7) – регулирующий фактор транскрипционную активность гена интерферона; IKK-комплекс – IкB киназный комплекс, состоящий из трех субъединиц, включая киназы IKK-, IKK-, IKK-. Неактивная форма NF-kB взаимодействует с гетеродимерами р50 и р65. При активации NF-kB происходит отщепление ингибитора и перемещение из цитоплазмы в ядро гетеродимера, состоящего из субъединиц р50 и р65 [Tobias et al., 2005; Seya et al., 2005].

фосфорилирование IRAK 1 с последующей диссоциацией киназного комплекса, но в тоже время с сохранением его связи с TRAF6 [Miggin1 et al., 2006]. Это приводит к активации TRAF6, сопровождаемой активацией и формированием сложного комплекса TAK1/TAB1/TAB2/TAB3 (TGF betaActivated Kinase 1/TAK1-binding protein 1/2/3).

Активный комплекс TAK1/TAB, запускает последующую активацию IKK комплекса, который состоит из IKK-, IKK-, IKK- (регуляторных субъединиц - модуляторов, катализирующих фосфорилирование) [Fitzgerald et al., 2003]. Далее следует разделение в димерном комплексе IKK-/ IKK- с участием протеосомного пути (рис. 4), с последующей активацией IkB и транслокация NF-В в ядро, далее и активируется каскад MAPК (mitogenactivated protein kinase) – митоген-активированные протеинкиназы [Sharma et al., 2003; Li et al., 2013].

NF-B (nuclear factor kappa-light-chain-enhancer of activated B cells) – ядерный фактор «каппа-би», это универсальный фактор транскрипции, контролирующий экспрессию генов иммунного ответа, апоптоза и клеточного цикла. Он получил свое название из-за участия в регуляции экспрессии гена легкой цепи иммуноглобулина в В-клетках. В семействе NF-B находятся пять видов белков: NF-B1 (p50), NF-B2 (p52), RelA (p65), RelB и c-Rel, которые образуют 15 комбинаций димеров. У всех белков семейства есть общий домен гомологии Rel, необходимый для образования белковых димеров, связывания ДНК с NF-B, а также для связывания с IkB цитозольный ингибиторный белок. Активная форма NF-B проявляется только в форме димера, наиболее распространённой формой является димер субъединиц p50 или p52 с субъединицей p65 [Fusco et al., 2009; Wier et al., 2012]. В цитоплазме субъединицы NF-B находятся в неактивном состоянии в комплексе с ингибиторным белком IkB. Активация NF-B обусловлена различными стимулами, включающими B- и T-клеточные митогены, цитокины (например TNF и IL1), продукты бактериальной и вирусной природы (лиганды рецепторов семейства TLR, например двухцепочечная РНК вируса или липополисахарид) и факторы стресса (активная форма кислорода или ультрафиолет). Стимулирующий фактор запускает фосфорилирование IkB при действии киназы IKK (IkB-киназа), что ведет к деградации IkB под действием протеосомы 26S. Вследствие чего NF-kB освобождается из ингибирующего комплекса, перемещается в ядро и активирует транскрипцию контролируемых генов. NF-kB – это важная составляющая большинства сигнальных путей, активация которых ведет к быстрой индукции цитокинов, являющихся основными участниками регуляции воспалительного процесса, неспецифических и специфических механизмов защиты [Akira et al, 2003; Bonizzi et al, 2004]. Блокировать способность NF-B связываться с ДНК и запускать транскрипцию генов может GR (англ. Glutathione reductase; глутатионредуктаза), взаимодействуя субъединицами NF-B. Также в подавлении активности NF-B может участвовать негативная регуляция посредством МАР-киназного сигнального пути, который ингибирует IKK-киназы, принимающие участие в активации NF-B [Hayashi et al, 2001; Hayden et al, 2008]. Помимо этого глюкокортикоиды вызывают увеличение экспрессии белка IkB, являющегося ингибитором NF-B, что ведет к стабилизации, тем самым препятсвуя перемещению NF-B в ядро.

Классический NF-B сигнальный путь является важной составляющей системы координирования экспрессии множества генов врожденной иммунной системы и воспаления, способствуя выживаемости клеток иммунитета при различных инфекциях или при острых воспалительных процессах [Palmer et al, 2008].

Активность MAPK обеспечивается киназами MAPK, MAP2K и MAP3K, посредством последовательного фосфорилирования белка, что ведет к активации p38 MAPK и киназы JNK (c-Jun N-terminal kinase) [Guillot et al., 2006], которые индуцируют представителей других классов факторов транскрипции – АР -1 (активирующий протеин 1) и Elk-1В [Beutler et al., 2002] (рис. 5).

Рисунок 5. Молекулярный каскад, запускаемый с рецепторов TLR в ходе иммунного ответа. IKK - IкB киназа; IRAK - IL-1 рецептор-ассоциированная киназа интерлейкина 1; MKK - митоген-активированная киназа; P фосфат.

JNK (c-Jun N-концевые киназы) - стресс-активируемые протеинкиназы (SAPK), которые принимают участие в ответ на действие цитокинов, ультрафиолетового облучения, теплового и осмотического шока, в дифференцировке и апоптозе Т-лимфоцитов. Впервые киназы идентифицированы по связыванию и фосфорилированию серина 63 и серина 73 траскрипционно-активационного домена белка c-Jun, входящего в состав транскрипционного фактора AP-1(активирующий протеин 1). JNK относится к семейству митоген - активируемых серин/треониновых протеинкиназ (поэтому JNK также называются MAPK8, MAPK9, MAPK10).

JNK киназы происходят из 3 генов JNK1, JNK2 и JNK3 и имеют изоформ. JNK1 и JNK2 встречаются во всех клетках и тканях, тогда как JNK находится в основном в мозге, и в небольших количествах в сердце.

JNK посредством фосфорилирования модифицируют активность некоторых белков, находящихся в митохондриях или в ядре. Таким образом JNK участвуют в регуляции различных функций клетки. JNK киназы могут регулировать воспаление, уровень активных форм кислорода (АФК) и различные стрессовые факторы.

В результате активации p38 MAPK и киназы JNK транскрипционный фактор NF-B освобождается из ингибирующего комплекса и перемещается в ядро, что ведет к экспрессии NO-синтазы, генов цитокинов и других регуляторных факторов воспаления [Kawai et al., 2006]. Вместе с тем, при активации TRAF и IRAK может быть инициирован выброс ИФН-альфа как следствие активации IRF-7 [Kawai et al., 2006].

В результате активируются все основные клеточные функции, связанные с представлением антигенов и развитием фагоцитоза, продукция активных форм кислорода, синтезируются низкомолекулярные медиаторы воспаления и провоспалительные цитокины, включающие интерлейкины: IL-1, IL-6, IL-8, интерфероны I типа, фактор некроза опухоли, хемокины [Kawai et al., 2006; Windheim et al., 2008; Papantonis et al., 2012].

Также активируются цитокины, стимулирующие дифференцировку Тh лимфоцитов – интерлейкины: IL-12, IL-23, IL-27 [Akira et al., 2004; Kawai et al., 2006], что представляет собой своеобразный мостик к развитию специфической иммунной системы, которая распознает антигенные структуры микроорганизмов.

