WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 | 3 |

«РАЗРАБОТКА ТЕХНОЛОГИИ ПРЕ- И ПОСТНАТАЛЬНОЙ ДИАГНОСТИКИ ГРУППЫ СИНДРОМОВ, ОБУСЛОВЛЕННЫХ МИКРОДЕЛЕЦИЕЙ 22q11.2 ...»

-- [ Страница 1 ] --

Федеральное Государственное бюджетное учреждение

«Медико-генетический научный центр»

Российской академии медицинских наук

На правах рукописи

КОЗЛОВА Юлия Олеговна

РАЗРАБОТКА ТЕХНОЛОГИИ ПРЕ- И ПОСТНАТАЛЬНОЙ

ДИАГНОСТИКИ ГРУППЫ СИНДРОМОВ, ОБУСЛОВЛЕННЫХ

МИКРОДЕЛЕЦИЕЙ 22q11.2

03.02.07 – генетика Диссертация на соискание ученой степени кандидата медицинских наук

Научный руководитель:

доктор биологических наук, профессор Т.В. Золотухина Москва 2014

ОГЛАВЛЕНИЕ

ВВЕДЕНИЕ Актуальность темы исследования Степень разработанности темы исследования Цель исследования Задачи исследования Научная новизна и практическая значимость работы Методология и методы исследования Положения, выносимые на защиту Личный вклад автора в проведенные исследования Степень достоверности и апробация результатов работы Публикации Структура и объем диссертации ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ 1.1. История изучения синдрома 1.2. Формирование фенотипических признаков СД22q11.2 в эмбриогенезе 1.3. Механизм возникновения делеции 22q11.2 1.4. Характеристика типично делетируемого региона 22q11.2 1.5. Фенотипические признаки СД22q11.2 и другие делеции, приводящие к схожему фенотипу 1.6. Методы диагностики микроделеции 22q11.2 1.7. 1. Особенности пренатальной диагностики микроделеции 22q11.2 1.7.2. Постнатальная диагностика СД22q11.2 ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ 2.1. Формирование и методы исследования пренатальной группы пациентов 2.2. Формирование постнатальной группы пациентов 2.3. Методы исследования постнатальной группы пациентов 2.3.1. Цитогенетическое исследование 2.3.2. Молекулярно-цитогенетическое исследование 2.3.3. Мультиплексная лигазная полимеразная цепная реакция (MLPA) 2.3.4. Секвенирование гена TBX1 2.3.5. Статистические методы обработки полученных данных

ГЛАВА 3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

3.1. Результаты исследования пренатальной группы 3.2. Результаты исследования постнатальной группы 3.2.1. Результаты диагностики делеции 22q11.2 FISH-методом 3.2.2. Анализ фенотипических данных пациентов 3.2.3. Результаты исследования делеции 22q11.2 методом MLPA 3.2.4. Результаты секвенирования гена TBX1 ЗАКЛЮЧЕНИЕ ВЫВОДЫ

ПРИМЕНЕНИЕ РЕЗУЛЬТАТОВ И НАУЧНЫХ ВЫВОДОВ

СПИСОК УСЛОВНЫХ СОКРАЩЕНИЙ

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ АВТОРОМ ПО ТЕМЕ

ДИССЕРТАЦИИ СПИСОК ЛИТЕРАТУРЫ

ВВЕДЕНИЕ

Хромосомные болезни занимают одно из ведущих мест в структуре врожденной и наследственной патологии человека. Они обусловлены числовыми или структурными аномалиями хромосом, которые приводят к инвалидизации и часто к летальным исходам. Так, доля хромосомных синдромов среди причин младенческой и детской смертности составляет 5-7%, среди детей с умственной отсталостью – 25-30%, у лиц с нарушениями полового развития – 25-27%.

Диагностика, в том числе и пренатальная, такой частой патологии, как хромосомные синдромы, представляет большую медицинскую, научную и социальную значимость. Установление диагноза больному ребенку позволяет семье не только определить наличие или отсутствие наследственной патологии и получить аргументированную медико-генетическую консультацию по поводу прогноза потомства, но и рекомендации пренатальной диагностики конкретного заболевания.

Это, в свою очередь, может стимулировать родителей к новой беременности, которая будет протекать при гарантированном благоприятном прогнозе здоровья будущего ребенка.

Спектр хромосомных аномалий (ХА), являющихся причиной наследственных синдромов, широк и представлен не только числовыми аберрациями (например, наиболее распространенными трисомиями по 21, 13, 18 хромосомам или моносомией по Х хромосоме), но и разнообразными структурными нарушениями хромосом, сопровождающимися дупликациями или делециями генетического материала. Классический цитогенетический анализ (G-band using Trypsin-Giemsa, GTG) позволяет выявить все числовые ХА и те из структурных ХА, величина которых превышает 10 миллионов пар оснований. Значительная часть ХА представлена более мелкими аберрациями (микроделециями и микродупликациями), которые не выявляются при стандартном цитогенетическом анализе и могут быть диагностированы только при использовании современных молекулярноцитогенетических или молекулярных методов исследования.