Адаптер TIRAP/Mal в отличие MyD88 связывается с другими областями TIR, но действует как MyD88, вступая во взаимодействия с IRAK1, IRAK4 и TRAF6 [McGettrick et al., 2004]. Участие адаптера TIRAP/Mal обуславливает активацию факторов транскрипции NF-B, но которая блокируется экспрессией TIR MyD88, IB суперрепрессором NF-B и IRF (интерферон-регулирующими факторами) [Vogel et al., 2003].

В передаче сигнала, связанного с адаптерной молекулой TRIF/TICAMучаствует TANK (TRAF-ассоциированный с активатором NF-B)связанная киназа-1 мишенью которой являются факторы транскрипции IRF [Hemmi et al., 2004; Sun et al., 2004], поэтому экспрессия TRIF/TICAM-1 приводит к обычной активации ядерного фактора NF-B и к экспрессии IRF-3, IRF-7 [Hardy et al., 2004].

связанным с молекулярным адаптером TRAM, происходит быстрая активация фактора транскрипции IRF-3 и отсроченная индукция NF-B [Yamamoto et al., 2003].

Молекулярные адаптеры TRAM, TRIF, активируя фактор транскрипции IRF-3, активации нормальной Т-клеточной экспрессии и секреции - RANTES) [Vogel et al., 2003]. MyD88 - независимый путь передачи сигнала, также активирует фактор транскрипции IRF-7 [Meylan et al., 2004].

Конечным событием активации TLR –зависимых сигнальных путей в клетке является продукция цитокинов [Veiko et al., 2000; Yao et al., 2009].

клетками, осуществляющие регуляцию взаимодействий на клеточном и межсистемном уровнях. Они стимулируют или ингибируют рост клеток, их дифференцировку, влияют на выживаемость клеток, действуют на функциональную активность и апоптоз клеток. Цитокины играют важную роль в развитии иммунного ответа в организме, обеспечивая взаимодействие между разными иммунокомпетентными клетками, также могут выступать в роли эффекторных молекул иммунных реакций. К цитокинам относятся:

интерлейкины, интерфероны, монокины, факторы некроза опухоли (ФНО), хемокины.

Впервые цитокины были обнаружены в середине 1960-х годов в супернатанте культуры лимфоцитов. Выяснилось, что добавление супернатанта из одной культуры лимфоцитов в другую способно оказывать влияние на процессы метаболизма, созревания, пролиферации, и дифференцировки клеток.

Цитокины обладают невысокой молекулярной массой 30 кД, в крови содержатся в незначительных концентрациях. Они вместе с клеткамипродуцентами и клетками-акцепторами формируют единую сеть, которая регулирует и контролирует взаимодействия между клетками как лимфомиелоидного комплекса, так и клетками других систем организма.

Главные реакции цитокинов среди множества биологических эффектов, являются иммунные реакции, воспалительный ответ, регуляция гемопоэза, репаративные процессы в тканях. Их действие на клетки организма является антиген-неспецифическим, они способны воздействовать на любые клетки, содержащие соответствующие рецепторы.

По механизму действия все цитокины можно разделить на следующие группы:

- провоспалительные, отвечающие за мобилизацию воспалительного ответа (интерлейкины 1,2,6,8, ФНО, интерферон );

противовоспалительные, сдерживающие развитие воспаления интерлейкины 4,10, ТФР);

- регуляторы гуморального и клеточного иммунитета — обладают цитотоксическими) [Симбирцев, 2004].

Продукция провоспалительных цитокинов приводит к формированию очага острого воспаления. Основными продуцентами провоспалительных цитокинов выступают лимфоциты, моноциты, макрофаги, основными индукторами обычно выступают инфекционные агенты (например, липополисахарид бактерий), а также факторы воспаления (сами провоспалительные цитокины). Все эффекты, опосредуемые цитокинами, реализуются посредством связывания их со специфическими рецепторами, представленными на многих типах клеток.

показали, что их мишенями могут служить практически все органы и ткани, и они способны индуцировать не менее 50 различных биологических эффектов. При внедрении патогена продукция ИЛ-1, ИЛ-6, ИЛ-8, ФНО микроорганизмами, таким образом первые проявления биологического действия цитокинов сводятся к активации местных защитных механизмов. За счет экспрессии своих собственных рецепторов в локальный воспалительный процесс быстро вовлекаются многие типы клеток, включая эндотелиоциты, фибробласты, все типы лейкоцитов. Цитокины повышают проницаемость кровеносных сосудов и обеспечивают направленную миграцию клеток в зону проникновения патогенов. Это происходит в результате повышения экспрессии на эндотелиальных клетках адгезинов под влиянием ИЛ-1, ФНО, а также этих молекул на лейкоцитах крови.

Одной из важных функций цитокинов в очаге воспаления является усиление фагоцитарной активности клеток и их микробицидных свойств.

макрофагов, нейтрофилов. ФНО, ИНФ – индуцируют образование в нейтрофилах и макрофагах супероксидных форм кислорода, оксида азота и гипохлорной кислоты, которые обладают сильными антимикробными свойствами. Одна из ролей цитокинов в очаге воспаления связана с их возможностью продливать срок жизни клеток. Установлено, что ИЛ-1, ИНФ, ИЛ-2 способны предотвращать апоптоз нейтрофилов и макрофагов, а будучи добавлены в культуральную среду этих клеток, удлиняют их жизнь в 2-3 раза. ИЛ-1, ИЛ-6, ФНО являются индукторами лимфоцитов, они способны активировать Т-, В-, НК-лимфоциты, способствовать их созреванию в эффекторные клетки иммунного ответа (Т-киллеры, плазматические клетки), стимулировать синтез специфических ростовых факторов для иммунокомпетентных клеток.

ФНО синтезируется преимущественно моноцитами, макрофагами и тучными клетками. Благодаря способности этого белка вызывать быструю некротическую регрессию некоторых опухолей, он получил название фактора некроза опухоли. Основным индуктором выработки ФНО являются грамотрицательные бактерии, компонент их клеточной стенки ЛПС.

Усиливается секреция ФНО под влиянием ИНФ-гамма, продуцируемого Тнклетками. ФНО способен стимулировать активность лейкоцитов, участвующих в воспалении, стимулирует продукцию цитокинов – ИЛ-1, ИЛповышать экспрессию молекул адгезии на эндотелиальных клетках сосудов, что способствует повышенному прилипанию нейтрофилов, моноцитов и лимфоцитов к поверхности этих клеток, усиливает экспрессию молекул ГКГ на клетках, что способствует развитию клеточного иммунитета и цитолиза пораженных клеток [Wang et al., 2013]. ФНО активирует систему свертывания крови, увеличивая синтез сывороточных белков в печени, способен подавлять деление стволовых клеток костного мозга.

Контроль над эффектами провоспалительных цитокинов осуществляют противовоспалительные цитокины – ИЛ-4, ИЛ-10, ИЛ-13, ТФР. Они способны индуцировать синтез рецепторных антагонистов интерлейкинов (РАИЛ), подавлять транскрипцию генов провоспалительных цитокинов в клетках-продуцентах, усиливать образование растворимых рецепторов и посредством down-регуляции снижать плотность провоспалительных рецепторов на клетках. Так, ИЛ-4 и ИЛ-10 в моноцитах и макрофагах блокирует образование ИЛ-1, ИЛ-6, ИЛ-8, подавляют продукцию ПГЕ2, супероксидных и нитроксидных радикалов. ФНО в лимфоцитах ингибирует синтез ИЛ-2, ИНФ. Кроме того, ИЛ-10 угнетает антигенпредставляющую функцию АПК, активирует продукцию РАИЛ, снижает экспрессию на Тлимфоцитах ТКР и ИЛ-2Р, реакцию гиперчувствительности замедленного типа. ТФР обладает способностью подавлять пролиферативную и функциональную активность Т-лимфоцитов и НК-клеток.

цитокинам и вырабатывается Тн2 и Тн3-клетками. ИЛ-10 способен угнетать активацию и эффекторные функции Т-клеток, НК-клеток, моноцитов и макрофагов и продукцию этими клетками ряда цитокинов, в частности ИЛФНО, в том числе и провоспалительных цитокинов ИЛ-1, ФНО, ИНФ [Sun et al., 2012].

провоспалительными и противовоспалительными цитокинами является важным моментом в регуляции иммунного ответа организма, и от него во многом зависит характер течения болезни и ее исход. Цитокиновый дисбаланс является основой для развития хронических воспалительных заболеваний, кроме того, баланс цитокинов в воспалительный период определяет форму иммунного ответа, будет ли это преимущественно клеточный или гуморальный иммунный ответ.

выделенной из биожидкостей организма, значительно отличаются от свойств геномной ДНК. Показано, что в составе вкДНК накапливаются ГЦ-богатые последовательности генома. Отмечено, что концентрация вкДНК значительно повышается при патологических состояниях и может быть использована в качестве количественного маркера гибели клеток в организме. Но как изменение свойств, в частности накопление ГЦ-богатых последовательностей в составе вкДНК, может повлиять на клетки организма.

организма, реализуемое посредством взаимодействия с рецепторами TLR9.

Однако, эксперименты проводились с использованием вирусной и бактериальной ДНК, а также синтетических олигонуклеотидов. Геномная ДНК не оказывает стимулирующее или подавляющее действие на клетки организма, но данный вывод был сделан при исследовании ДНК, которая была выделенна из клеточных ядер. Анализ литературы показал, что на данный момент нет работ, анализировавших действие вкДНК или отдельных ее фрагментов, выделенных из организма, на клетки.

Таким образом, на данный момент накоплено большое количество данных о структуре, методах обнаружения и происхождении внеклеточной ДНК. В то же время, многие вопросы до сих пор остаются нерешенными, в том числе и механизмы ее влияния на клетки и возможные последствия такого воздействия.

Дальнейшие исследования эффектов, производимых действием вкДНК на клетки, позволит приблизиться к решению вопроса о ее функциях в взаимодействия между клетками, но и поможет грамотнее подходить к проблеме диагностического и, возможно, терапевтического ее применения.

2 МАТЕРИАЛЫ И МЕТОДЫ

2.1 Выделение и культивирование мезенхимальных стволовых Мультипотентные стволовые клетки могут быть обнаружены во многих тканях, в том числе и в любой мезенхимальной ткани [Azzam et al., 2003]. Мезенхимальные стволовые клетки (МСК) обладают способностью под действием специфических индукторов давать начало мезодермальным клеточным линиям, поддерживать и регулировать гемопоэз, поддерживать гомеостаз в пределах ниши стволовых клеток, а также участвовать в репарации поврежденных тканей [Pevsner-Fischer et al., 2007].

Легко доступными для выделения МСК являются три ткани: строма костного мозга, мезенхима пуповинного канатика и строма жировой ткани.

Существуют литературные данные о том, что МСК, полученные из этих тканей, одинаковы по следующим характеристикам: фибробластоподобная морфология, иммунный фенотип, успешность выделения, частота образования колоний и дифференцировочный потенциал. В то же время, процедура получения МСК из жировой ткани гораздо проще и менее болезненна, чем из костного мозга. Помимо этого, количество МСК в 1г жировой ткани в 500 раз больше, чем в 1г стромы костного мозга [Mizuno, 2009]. Процедура получения и выделения клеток из пуповины также вызывает определенные затруднения; к тому же, есть данные о том, что дифференцировочный потенциал таких клеток ниже, чем у мезенхимных стволовых клеток жировой ткани (МСКЖТ). К тому же, некоторые авторы полагают, что МСКЖТ быстрее пролиферируют и медленнее стареют, чем другие типы МСК [Locke et al., 2009].

Поэтому на данный момент именно на МСКЖТ возлагаются основные надежды в плане использования их в регенеративной медицине.

Стандартная процедура выделения МСКЖТ из липоаспирата выглядит следующим образом: ткань отмывается от клеток крови, обрабатывается коллагеназой, фильтруется и центрифугируется. Осадок после центрифугирования представляет собой стромально-васкулярную фракцию.

Однако в такой фракции, помимо собственно МСКЖТ, находятся эндотелиоциты, гладкомышечные клетки, перициты, фибробласты, а также циркулирующие клетки крови, такие как лейкоциты, гемопоэтические стволовые клетки или предшественники эндотелия. Некоторые авторы полагают, что из всех этих типов клеток только МСКЖТ адгезивны к пластику, поэтому в конечном счете культура очищается. Об этом можно судить по уменьшению в популяции экспрессии гемопоэтических маркеров (таких как CD34). Однако подобными свойствами обладают и фибробласты, поэтому некоторые авторы высказывают сомнения по поводу того, можно ли полученную таким образом культуру считать чистой. Для очищения культуры обычно используют иммуномагнитную сепарацию с антителами к CD45 (удаляется лейкоцитарно-гемопоэтическая фракция клеток) и CD (удаляются эндотелиальные предшественники) [Locke et al., 2009].

В культуре МСКЖТ отличаются высоким уровнем пролиферации.

Обычно популяция МСКЖТ удваивается за 2-4 дня в зависимости от возраста донора, типа жировой ткани, локализации жировой ткани в организме, условий операции, плотности культуры и условий культивирования [Mizuno, 2009]. Пролиферация может быть стимулирована с помощью различных факторов, включая FGF-2 (действует через активацию JNK-киназы), PDGF (также через JNK-киназу) или онкостатин М (через активацию MEK – microtubule-associated protein kinase, ERK – extracellular signal-regulated kinase и JAK/STAT1-сигнального пути) [Mizuno, 2009].

Для МСКЖТ также характерна активная секреция. Они выделяют ростовые, анти-апоптотические и ангиогенные факторы, такие как VEGF (vascular endothelial growth factor), HGF (hepatocyte growth factor), FGF-2, IGFinsulin-like growth factor), а также М-КСФ и ГМ-КСФ [Locke et al., 2009].

Уровень секреции может регулироваться гипоксией, другими ростовыми факторами, факторами дифференцировки или ФНО- [Mizuno, 2009].

Стимуляция ангиогенеза происходит скорее за счет индукции пролиферации в эндотелии, чем за счет дифференцировки в эндотелиоциты самих МСКЖТ [Locke et al., 2009].