Хромосомные болезни, обусловленные структурными аномалиями хромосом, приводящие к избытку (дупликации) или недостатку (делеции) малого количества генетического материала, встречаются среди определенных групп пациентов с высокой частотой. Так среди детей с идиопатической умственной отсталостью микроперестройки хромосом встречаются с частотой до 30%. Как правило, дети с такой хромосомной аномалией остаются без определенного диагноза, а семьи без четкого прогноза потомства, т.к. такие микроперестройки хромосом не диагностируются при GTG-анализе. У пациентов, кариотип которых ранее определен как нормальный, современные молекулярные технологии позволяют выявить новые ХА, обусловленные микроделециями или микродупликациями.

Перечень таких микроделеционных и микродупликационных хромосомных синдромов постоянно увеличивается в связи с расширением методических возможностей их диагностики.

Частота микроделеционных синдромов среди новорожденных вследствие неравного кроссинговера достаточно высока (от 1:4000 до 1:30000). Многие известные на сегодняшний день синдромы (Ди Джорджи, Прадера-Вилли, Хиршхорна, Вильямса) описаны задолго до того, как установлена их этиология на молекулярном уровне.

В большинстве своем клинические проявления микроделеционных синдромов в постнатальном периоде характеризуются умственной и психомоторной задержкой развития разной степени, множественными стигмами дисэмбриогенеза, пороками развития, а также различными функциональными нарушениями.

Группа синдромов, обусловленных делецией 22q11.2, обозначаемая далее как синдром делеции 22q11.2 (СД22q11.2), включает в себя несколько синдромов с признаками. Основными синдромами этой группы являются: вело-кардиофациальный синдром, синдром конотрункальных и лицевых аномалий и синдром Ди Джорджи. В настоящее время СД22q11.2 считается самым распространенным в популяции человека. Он встречается с частотой 1 на 4000 новорожденных и обозначается в зарубежной литературе как 22q11.2DS (22q11.2 Deletion Syndrome) (DG, MIM# 188400; CTF, MIM# 217095; VCF,MIM# 192430) [Wilson D. et al., 1992;

Devriendt K. et al., 1998; Goodship J. et al., 1998; Scrambler P., 2000; Botto L. et al., 2003]. Величина делеции 22q11.2, как правило, не превышает 3 миллионов пар кариотипировании [Gong W. et al., 1996].

У пациентов этой группы синдромов отмечается выраженный клинический полиморфизм с преобладанием таких признаков, как лицевые дизморфии, врожденные пороки сердца (ВПС) и магистральных сосудов, аномалии развития твердого и мягкого неба, патология мочевыделительной системы, снижение иммунитета, патология центральной нервной системы, психиатрические заболевания и умственная отсталость [McDonald-McGinn D. et al., 1997а,б; McDonald-McGinn D.

et al., 1999; McDonald-McGinn D. et al., 2001а; Sullivan K. et al., 2005]. Широкий спектр симптомов, формирующих группу СД22q11.2, свидетельствует о сложности клинической дифференциальной диагностики этих заболеваний и о необходимости анализа комплекса клинических признаков у пациентов с СД22q11.2 на репрезентативной выборке.

На практике зачастую врачи разного профиля, наблюдая пациентов с отдельными признаками или с комплексом признаков, характерным для СД22q11.2, либо ставят диагноз на основании клинических проявлений, либо пациенты остаются вовсе без определенного диагноза. Однако, по сути пациенты с такими признаками формируют лишь группу риска. Как и для других генетических синдромов окончательный диагноз СД22q11.2 пациенту может быть поставлен лишь после проведения уточняющей диагностики с применением современных лабораторных технологий. Таким образом, путь от формирования группы риска к конкретному диагнозу посредством использования современных молекулярнодиагностических подходов (а затем возможно и к таргетной терапии) представляет современную тенденцию персонализированной медицины, которая занимает все более значительное место в клинической практике. Клинический полиморфизм многих генетических синдромов, как и СД22q11.2, затрудняет прямую клиническую диагностику, обуславливая необходимость использования для их диагностики современных прямых молекулярных методов.

микроделеционных синдромов с целью выработки тактики ведения беременности и родов, а также курирования таких пациентов в постнатальном периоде [Bretelle F. et al., 2010]. Так как при стандартном цитогенетическом анализе материала, полученного в ходе инвазивного вмешательства (амниотическая жидкость, ворсины хориона или пуповинная кровь плода), делеция 22q11.2 не может быть диагностирована, то при подозрении на ее наличие у плода следует предусмотреть расширенное молекулярное исследование или сохранение образца для дальнейшего исследования.

Изучение чувствительности современных молекулярных технологий в ранней (в том числе пренатальной) диагностике СД22q11.2 актуально как с научной, так и с практической точек зрения [Driscoll D. et al., 1993; Mosca-Boidron A. et al., 2012].

Не менее актуально определение критериев отбора, т.е. формирования среди беременных женщин группы риска, – для проведения расширенного молекулярного исследования плодного материала на СД22q11.2. При этом у плода с нормальным кариотипом, определенном GTG-методом, следует обращать особое внимание на поиск дополнительных эхографических маркеров, косвенно свидетельствующих о возможной патологии: расширенное воротниковое пространство (ВП), пороки сердечно-сосудистой системы, задержка внутриутробного развития, аплазия или гипоплазия тимуса, аномалии развития мочевыделительной системы.

В связи с уже упомянутой выше высокой частотой встречаемости СД22q11.2, диагностика и курирование пациентов с данным синдромом является важным медицинским аспектом, представленным, к сожалению, в основном за рубежом. В настоящее время огромное число исследователей в различных областях медицины и биологии заняты вопросами фундаментальных и клинических исследований, связанных с микроделецией 22q11.2. Существует Международная организация “International Foundation 22q11.2”, объединяющая не только всех специалистов, теоретически или клинически изучающих этот синдром, но и семьи, в которых есть дети с СД22q11.2. Раз в два года эта организация проводит съезды для профессионалов и семей. Из отечественных исследований следует отметить диссертационную работу Антоненко В.Г. (2004 г.), в которой освещены теоретические основы микроделеции 22q11.2, проведен анализ фенотипических данных пациентов с делецией, обсуждены материалы из литературных источников того времени, а также диагностика относительно небольшой группы пациентов с помощью микросателлитного анализа с фенотипическими признаками (n=30) диссертационная работа Хурс О.М. (Республика Беларусь, г.Минск), в которой в аспекте сложности диагностики микроделеционных синдромов вообще в белорусской популяции, в числе других рассматриваются особенности ПД СД22q11.2, однако в основном диагноз установлен post mortem [Хурс О.М., 2013]. За фундаментальной точек зрения посвящено довольно большое количество исследований. Уделяя большое значение дифференциальной диагностике такого частого синдрома, периодически собираются тематические конференции, публикуют результаты исследования различных групп пациентов в отдельных странах, а также результаты коллаборативных исследований специалистов разных профилей. Однако в Российской Федерации исследованию этого синдрома и точной постановке диагноза СД22q11.2, в особенности пренатально, до настоящего времени уделено мало внимания. В этой связи мы считали исключительно важным подготовить и провести всестороннее исследование большой выборки пациентов с фенотипическими признаками СД22q11.2 в постнатальном периоде, а также плодов с эхографическими маркерами микроделеции 22q11.2 в пренатальном периоде.

Целью работы является разработка подходов к пре- и постнатальной эффективности методов их лабораторной диагностики.

сформировать группу риска среди беременных, провести ПД синдрома методом FISH и оценить диагностическую эффективность предлагаемых маркеров.

Определить клинические критерии для формирования группы пациентов с подозрением на СД22q11.2, на их основании создать карту-анкету и сформировать выборку для лабораторного обследования пациентов в постнатальном периоде.

молекулярно-цитогенетическим методом, среди пациентов постнатальной группы.

Провести сравнительный анализ фенотипических проявлений СД22q11.2 в подгруппах пациентов с подтвержденной делецией 22q11.2 и без нее.

Провести исследование ДНК пациентов постнатальной группы методом MLPA, определить размер делеции, провести поиск других делеций, формирующих у пациентов сходные с СД22q11.2 фенотипические признаки.

Провести сравнительную оценку эффективности выявления микроделеции 22q11.2 методами FISH и MLPA.

Оценить вклад мутаций гена TBX1 в формирование фенотипа СД22q11.2 при отсутствии делеции 22q11.2.

Научная новизна и практическая значимость работы Определены клинические критерии формирования групп пациентов с подозрением на СД22q11.2 в постнатальном периоде с описанием четырех главных компонентов синдромального фенотипа по признакам, характеризующим: 1) сердечно-сосудистую систему; 2) состояние тимуса и иммунитета; 3) лицевые дизморфии и расщелины; 4) другие микроаномалии развития.

Использованные критерии клинического отбора пациентов с фенотипическими признаками CД22q11.2 позволили оптимизировать диагностику СД22q11.2 и выявить делецию 22q11.2 FISH-методом в 31% случаев. Показано, что подгруппы пациентов с подтвержденной делецией 22q11.2 и без делеции различаются по частоте встречаемости некоторых признаков: у пациентов с делецией достоверно чаще наблюдались неконотрункальные ВПС, отдельные виды конотрункальных пороков (ОАС, ПДА, тип В), гипокальциемия, пороки развития МПС и совокупность четырех признаков, относящихся к лицевым дизморфиям и микроаномалиям развития. Впервые в выборке российских больных с СД22q11.2 методом MLPA определен размер делеции у пациентов и показано, что в исследованной выборке наиболее часто представлена делеция локуса LCR22-A-B-C (3 м.п.о.).

Мутации в гене TBX1 в обследованной группе пациентов с характерным для СД22q11.2 фенотипом и отсутствием делеции 22q11.2, не вносят вклада в структуру причин синдрома.

Впервые определен комплекс эхографических маркеров СД22q11.2 у плода для формирования группы риска среди беременных.