МСКЖТ экспрессируют характерные маркеры: CD29, CD90 и CD [Ishimura et al., 2008], а также CD44, CD49d и Oct-4 [Zhang et al., 2010].

Помимо этого, постоянно на высоком уровне детектируются CD49d, CD63, CD73. CD34 экспрессируется в начале существования первичной культуры, однако, теряется впоследствии [Locke et al., 2009].

Поскольку содержание МСК в тканях составляет доли процента, работа с ними подразумевает необходимость выделения и размножения клеток in vitro. Получение МСК из жировой ткани связано с необходимостью ферментативной обработки, поскольку популяция МСК заключена в плотный межклеточный матрикс. Методическая проблема состоит также в необходимости элиминации клеток других тканей, контактирующих с МСК.

Однако при подборе оптимальных условий культивирования сопутствующие клетки элиминируются в ходе последующих пассажей.

Используемые нами мезенхимальные стволовые клетки были получены из жировой ткани операционного материала больных с аденокарциномой молочной железы, доставленного из РОНЦ РАМН в течение часа после резекции опухоли. Образец был механически измельчен в среде ДМЕМ (“ПанЭко”, Москва), содержавшей 250 мкг/мл гентамицина, 60 Ед/мл пенициллина и 60 Ед/мл стрептомицина (“ПанЭко”). Ферментативную диссоциацию проводили в среде ДМЕМ, инкубируя препарат в присутствии 10%-ой эмбриональной телячьей сыворотки (“PAA”, Австрия), 0.04%-ой коллагеназы (“Sigma”) и тех же антибиотиков в течение 16 часов при 370C.

Затем клетки центрифугировали (10 мин, 200g), перенесли в слайд-флаконы и культивировали при 370С в среде AmnioMax С-100 Basal Medium (“Gibco”), содержавшей AmnioMax Supplement C-100, 20 мкмоль/л HEPES (“Пан/Эко”) и антибиотики.

Визуально оценивали морфологию клеток с использованием фазовоконтрастного микроскопа (рис. 6а). Кроме того, культуры мезенхимальных стволовых клеток при достижении субконфлюэнтности (70% монослоя) фиксировали изопропанолом и окрашивали кристаллическим фиолетовым.

Клетки культуры МСК имели характерную фибробластоподобную морфологию (рис. 6б).

Рисунок 6. а - культура мезенхимальных клеток жировой ткани.

Фотография сделана с использованием фазово-контрастного микроскопа, увеличение Х 250, б – культура мезенхимальных клеток жировой ткани после окрашивания кристаллическим фиолетовым. Фотография получена с использованием светового микроскопа, увеличение Х 100.

Чтобы подтвердить корректность используемого способа получения МСК, для одной из культур проведен анализ экспрессии поверхностных белков.

2.1.2 Исследование экспрессии клетками поверхностных белков Экспрессию клетками поверхностных белков проводили методом проточной цитофлуориметрии. Монослой клеток переводили в суспензию при помощи раствора Версена и промывали буферным раствором для окрашивания: фосфатно-солевой буфер (ФСБ), содержащий 1% фетальной сыворотки и 0,1% азида натрия. Окрашивание клеток проводили в том же буферном растворе с использованием антител, меченных флуоресцеинизотиоцианатом (FITC) и фикоэритрином (РЕ) (“Becton Dickinson”, США) в течение 1 ч при 4°С. В качестве негативного контроля были использованы изотипические антитела, меченные определенными флуоресцентными красителями того же производителя. После инкубации клетки отмывали раза в 1 мл буферного раствора для окрашивания и фиксировали 2%-ным раствором параформальдегида. Анализ проводили на проточном цитофлюориметре “FACSAria” (“Becton Dickinson”); данные обрабатывали с использованием программы “WinMDI”.

2.2 Определение концентрации повторяющейся последовательности ДНК человека в крови Концентрацию повторяющейся последовательности генома человека определяли методом количественной дот-гибридизации с биотинилированными зондами. Перед нанесением проб фильтры Hybond C («Amerscham») смачивали буфером А (0,15 М цитрат натрия, 1,5 М NaCl, рН 7,0) и высушивали на воздухе. К 10 мкл пробы вкДНК приливали 1,5 мкл 1 М раствора NaOH. Пробы тщательно перемешивали и оставляли на 10 мин при комнатной температуре. После чего к пробе добавляли 8,5 мкл 4 М раствора ацетата аммония. По 1,5 мкл каждой пробы наносили на фильтры Hybond C («Amersham»). При учете возможной неоднородности гибридизации по поверхности фильтра, каждый образец ДНК наносили в 3-5 точках от края фильтра к центру. Иммобилизовали ДНК путем прожаривания 1,5-2 ч при 80°С. Это производилось для предотвращения смывания образца ДНК с фильтра во время гибридизации и при последующих операциях. После прожарки фильтр смачивали в растворе 2SSC (3,0 М хлорид натрия, 1,5 М лимоннокислый натрий, рН 7,0). Переносили фильтр на стекло, покрытое гидрофобной пленкой, и наслаивали сверху тонкий слой буфера Б (2,5- ти кратный раствор Денхарда: 2,5 нг/мл BSA; 2,5 нг/мл фикол; 2,5 нг/мл ПВП;

0,05 М фосфат натрия, рН 7,4; 0,65М NaCl; 50% формамид). Фильтры, покрытые блокирующим буфером, помещали в термостат на 1-1,5 ч. при 42°С.

Для определения количества ТОрДНК использовали зонд pHRGВВ-28S (порядковый номер нуклеотидов 9346-10783, HSU 13369, GeneBank) [Вейко и соавт., 1996]. В параллельных пробах для сравнения определяли количество СатIII (субфрагмента сателлита III человека, локализованого в прицентромерном районе 1q12) с помощью зонда pRt301[Томилин и соавт., 1984]. Отбирали в полипропиленовые пробирки на 2 мл по 20 мкл ДНКзонда, каждый зонд – в свою пробирку. Добавляли в каждую пробирку по мкл 1 М раствора NaOH. Тщательно перемешивали. Помещали пробирки на 4 мин в кипящую водяную баню, добавляли 2 мл буфера Б, содержащем 5% декстрансульфата, после чего пробирки сразу же охлаждали. Фильтры доставали из термостата, удаляли остатки буфера Б, осторожно переносили на другое стекло, покрытое гидрофобной пленкой. Сверху на фильтр осторожно наносился слой буфера, содержащий ДНК-зонд. Каждый зонд наносился на свой фильтр. Биотинилирование зондов осуществляли с использованием фотореагента N-(4-азидо-2-гидроксибензоил)-1,7диаминогептан (уксуснокислая соль). Гибридизацию с денатурированными (0,05M NaОН при 99оС в течение 4мин.) биотинилированными зондами ( нг/мл) проводили в буфере Б, содержащем 5% декстрансульфата при 420С в течение 20 часов. Отмывка фильтров производилась в 2 смены по 10 мин в растворе, содержащем 2SSC и 0,1SDS, при комнатной температуре. Затем фильтры помещали в раствор для отмывки фильтров 2, содержащий 0,2SSC и 0,1%SDS. Отмывка производилась при 60°С в течение 10 мин. После этого фильтры 15 мин выдерживают в блокирующем буфере для нитроцеллюлозы (0,1% обезжиренного молока, 0,1% желатина, 0,05 М Трис-НСl, рН 7,5, 0,1 М NaCl). В 10 мл раствор АР (0,05 М Трис-НСl, рН 7,5, 0,1 М NaCl, 0,005М MgCl2) добавляли 7 мкл конъюгата стрептавидин - щелочная фосфатаза («Sigma», США) для выявления биотина. Фильтры размещали на стекле, покрытом гидрофобной пленкой, и наслаивали приготовленный раствор.