При использовании разработанной карты-анкеты, включающей характерные для СД22q11.2 фенотипические признаки, сформированы группы риска для дальнейшего направления пациентов с подозрением на СД22q11.2 на цитогенетическое и молекулярно-цитогенетическое исследование в постнатальном периоде. В результате расширенного поиска дополнительных эхографических критериев у плода определены показания для пренатальной молекулярноцитогенетической диагностики этого синдрома.

В работе при отборе пациентов для исследования использованы клинические методы (анализ фенотипа), цитогенетические (GTG-метод) и молекулярноцитогенетические методы (FISH-метод). Молекулярные методы: мультиплексная лигазозависимая амплификация (MLPA), секвенирование. Проведена статистическая обработка полученных клинических данных.

лимфатические образования в области шеи плода, пороки сердечно-сосудистой системы, пороки развития МПС, гипо- и аплазию тимуса, является эффективным и позволяет выявить микроделецию 22q11.2 в 5% наблюдений пренатальной выборки.

Использование в качестве критериев отбора пациентов в постнатальном периоде для лабораторного обследования комплекса фенотипических признаков, включающего ВПС, нарушения иммунитета, гипокальциемию, пороки МПС, совокупность характерных лицевых дизморфий и микроаномалий развития, обоснованно, поскольку позволило сформировать выборку пациентов, частота выявления СД22q11.2 в которой составила 31%.

Частоты отдельных фенотипических проявлениий в подгруппах пациентов с подтвержденной лабораторными методами делецией 22q11.2 и без нее достоверно различаются. Включение в карту-анкету гипокальциемии, пороков развития МПС и совокупности четырех признаков, относящихся к лицевым дизморфиям и микроаномалиям развития, позволяет повысить эффективность лабораторной диагностики.

методом, полностью соответствуют результатам, полученным методом MLPA.

Однако метод MLPA может являться предпочтительным, поскольку позволяет определить наличие делеции 22q11.2, ее размер, а также выявить делеции в локусах других хромосом, способных формировать схожие с СД22q11.2 фенотипические признаки.

В исследованной выборке мутации гена TBX1 не обнаружены и, следовательно, не вносят вклада в структуру причин СД22q11.

Личный вклад автора в проведенные исследования Определение направления работы, цели и задач исследования, разработка протокола диагностики, оценка результатов исследования проводились автором совместно с научным руководителем д.б.н, профессором Золотухиной Т.В.

Автором самостоятельно изучена отечественная и зарубежная литература по теме диссертации и лично написана рукопись настоящей работы. Основная часть экспериментальной работы: составление карты-анкеты, анализ фенотипических признаков пациентов, формирование пре- и постнатальной выборки пациентов, молекулярно-цитогенетическое исследование, выполнена автором самостоятельно. Часть исследования, относящаяся к секвенированию гена TBX и исследованию образцов методом MLPA, выполнена совместно с сотрудниками лаборатории ДНК-диагностики ФГБУ «МГНЦ» РАМН. Сбор клинических данных осуществлен с помощью врачей-педиатров Городской клинической больницы № 67 им. Л. А. Ворохобова (г. Москва) и Научного центра сердечнососудистой хирургии им. А.И. Бакулева РАМН (г. Москва). Сбор клинических данных пренатальных наблюдений, эхографические исследования и инвазивные процедуры осуществлены врачами клинического родильного дома №27 г. Москвы.

Степень достоверности и апробация результатов работы Достоверность полученных данных в постнатальной группе пациентов подтверждена двойной верификацией результатов исследования прямыми диагностическими методами - FISH и MLPA. Результаты исследований в пренатальной группе получены с помощью прямого таргетного исследования FISH методом с зондом TUPLE1/ARSA (Abbott Molecular). Частота встречаемости делеции 22q11.2 у пациентов в двух подгруппах, пре- и постнатальной, при аналогичном подходе к формированию групп риска по делеции, соответствуют данным, представленным в зарубежной литературе. Изложенные в диссертационном исследовании положения, выводы и рекомендации являются достоверными.

Материалы диссертационного исследования неоднократно представлены в виде стендовых сообщений: на VI Съезде Российского общества медицинских генетиков (г.Ростов-на-Дону, 2010 г.), на конгрессе Европейского общества генетики человека (г. Париж, 2013г.), на 9-ой конференции Европейского общества цитогенетиков (г. Дублин, 2013г.).; в виде устных сообщений на IX научной конференции «Генетика человека и патология: актуальные проблемы современной цитогенетики» (г.Томск, 2011 г.), на конференциях молодых ученых ФГБУ «МГНЦ» РАМН (г. Москва, 2012 и 2013г.). По результатам конкурсной конференции Молодых ученых ФГБУ «МГНЦ» РАМН за 2013г. представленная работа удостоена первой премии.

Работа апробирована и рекомендована к защите на заседании научного семинара ФГБУ «МГНЦ» РАМН 19 февраля 2014года.

По теме и материалам диссертации опубликованы 23 печатные работы: статей, в том числе 6 в рецензируемых научных журналах, рекомендуемых ВАК МОН РФ и 13 тезисов,7 из них – в иностранных источниках.