Фильтры выдерживали при комнатной температуре в течение 10 мин.

Отмывка фильтров производилась в две смены по 10 мин в растворе АР (рН 7,5). Пока готовился раствор субстратов, фильтры на короткое время помещали в раствор АР (0,05 М Трис-НСl, рН 9,5, 0,1 М NaCl, 0,005М MgCl2) для выравнивания рН. Для приготовления субстратов в 10 мл буфера АР (рН 9,5) добавляли 33 мкл BCIP в присутствии 44 мкл NBT, который образует нерастворимый осадок («Sigma», США). Фильтры размещали на гидрофобной поверхности и сверху аккуратно наносили раствор субстрата.

Оставляли до проявления гибридизационного сигнала при комнатной температуре (2-3 ч). Фильтры промывали деионизированной водой и слегка подсушивали на фильтровальной бумаге.

Интенсивность окраски пятен (гибридизационный сигнал) определяли при помощи компьютерного анализа изображения фильтра программой «Images» (ИнтерЭВМ, Москва). Стандартным образцом при построении калибровочной зависимости, которая связывает количество последовательности в пробе и уровень гибридизационного сигнала, выступала ДНК донора, для которой ранее было определено содержание анализируемой последовательности в геноме [Вейко Н.Н. и соавт., 2003].

Стандартная ошибка вычислялась по формуле, которая учитывает погрешность измерения гибридизационного сигнала данного образца ДНК и погрешность построения калибровочной кривой [Дерффель, 1994]. Средняя ошибка метода во всех опытах составляет (5±2)% от измеряемой величины.

В качестве модельных фрагментов CpG–ДНК генома человека использовали CpG – богатый фрагмент транскрибируемой области рибосомного повтора ДНК - фрагмент с 515 по 5321 в соответствии с HSU13369, GeneBank, встроенный в плазмиду pBR322 (п(ТОрДНК)). В качестве АТ – обогащенной ДНК использовали фрагмент 1,77 сателлита III (СатIII) - участок 1q12, хромосомы 1, также встроенный в вектор pBR (p(satIII)). ДНК E. coli выделяли из штамма MG 1655 методом фенольной экстракции, затем добавили 100 мкл лизирующего буфера (10%-ый лаурилсаркозилат натрия, 0,1 М ЭДТА) и 10 мкл РНКазы А (75 мкг/мл), полученную смесь инкубировали при 37°С 1 час, после чего добавляли к каждому образцу 20 мкл раствора протеиназы К (200мкг/мл) и инкубировали препараты в течение 24 часов при 37°С. Добавляли к каждому образцу равный объем насыщенного фенола. Центрифугировали образцы при 8000 g в течение 5 мин. В новую пробирку отбирали супернатант, добавляли равный объем насыщенного фенола и вновь центрифугировали образцы при 8000 g в течение 5 мин, после чего добавляли ацетат аммония (2 М) и осаждали ДНК 0,8 объемами изопропанола при -20°С. ДНК отделяли центрифугированием, промывали 75%-ым водным раствором спирта, затем ДНК растворяли в мкл воды. Все пробы ДНК дополнительно очищали от липополисахаридов:

поочередно обрабатывали тритоном Х-114 и проводили гельфильтрацию на носителе HW-85. МСК культивировали в присутствии п(ТОрДНК) (50 нг/мл), п(СатIII) (50 нг/мл), ДНК Е.coli (50 нг/мл) в течение 3 часов при 37°С.

Результаты были подтверждены в трех независимых экспериментах и на трех различных культурах МСК человека.

2.4 Выделение РНК из мезенхимальных стволовых клеток Выделение РНК из МСК проводили с помощью стандартной методики с использованием наборов YellowSolve (Клоноген, Санкт - Петербург). К 3- млн. клеток добавляли 1 мл лизирующего раствора YellowSolve, перемешивали, далее добавляли 200 мкл хлороформа («Химмед», Россия, 67и изоамилового спирта (“Sigma-Aldrich”, Германия, W205702) (25:1), перемешивали и выдерживали 20 мин при -200С, затем центрифугировали ( мин, 14 тыс. об/мин). К супернатанту, содержащему РНК, добавили одинаковый объем смеси GгееnСlеаn («Клоноген», Россия, K0800), энергично встряхивали смесь 2-3 минуты и центрифугировали (10 мин, тыс. об/мин). РНК осаждали 2,5 объемами изопропанола (-200С, 12ч) с добавлением 1/5 части насыщенного раствора ацетата аммония, осадок промывали 75%-ым водным раствором этанола и растворяли в 50 мкл стерильной воды, обработанной DEPC («Силекс», Россия, DW0202).

Выделенную РНК хранили при температуре -70°С.

Для дополнительной очистки выделенной РНК проводили ДНКазный гидролиз с помощью реагентов фирмы “Силекс” (Россия). К пробе РНК объемом 45 мкл добавляли 5 ед ДНКазы (без РНКазной активности) и 5 мкл ДНКазного буфера (x10): 100 mM Трис-HCl, pH 7.5 / 25oC, 100 mM MgCl2, mM CaCl2 и оставляли на 20 минут при температуре 22 °С. Реакцию останавливали кратковременным прогреванием при температуре 95С. Для удаления ДНКазы после обработки препарата использовали сорбент BlueSorb (“Силекс” (Россия)).

Качество выделенной РНК оценивали с помощью гель-электрофореза в 1%-ом агарозном геле. В результате была выделена стабильная РНК без примесей продуктов гидролиза РНК.

люминесцентном спектрометре «LS 55» («PerkinElmer», Англия).

Концентрацию РНК измеряли, используя РНК-связывающий краситель Quant-iTTM RiboGreen RNA reagent (MoBiTec), возб487 нм, флу524 нм.

Развели 1:2000 краситель в буфере ТЕ (0,01 М Tris HCl, pH=7,5; 0,001 M ЭДТА), отобрали 2 мл полученного раствора, добавили 5 мкл раствора РНК, измерение флуоресценции проводили в течение одной минуты.

Нормировали полученные значения по числу клеток, из которых была выделена РНК. Наиболее точным методом оценки количества клеток в культуре является измерение концентрации ДНК.

2.5 Выделение ДНК из мезенхимальных стволовых клеток Выделение ДНК мезенхимальных стволовых клеток проводили из интерфазы, образующейся на первом этапе при выделении РНК. К интерфазе (на границе раздела водной и органической фазы), добавили 100 мкл лизирующего буфера (10%-ый лаурилсаркозилат натрия, 0,1 М ЭДТА) и мкл РНКазы А (75 мкг/мл), полученную смесь инкубировали при 37°С 1 час, после чего добавляли к каждому образцу 20 мкл раствора протеиназы К (200мкг/мл) и инкубировали препараты в течение 24 часов при 37°С.