Диссертационная работа изложена на 100 страницах машинописного текста (без учета списка литературы), содержит 10 таблиц, 8 иллюстраций и состоит из следующих разделов: оглавление, введение, обзор литературы, материалы и методы исследования, результаты и обсуждение, заключение, выводы, применение результатов и научных выводов, список условных сокращений, список работ, опубликованных автором по теме диссертации, список цитируемой литературы.

Библиографический указатель включает 172 источника до 2014 года включительно, из них 9 отечественных и 163 – зарубежных авторов.

Автор выражает благодарность научному руководителю Т.В. Золотухиной за вклад в диссертационную работу, всему коллективу лаборатории цитогенетики, в особенности В.Г. Антоненко за помощь в сборе и обработке данных, а также сотрудникам лаборатории ДНК-диагностики ФГБУ «МГНЦ» РАМН

ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ

Хромосомная патология – одна из причин возникновения врожденных пороков развития (ВПР), аномалий полового развития и умственной отсталости. С клинической точки зрения ХА характеризуются следующими основными признаками: внутриутробной и постнатальной задержкой развития и роста, часто сопровождающимися умственной отсталостью (УО), множественными ВПР, лицевыми дизморфиями, нарушением половой дифференцировки, репродуктивными проблемами. Эффективность диагностики ХА как в пре-, так и в постнатальном периоде во многом зависит от критериев при формировании группы пациентов с подозрением на ХА и от примененных методов выявления ХА.

Основным методом изучения кариотипа и диагностики хромосомных болезней человека является анализ хромосомных препаратов культуры лимфоцитов периферической крови, обработанных трипсином и дифференциально окрашенных раствором Гимза, с использованием световой микроскопии – GTG-метод [Caspersson T. et al., 1970;,Yunis J. et al., 1978]. Для высокого разрешения GTG-метода требуются хромосомные препараты с распознаванием рисунка окраски на уровне 550- бэндов, что соответствует чувствительности 8-10 млн пар оснований. Однако в ряде случаев при стандартном кариотипировании хромосомный дисбаланс генома не выявляется, так как хромосомный дефект 10 млн.п. о. и GTG-метод достигает пределов своей разрешающей возможности.

Значительный прогресс в точности диагностики структурных перестроек хромосом и выявлении низкоуровневого мозаицизма достигнут с внедрением в цитогенетику молекулярных методов исследования. Использование флуоресцентной in situ гибридизации (fluorescence in situ hybridization – FISH-метод) позволяет с высоким разрешением диагностировать мелкие структурные, невидимые глазом (cryptic) ХА. В большинстве своем этот метод является таргетным, т.е. может маркировать и выявлять только те участки хромосом, ДНК-зонды к которым использованы при анализе. FISH-метод относится к молекулярно-цитогенетическим методам исследования, с помощью которых можно идентифицировать как отдельные хромосомы, так и их районы. В настоящее время имеется большое разнообразие ДНК-проб для FISH-анализа в цитологии, онкологической и конститутивной генетике. Использование FISH-метода позволяет значительно повысить чувствительность диагностики ХА. Кроме того, FISH-метод может быть использован при анализе как метафазных хромосом, так и интерфазных ядер культивированных и некультивированных клеток (интерфазная FISH).

Наиболее эффективно использование FISH-метода для идентификации различных структурных перестроек хромосом. Среди разнообразных ДНК-зондов в конститутивной генетике особое значение имеют зонды, маркирующие участки хромосом, делеции в которых обуславливают проявление тех или иных проявлений синдромов.

Микроделеции – это делеции, размеры которых составляют, как правило, менее 2 млн. п. о. и находятся за гранью разрешающей возможности световой микроскопии [Gu W. et al., 2008]. Утрата строго определенных локусов хромосом, содержащих до нескольких десятков функционально не связанных генов, приводит к формированию характерных симптомо-комплексов, обозначаемых синдромами микроделеций [Shaw C. et al., 2004; Lupski J., 2009]. Наиболее известными из этих генетических болезней являются синдромы Вилльямса, Прадера-Вилли, Ангельмана, фациального, синдрома конотрункальных и лицевых аномалий), ВольфаХиршхорна, Смит-Магенис, Миллера-Дикера. Фенотипическая картина данных заболеваний детально описана и характеризуется широкой вариабельностью.

До недавнего времени врачи-генетики устанавливали диагнозы синдромов микроделеций только на основании наблюдаемых клинических признаков, так как молекулярно-цитогенетические методы диагностики микроперестроек использовались недостаточно широко. Правомерно считать, что данные диагнозы, не подтвержденные идентификацией хромосомной аномалии, оставались клинически предполагаемыми. Результаты изучения спектра проявлений и особенностей этих заболеваний, оценка частоты обнаружения различных микроделеций у пациентов с характерными симптомо-комплексами, создание протокола их лабораторной диагностики позволяют повысить эффективность медико-генетического консультирования и усовершенствовать профилактику хромосомной патологии.

Учитывая, что синдромы микроделеций представляют важную медицинскую и молекулярных методов исследования актуально как для практической медицины, так и для понимания фундаментальных основ строения и функционирования генома человека.

Мутации, вызывающие хромосомные перестройки, могут возникать как в ходе преимущественным процессом, когда хромосомные районы особенно активны в ходе мейотического синапсиса и рекомбинации, приводящим к мутациям. Митоз, в свою очередь, из-за огромного количества процессов деления в клетках может быть источником аберрантных клонов клеток. Однако мозаицизм по структурным перестройкам является крайне редким событием [Grant R., 2003, c.267]. Структурные перестройки, такие как транслокации, инверсии, инсерции, изохромосомы, делеции и дупликации, как правило, возникают de novo в ходе неравного кроссинговера в мейозе гаметогенеза, происходящего между хромосомо-специфичными низкокопийными повторами ДНК-последовательностей с высокой степенью гомологии, также известных как «дупликоны» [Ji Y. Et al., 2000]. Когда такие перестройки вызывают дисбаланс дозы генов, участвующих в процессах развития организма, возникают геномные нарушения [Lupski J., 1998; Lupski J., 2003].

Большинство точек разрыва на хромосомах находятся в нетранскрибируемых локусах ДНК и, таким образом, часто не оказывают неблагоприятного влияния на фенотип человека. Если же точка разрыва на одной из хромосом повреждает ген, то фенотипические последствия, скорее всего, возникают.

Повторяющиеся последовательности, богатые парами оснований АТ, лежат в основе т.н. «горячих точек», рассредоточенных по всему геному. Одна из таких горячих точек находится в районе q11.2 хромосомы 22 [Kurahashi H. et al., 2000a].

Частые перестройки, захватывающие эту область, ведут к образованию транслокаций, связанных с развитием злокачественных образований. Например, t(9;22) Филадельфийской хромосомы и вызывает хронический миелоидный лейкоз; t(8;22), связана с лимфомой Беркитта; t(11;22) обнаруживается при саркоме Юинга и периферической нейроэпителиоме. Частые конституциональные аномалии, связанные с районом 22q11, включают и дупликации. Например, наличие сверхчисленной маркерной хромосомы inv dup(22)(q11) при синдроме кошачьего глаза (Cat eye Syndrome, CES, OMIM #115470), наличие сверхчисленной маркерной хромосомы der(22)t(11;22) при синдроме Эмануэль (OMIM# 609029), а также дупликационные синдромы 22q11.2 (Chromosome 22q11.2 Duplication Syndromes, OMIM #608363). Все это позволяет предположить геномную нестабильность в районе 22q11.2.

Группа синдромов, обусловленных микроделецией в районе q11.2 хромосомы 22, включает в себя несколько заболеваний с различными названиями и во многом перекрещивающимися клиническими признаками. К этой группе синдромов относятся: вело-кардио-фациальный синдром, синдром конотрункальных и лицевых аномалий и синдром Ди Джорджи. Эта микроделеция встречается с частотой 1 на 4000 новорожденных и считается самой распространенной микроделецией в популяции человека [Wilson D. et al. 1994; Goodship J. et al. 1998; Botto L. et al., 2003]. В настоящее время используется название «синдромы делеции 22q11.2» (в зарубежной литературе – 22q11.2 Deletion Syndromes, 22q11.2DS). Однако широко используемы, более приняты и понятны врачам такие устоявшиеся названия заболеваний, как «синдром Ди Джоржи» и «вело-кардио-фациальный синдром», подразумевая, что этиологически эти заболевания идентичны, т.к. вызваны делецией 22q11.2 [McDonald-McGinn D. et al., 1996; Matsuoka R. et al., 1994].

СД22q11.2 является наиболее распространенным в популяции человека среди микроделеционных синдромов [Devriendt K. et al., 1998; Goodship J. et al., 1998;

Murphy K. et al., 2005]. Такая высокая частота встречаемости обусловливает большой интерес исследователей к этой группе синдромов по всему миру и в нашей стране, в частности. Широкий спектр фенотипических проявлений, характерных для группы синдромов, обусловленных микроделецией 22q11.2, включает более 180 признаков и затрагивает почти все органы и системы пациента [Monteiro F. et al., 2013]. Наиболее частые проявления, однако, касаются сердечно-сосудистой системы и могут являться причиной смертности таких пациентов, также для пациентов этой группы характерны аномалии неба, иммунные нарушения, психиатрические и поведенческие расстройства [McDonald-McGinn D. et al., 2008].