Добавляли к каждому образцу равный объем насыщенного фенола.

Центрифугировали образцы при 8000 g в течение 5 мин. В новую пробирку отбирали супернатант, добавляли равный объем насыщенного фенола и вновь центрифугировали образцы при 8000 g в течение 5 мин, после чего добавляли ацетат аммония (2 М) и осаждали ДНК 0,8 объемами изопропанола при -20°С. ДНК отделяли центрифугированием, промывали 75%-ым водным раствором спирта, затем ДНК растворяли в 30 мкл воды.

связывающий краситель Hoechst 33258 (возб 350 нм, флу450 нм).

Приготовили раствор красителя Hoechst 33528 (0,2 мкг/мл) в буфере (0,05 М Tris HCl, pH 7,4, 0,5 М NaCl, 1мМ ЭДТА), отобрали 2 мл полученного раствора, добавили 5 мкл раствора ДНК, измерение флуоресценции проводили в течение одной минуты. За основу фоновых значений сигнала исчерпывающему гидролизу ДНКазой 1. Ошибка метода измерения концентрации ДНК составляет 2±5%.

2.6 Постановка полимеразцой цепной реакции 2.6.1 Проведение реакции обратной транскрипции Получали кДНК путем проведения обратной транскрипции, используя реактивы фирмы «Силекс» (РФ), стандартным методом. К РНК (0,2–1 мкг) добавили случайные гексапраймеры («Силекс», Россия, D0300) 1 мкл (0, нг), доводили до объема 20 мкл водой, свободной от РНКаз. После кратковременного центрифугирования смесь инкубировали при температуре 70°С в течение 5 минут. После охлаждения добавили 2,5 мкл 10-кратного по концентрации буфера (700 мМ Tris-HCl pH 8,3, 166 мМ (NH4)2SO4, (“SigmaAldrich”, Германия, А4418), 75 мМ MgCl2)), 4 мкл 1,5 мМ раствора дезоксирибонуклеотидов («Силекс», Россия, N1101) и 2 мкл раствора MMLV обратной транскриптазы («Силекс», Россия, Е1211), доводили водой, свободной от РНКаз, до объема 20 мкл, затем смесь инкубировали при температуре 25°С в течение 10 мин и следующие 60 мин при температуре 37°С в амплификаторе ДНК МС2 («ДНК-технология», Россия). Прекращали течение реакции при помощи прогревания 70°С в течение 10 мин.

Визуализацию результата обратной транскрипции проводили, используя агарозный гель-электрофорез ДНК в 1%-ом агарозном геле. Выделенную кДНК хранили при температуре -70°С. Контролировали концентрацию кДНК, измеряя ее флуориметрически.

2.6.2 Полимеразная цепная реакция (ПЦР) в реальном времени Использовали метод ПЦР в реальном времени по принципу TaqMan, прибор Rotor Gene 300 ("Corbett Research”, Австралия). Готовили реакционную смесь объемом 25 мкл, включающую: 1,5 мкл кДНК, 4 мкл 1, мМ раствора нуклеотидов; 2,5 мкл буфера (700 мМ Tris-HCl, pH 8,6; 166 мМ сульфата аммония, 35 мМ MgCl2); 0,3 мкл раствора F-праймеров и 0,3 мкл раствора R-праймеров («Синтол», Россия) (таб. 1); 0,3 мкл 2 ед Taqполимеразы («Силекс», Россия, Е0121), 0,2 мкл Х100 раствора SyBR Green.

Отжиг праймеров при температуре 58°С. Постановка ПЦР-реакции при следующих условиях: после денатурации (при температуре 95°С в течение мин) следовали 45 циклов амплификации в режиме: 20 сек – при 95°С, 30 сек – 58°С, 30 сек – 72°С, далее 5 мин при 72°С. Количество мРНК оценивали, используя программное обеспечение прибора. Для подтверждения результатов проводили несколько независимых опытов на трех культурах клеток, ошибка метода составляла 2%.

В качестве гена внутреннего стандарта использовали ТВР (TATAA-box binding protein) и GAPDH (glyceraldehyde-3-phosphate dehydrogenase). Для первичного скрининга TLR-сигнального пути использовали наборы «TollLike Receptor Signaling Pathway PCR Array» (SA Biosciences, PAHS-018). В последующих экспериментах использовали праймеры «IDT» (США), «Синтол» (Россия).

Таблица 1. Список используемых праймеров.

R CCG-TGG-TTC-GTG-GCT-CTC-T F GAA-GGT-GAA-GGT-CGG-AGT-C GAPDH R GAA-GAT-GGT-GAT-GGG-ATT-TC F ATT-TCA-AAC-GTG-AAG-CTA-CAG-GG TLR R CCG-AAC-ACA-TCG-CTG-ACA-ACT F GGC-CAG-CAA-ATT-ACC-TGT-GTG TLR R AGG-CGG-ACA-TCC-TGA-ACC-T F AAG-AGT-TTT-CTC-CAG-GGT-GTT-TT TLR R CAG-ATT-CCG-AAT-GCT-TGT-GTT-TG F TGC-CTT-GAA-GCC-TTC-AGT-TAT-G TLR R CCA-ACC-ACC-ACC-ATG-ATG-AG F GAA-GAA-GAA-CAA-CCC-TTT-AGG-ATA-GC TLR R AGG-CAA-ACA-AAA-TGG-AAG-CTT F TTA-CCT-GGA-TGG-AAA-CCA-GCT-ACT TLR R TCA-AGG-CTG-AGA-AGC-TGT-AAG-CTA F TGA-AGA-CTT-CAG-GCC-CAA-CTG TLR R TGC-ACG-GTC-ACC-AGG-TTG-T F GGC-ATT-TTG-AAG-AAT-TGG-AAA-G Ifng R TTT-GGA-TGC-TCT-GGT-CAT-CTT F CAG-CCT-CTT-CTC-CTT-CCT-GAT R GCC-AGA-GGG-CTG-ATT-AGA-GA

F ACTGAGAGTGATTGAGAGTGGAC

R AACCCTCTGCACCCAGTTTTC

F AAG-GCG-CAT-GTG-AAC-TCC-C IL R ACG-GCC-TTG-CTC-TTG-TTT-TC F GAG-CCA-CAG-GTA-CAG-TGG-TC M4K R AAG-CCT-TTT-GGG-TAG-GGT-CAG F ATG-GTG-GCT-TTC-GTC-AAG-TCA R TCA-GAT-ACT-GTA-GCT-GAA-TCC-CG F GGC-TGC-TCT-CAA-CAT-GCG-A Myd88F R TGT-CCG-CAC-GTT-CAA-GAA-CA JNK F AGA-AGC-TAA-GCC-GAC-CAT-TTC (MAPK8) R TCT-AGG-GAT-TTC-TGT-GGT-GTG-A F TCC-AAG-TGC-CGA-AAA-AGG-AAG R CGA-GTT-CTG-AGC-TTT-CAA-GGT Клетки фиксировали в 3%-ом растворе формальдегида 20 минут при комнатной температуре, промывали в PBS и затем пермеабилизировали в растворе 0,1% тритона X-100 («Sigma») в буфере PBS 15 минут при комнатной температуре.