обозначающихся СД22q11.2, впервые описаны как три отдельных синдрома врачами различных специальностей. Наибольшую известность в этой связи получил американский доктор-эндокринолог A. M. DiGeоrge, который в ходе клинических экспериментов доказал, что тимус является важным органом в иммунной системе человека, что послужило подтверждением теории о наличии гуморального и клеточного видов иммунитета. Он же впервые в 1965 году описал синдром, включающий такие признаки, как гипопаратиреоидизм, конотрункальные пороки сердца, лицевые дизморфии и иммунодефицит, и тремя годами позже опубликовал данные о нескольких пациентах со схожим фенотипом [DiGeorge A., 1965; DiGeorge A., 1968]. До сих пор название «синдром Ди Джоржи» (DiGeorge syndrome, DGS) наиболее широко распространено и общеупотребимо. В 1955 г. Sedlackov описала синдром, включающий врожденные аномалии небной занавески и гиперназализацию голоса, лицевые дизморфии, умственную отсталость (УО) и другие аномалии [Sedlakov E., 1955]. Позже к этому описанию добавлены пороки сердца и аномалии развития неба. Впоследствии синдромы с перекрывающимися фенотипическими признаками были описаны и другими специалистами. Десятилетие спустя Kinouchi описал синдром конотрункальных и лицевых аномалий (Conotruncal Anomalies Face Syndrome, CTAF), включавший ВПС, характерные лицевые аномалии, задержку развития и снижение интеллекта [Kinouchi A. et al., 1976]. Shprintzen с соавторами в 1978 г. описал сходные фенотипические признаки у пробандов, а также небноглоточную (вело-фарингеальную) недостаточность с расщелиной неба или без нее, которые объединил в синдром под названием «вело-кардио-фациальный» синдром (Velo-Cardio-Facial Syndrome, VCFS) [Shprintzen R. et al., 1978].

Сравнение совокупностей клинических признаков, описанных под разными названиями, в целом внесло разногласия и недопонимание в ряды врачей и исследователей. С одной стороны, синдромы охарактеризованы независимо примерно в одно и то же время специалистами разных специальностей – иммунологами, кардиологами, черепно-лицевыми и пластическими хирургами, фониаторами. С другой стороны – эти синдромы имели под собой единую этиологию, что выяснено несколько позже.

Потребовались некоторые усилия, чтобы научное сообщество пришло к единому мнению по поводу названия синдромов, связанных с микроделецией 22q11.2. По этическим причинам пришлось отказаться от использования акронима CATCH 22, созданного по первым буквам главных симптомов (Cardiac defects, Abnormal facies, Thymic hypoplasia, Cleft palate, Hypocalcemia, 22q deletion), поскольку коннотация английского слова «catch» (ловушка, западня) могло создать чувство безвыходности в семьях с больными детьми [Wulfsberg E. et al., 1996;

Shprintzen R. et al., 1998]. Как уже сказано выше, в настоящее время используется название «синдром делеции 22q11.2» или «синдром Ди Джоржи», или «вело-кардиофациальный синдром».

Диагностика СД22q11.2 развивалась в соответствии с совершенствованием методов исследования. Наблюдение семей с носительством транслокации, содержащей район q11.2 хромосомы 22 и характерным фенотипом пробандовносителей несбалансированного кариотипа с моносомией по этому участку позволило предположить, что потеря именно этого участка хромосомы 22 ведет к формированию фенотипических признаков, таких как ВПС, иммунодефицит и характерные лицевые дизморфии [de la Chapelle A. et al., 1981; Greenberg F. et al., 1984]. Эти работы относятся к 1980-м годам. В эти же годы были проведены первые исследования прометафазных хромосом, показавшие наличие делеции в районе 11. хромосомы 22 у таких пациентов [Franke U. et al., 1994; Greenberg F. et al., 1988].

Таким образом, была установлена единая этиология ранее описанных клинически синдромов, а именно – микроделеция в районе q11.2 хромосомы [Driscoll D. et al., 1992; Kelly D. et al., 1993; Scrambler P. et al., 1992; Demczuk S. et al., 1994]. Этот локус хромосомы 22 считается критическим регионом для синдрома Ди Джоржи (DGS critical region, DGCR) [Gong W. et al., 1996; Funke B. et al., 1998].

Формирование фенотипических признаков СД22q11.2 в Основные структурные нарушения при СД22q11.2, такие как конотрункальные паращитовидных желез, лицевые дизморфии, располагаются в органах, являющихся частично или полностью производными таких эмбриональных образований, как жаберные дуги и глоточные карманы.

Они в свою очередь образуются из клеток нервного гребня, мигрирующих на ранних стадиях эмбриогенеза в область будущей головы и шеи [Сосунов А.А., 1999; Ярыгин В.Н. и др., 2003]. Естественные или индуцированные мутации генов, скорее всего, играют роль в формировании, развитии и дальнейших преобразованиях нервного гребня, что экспериментально доказано при моделировании аналогичной патологии на мышах [Conway S. et al., 1997; Takahira Y. et al., 1997]. Мыши, гетерозиготные по делеции в регионе мышиной хромосомы 16 (гомологичном типично делетируемому району 22q11.2), имели дефекты, в том числе сердечно-сосудистой системы, напоминающие таковые у пациентов с СД22q11.2 [Lindsay E. et al., 1999; Clouthier D. et al., 2000]. При различном генетическом фоне, у этих мышей также обнаружены дефекты тимуса [Lindsay E. et al., 2000]. Среди многих генов-кандидатов, TBX1 (T-box 1) определен как основной ген, формирующий пороки развития, характерные для СД22q11. [Jerome L. et al., 2001; Merscher S. et al., 2001]. Точечные делеции гена TBX показали,что у гетерозиготных мышей формируются дефекты дуги аорты [Merscher S. et al., 2001]. Мыши-гомозиготы по TBX1 умирали до или сразу после рождения, имея характерные для СД22q11.2 отличительные признаки, включая дефекты выводящего тракта, гипоплазию тимуса и паращитовидных желез, расщелины неба и лицевые аномалии [Jerome L. et al., 2001].