Клетки блокировали с 0,5% BSA в PBS в течение 1 ч при комнатной температуре и инкубировали в течение ночи при 4°С с антителами к p65 NFkB (3038-100, «BioVision»). После промывания в растворе PBS – 0,1% Triton, клетки инкубировали в течение 2 ч при комнатной температуре с вторичными антителами к мышиному IgG, меченными FITC.

Связывание антител с TLR9 анализировали с помощью антител к TLR9, меченных флуоресцирующим красителем фикоэритрином – PE-antiTLR9 (eB72-1665, «eBioscience», США). Клетки после фиксации и пермеабилизации (описанным выше способом) обрабатывали антителами к TLR9 30 мин в темноте.

Клеточные препараты анализировали с помощью флуоресцентного микроскопа. Количество антиген-позитивных клеток определяли как % флуоресцирующих клеток при просматривании, по крайней мере, 30 полей каждого клеточного препарата за вычетом % флуоресцирующих клеток, наблюдаемых в препарате отрицательного контроля.

2.8 Иммуноферментный анализ секреции цитокинов Клетки культивировали с п(рДНК) (50 нг/мл), супернатант собирали через 3 и 24 ч. Секрецию цитокинов – интерлейкина 10 (ИЛ-10) и фактора некроза опухоли (ФНО или TNF) определяли с помощью наборов для иммуноферментного анализа (ИФА) («Cytokine», С.-Петербург, Россия).

2.8.1 Иммуноферментный анализ секреции цитокина IL- Набор реактивов “ИФА-IL-10” предназначен для количественного определения интерлейкина-10 человека в исследуемых образцах методом твердофазного иммуноферментного анализа (ИФА). Интерлейкин-10 это провоспалительный цитокин с молекулярной массой 18 кДа. Он продуцируется SAC-активируемыми В-клетками, LPS-активируемыми моноцитами, и активированными Т-клетками. In vitro интерлейкин- угнетает продукцию цитокинов IL-1, IL-1, IL-6, IL-8, GM-CSF, M-CSF, ILОпределение интерлейкина-10 имеет особое значение при исследовании механизмов воспалительного процесса.

В наборе «IL-10» используется «сэндвич» вариант иммуноферментного анализа. Для этого используется два моноклональных антитела с разной эпитопной специфичностью к IL-10. Одно из которых находится на твердой фазе – внутренняя сторона лунок, второе – конъюгировано с биотином.

Первая стадия анализа – IL-10, который содержится в исследуемых и калибровочных образцах, взаимодействует с антителами, находящимися на твердой фазе - внутренняя поверхность лунок. Вторая стадия – IL- взаимодействует с антителами, меченными биотином. Количество IL-10 в исследуемых образцах прямо пропорционально количеству связанного коньюгата. На завершающей стадии в лунки вносим авидин-пероксидазу. В течении инкубации в субстратной смеси раствор в лунках окрашивается.

Насыщенность окраски раствора прямо пропорциональна количеству связанных меченых антител. Измеряя оптическую плотность раствора в лунках, можно рассчитать концентрацию IL-10 в анализируемых образцах, на основании калибровочной кривой.

Подготовка реагентов:

дистиллированную воду по 100 мкл, выдержали 20 мин, далее хорошо перемешали до растворения содержимого полностью. Для подготовки промывочного буфера в 480 мл дистиллированной воды добавили содержимое флакона с маркировкой «Буфер Р», тщательно перемешали.

Приготовили необходимый объем одноразового раствора антител анти IL- -биотин на нужное количество стрипов. Из расчета на один стрип смешивали концентрированный раствор антител 40 мкл с промывочным буфером 1 мл.

Раствор должен быть использован в течение часа. Также в зависимости от количества анализируемых образцов приготовили необходимый объем однократного раствора коньюгата авидин-пероксидаза, для этого смешивали концентрированный раствор коньюгата 40 мкл с промывочным буфером 1 мл из расчета для одного стрипа. Раствор также должен быть использован в течение часа.

Проведение анализа:

Сначала вносили во все лунки по 100 мкл «буфера А», далее в течение 15 мин внесли по 100 мкл калибровочных и исследуемых образцов.



Pages:   || 2 |
 
Похожие работы:

«Цатурян Людмила Дмитриевна Функциональное состояние сердечно-сосудистой системы организма детей с учетом их конституциональных особенностей 03.00.13 – физиология 14.00.09 – педиатрия диссертация на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор Бутова О.А. доктор медицинских наук, профессор Калмыкова А.С. Ставрополь – ОГЛАВЛЕНИЕ Стр. Список сокращений Введение Глава 1....»

«Баканев Сергей Викторович Динамика популяции камчатского краба (Paralithodes camtschaticus) в Баренцевом море (опыт моделирования) Специальность 03.00.18 – Гидробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель – доктор биологических наук, профессор А. В. Коросов Мурманск – 2009 Содержание Введение... Глава 1....»

«ПЛИТИНЬ Юлия Сергеевна ГУМУСНОЕ СОСТОЯНИЕ ЧЕРНОЗЕМА ВЫЩЕЛОЧЕННОГО В АГРОЦЕНОЗАХ АЗОВО-КУБАНСКОЙ НИЗМЕННОСТИ Специальность 03.02.13 – почвоведение Диссертация на соискание ученой степени кандидата сельскохозяйственных наук Научный руководитель доктор сельскохозяйственных наук, профессор...»

«Подсвирова Ирина Александровна Микробиологический мониторинг патогенов гнойновоспалительных заболеваний в хирургических отделениях и в отделении реанимации и интенсивной терапии в многопрофильном стационаре 03.02.03 – микробиология Диссертация на соискание учёной степени кандидата медицинских наук...»

«УДК: 579.846.2[063+22+26](043) НАМСАРАЕВ Зоригто Баирович МИКРОБНЫЕ СООБЩЕСТВА ЩЕЛОЧНЫХ ГИДРОТЕРМ. Специальность 03.00.07. – микробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор В.М. Горленко МОСКВА – 2003 ОГЛАВЛЕНИЕ ВВЕДЕНИЕ ОБЗОР ЛИТЕРАТУРЫ 1.1. Характеристика основных типов щелочных гидротерм 1.1.1. Основные типы щелочных гидротерм...»

«УДК 591.15:575.17-576.3 04200952266 БЛЕХМАН Алла Вениаминовна ВНУТРИПОПУЛЯЦИОННАЯ И ГЕОГРАФИЧЕСКАЯ ИЗМЕНЧИВОСТЬ ШИРОКОАРЕАЛЬНОГО ВИДА HARMONIA AXYRIDIS PALL. ПО КОМПЛЕКСУ ПОЛИМОРФНЫХ ПРИЗНАКОВ 03.00.15 - генетика Диссертация на соискание ученой степени V кандидата биологических наук Научные руководители: доктор...»

«Бабин Константин Александрович ОСОБЕННОСТИ ОБМЕНА БИОГЕННЫХ АМИНОВ И СВОБОДНОРАДИКАЛЬНОГО ОКИСЛЕНИЯ ПРИ АЛКОГОЛЬНОМ ДЕЛИРИИ С СОПУТСТВУЮЩИМ ВИРУСНЫМ ГЕПАТИТОМ С 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель : доктор...»

«Шевченко Сергей Михайлович ОСОБЕННОСТИ БИОЛОГИИ НЕКОТОРЫХ ПРЕДСТАВИТЕЛЕЙ РОДА CERASUS L. В УСЛОВИЯХ БЕЛГОРОДСКОЙ ОБЛАСТИ Специальность: 03.02.01 - ботаника ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель : доктор...»

«Бондарев Станислав Александрович ВЛИЯНИЕ МУТАЦИЙ В ПРИОНИЗУЮЩЕМ ДОМЕНЕ БЕЛКА Sup35 НА СВОЙСТВА ПРИОНА [PSI+] ДРОЖЖЕЙ Saccharomyces cerevisiae Специальность 03.02.07 – генетика. Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель д.б.н., профессор, Г.А. Журавлева Санкт-Петербург Оглавление 1. Список сокращений 2. Введение 3. Обзор...»

«УДК Шелудченков Антон Александрович Исследование механизма цитотоксического действия белкового комплекса Tag7-Hsp70 на опухолевые клетки специальность 03.01.03 - молекулярная биология Диссертация на соискание учной степени кандидата биологических наук Научный руководитель : Д.б.н., профессор Л.П. Сащенко Москва- Оглавление СПИСОК СОКРАЩЕНИЙ ВВЕДЕНИЕ 1. ОБЗОР ЛИТЕРАТУРЫ 1.1....»

«Вознийчук Ольга Петровна ПРОСТРАНСТВЕННАЯ СТРУКТУРА И ОРГАНИЗАЦИЯ НАСЕЛЕНИЯ НАЗЕМНЫХ ПОЗВОНОЧНЫХ ЦЕНТРАЛЬНОГО АЛТАЯ 03.02.04 – зоология Диссертация на соискание учёной степени кандидата биологических наук Научный руководитель : доктор биологических наук, профессор Ю.С. Равкин Горно-Алтайск – ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.. ГЛАВА 1. ИСТОРИЯ...»

«АНДРЕЙЧЕВ Виталий Васильевич ДИСБИОТИЧЕСКИЕ НАРУШЕНИЯ МИКРОФЛОРЫ В РЕПРОДУКТИВНОМ ТРАКТЕ У МУЖЧИН С ХРОНИЧЕСКИМ ТРИХОМОНИАЗОМ 14.00.11 – Кожные и венерические болезни 03.02.03 – Микробиология ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор В.А. Гриценко доктор медицинских наук М.А. Захарова Оренбург-...»

«НОСАЧ Екатерина Сергеевна Микробиологические аспекты диагностики хламидийных и микоплазменных пневмоний у лиц молодого возраста в закрытых коллективах. 03.02.03 – микробиология АВ ТОР ЕФЕР АТ диссертации на соискание ученой степени кандидата медицинских наук Владивосток 2014 Диссертация выполнена в государственном бюджетном образовательном учреждении высшего профессионального образования Тихоокеанский государственный медицинский университет Министерства здравоохранения...»

«МИРОШНИЧЕНКО ЮЛИЯ АЛЕКСАНДРОВНА СОСТОЯНИЕ МУКОЗАЛЬНОГО БАРЬЕРА РЕПРОДУКТИВНОГО ТРАКТА И УРОВЕНЬ АДИПОКИНОВ У ЖЕНЩИН ПРИ ФИЗИОЛОГИЧЕСКОЙ БЕРЕМЕННОСТИ Специальность: 03.01.04 – биохимия Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель : доктор...»

«Блащинская Оксана Николаевна БАРЬЕРНЫЕ СВОЙСТВА ДРЕВЕСНОГО РАСТИТЕЛЬНОГО ПОКРОВА (сосна обыкновенная и береза повислая) УРБАНИЗИРОВАННОЙ ТЕРРИТОРИИ (на примере города Ангарска Иркутской области) Специальность 03.02.08. – Экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель – доктор биологических наук, доцент...»

«СОКОЛОВА ЕКАТЕРИНА АНАТОЛЬЕВНА МИКРОБИОЛОГИЧЕСКИЕ АСПЕКТЫ ВНУТРИУТРОБНЫХ ПНЕВМОНИЙ С РАЗЛИЧНЫМ ИСХОДОМ 03.02.03 – микробиология ДИССЕРТАЦИЯ на соискание ученой степени кандидата медицинских наук Научные руководители: доктор медицинских наук, профессор Э.С. Горовиц, доктор медицинских наук, профессор Г.Г. Фрейнд Пермь – ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ.....»

«БАШКАТОВ АЛЕКСЕЙ НИКОЛАЕВИЧ УПРАВЛЕНИЕ ОПТИЧЕСКИМИ СВОЙСТВАМИ БИОТКАНЕЙ ПРИ ВОЗДЕЙСТВИИ НА НИХ ОСМОТИЧЕСКИ АКТИВНЫМИ ИММЕРСИОННЫМИ ЖИДКОСТЯМИ 03.00.02 - биофизика Диссертация на соискание ученой степени кандидата физико-математических наук Научные руководители: доктор физико-математических наук профессор В.В. Тучин кандидат физико-математических наук с.н.с. В.И. Кочубей Саратов...»

«БАРАНОВ КОНСТАНТИН ОЛЕГОВИЧ ХАРАКТЕРИЗАЦИЯ НОВЫХ ЛЕЙКОЦИТАРНЫХ РЕЦЕПТОРОВ ЧЕЛОВЕКА FCRL1, FCRL4 И FCRL6 03.01.07 – молекулярная генетика Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель д.б.н. Таранин А. В. Новосибирск – 2014 2 ОГЛАВЛЕНИЕ СПИСОК СОКРАЩЕНИЙ.. ВВЕДЕНИЕ.. Глава 1. ОБЗОР ЛИТЕРАТУРЫ.. 1.1....»

«Бабоша Александр Валентинович МНОГОФАЗНЫЙ ХАРАКТЕР КОНЦЕНТРАЦИОННОЙ ЗАВИСИМОСТИ ДЕЙСТВИЯ ФИЗИОЛОГИЧЕСКИ АКТИВНЫХ ВЕЩЕСТВ НА РОСТ РАСТЕНИЙ И УСТОЙЧИВОСТЬ К ФИТОПАТОГЕНАМ Специальность 03. 01. 05 – Физиология и биохимия растений Диссертация на соискание ученой степени доктора биологических наук Москва – 2014 СОДЕРЖАНИЕ ВВЕДЕНИЕ Основные представления о природе...»

«МАРКЕЛОВ ИВАН НИКОЛАЕВИЧ ГЕОМЕТРИЧЕСКИЕ ХАРАКТЕРИСТИКИ ПСЕВДОСИММЕТРИИ ВЕНЧИКА АКТИНОМОРФНОГО ЦВЕТКА КАК ИНДИКАЦИОННЫЕ ПОКАЗАТЕЛИ СОСТОЯНИЯ ОКРУЖАЮЩЕЙ СРЕДЫ 03.02.08 — экология (биология) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель : доктор...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.