В экспериментах на мышах с повреждением нервного гребня или наличием препятствия для миграции его отдельных клеток показана возможность появления у мышей признаков фенокопии СД22q11.2 [Kirby M., 1999; Lindsay E. et al., 2000;

Guris D. et al., 2001]. Эти наблюдения позволили предположить, что потеря генов при делеции в районе 22q11.2 влияет на клетки нервного гребня или клетки, с которыми он взаимодействует в критические фазы органогенеза. В формировании жаберных дуг и фарингеальных структур также принимает участие и эндодерма, которая может повреждаться и тератогенными факторами [Graham A., 2001; Vermot J. et al., 2003]. Таким образом, при выделении генов-кандидатов, ответственных за формирование фенотипа, характерного для СД22q11.2, исследователи уделяли особое внимание тем из них, которые участвуют в процессах формирования и миграции клеток нервного гребня, образования жаберных дуг и щелей и, в дальнейшем, структур сердца и крупных сосудов.

Неравный кроссинговер между блоками низкокопийных повторов в ходе мейоза способен приводить к дисбалансу дозы генов. Это, в свою очередь, может вызывать геномный дисбаланс, приводящий к умственной отсталости или трудностями в обучении и к врожденным аномалиям развития, как средней степени тяжести, так и тяжелыми. В целом, частота возникновения различных перестроек de novo в районе 22q11.2 достаточно высока и в этой связи большое количество исследований посвящено изучению данного района [Sutherland H. et al., 1998; Funke B. et al., 1998; Gong W. et al., 1996; Baldini A., 2002]. Для понимания механизмов, вызывающих делецию в районе 22q11.2, исследователи изучили генный состав и строение этого хромосомного района и возможные факторы, ведущие к этой делеции.

предрасположенных к перестройкам и характеризуется наличием в нем хромосомоспецифичных низкокопийных повторов или сегментных дупликаций [Emanuel B., 2008]. Многие из этих сегментных дупликаций фланкируют геномные регионы, ассоциированные с известными делеционными и дупликационными синдромами [McDermid H. et al., 1986; Yu S et al.., 2012]. Сегментные дупликации имеют высокий уровень идентичности последовательностей и вызывают неаллельную гомологичную рекомбинацию в районах, где они расположены.

Результатом этой рекомбинации могут быть делеции, дупликации и инверсии [Shaffer l. et al., 2000; Feuk L. et al., 2006]. Такие сегментные дупликации могут приводить к неправильному спариванию хроматид и неравному кроссинговеру между гомологичными хромосомами, а также к хромосомной рекомбинации внутри одной хроматиды или между сестринскими хроматидами, то есть к межхромосомной и внутрихромосомной рекомбинации [Ji Y. et al., 2000] (Рисунок 1).

Рисунок 1. Схематическое изображение возможных механизмов, приводящих к возникновению микроделеции 22q11.2 А - межхромосомная рекомбинация, Б внутрихромосомная рекомбинация (по Ji Y. et al.) При секвенировании типично делетируемого региона 22q11.2 размером 3 млн.

п. о. определены дуплицированные последовательности, находящиеся в нем, и несколько более дистально расположенных дуплицированных последовательностей.

Эти блоки последовательностей различаются по составу и организации, но содержат модули идентичные друг другу до 97-98% [Shaikh T. et al., 2001]. В исследованиях Edelmann et al. и Shaikh et al. с помощью метода FISH показано, что наличие и структурная организация сегментных дуплицированных последовательностей в районе точек разрывов напрямую связана с возникновением делеции [Shaikh T. et al., 2000; Edelmann L. et al., 1999]. Район 22q11.2 содержит по меньшей мере четыре крупных блока дуплицированных последовательностей ДНК, которые в большинстве случаев совпадают с точками разрыва возникающих типичных делеций [Emanuel B., 2008] (Рисунок 2).

Рисунок 2. Схематическое изображение организации типично делетируемого региона 22q11.2. A, B, C, D – блоки низкокопийных повторов, наиболее часто вовлеченные в перестройки и делеции района 22q11.2. (по Emanuel B., 2008) В настоящее время существуют убедительные доказательства того, что неаллельная гомологичная рекомбинация является ведущим механизмом возникновения микроделеции 22q11.2 [Baumer A. et al., 1998; Saitta S. et al., 2004].

Кроме того, Baumer et al. сообщает о высокой частоте случаев асинхронной репликации в районе 22q11.2 с более ранней репликацией отцовских аллелей [Baumer A. et al., 2004]. Иными словами, увеличение вероятности неправильного спаривания низкокопийных повторов отцовских аллелей является фактором риска формирования делеции за счет аберрантных обменов. Сами сегментные дупликации района 22q11.2 размером 100-400 тысяч нуклеотидов содержат необычные конфигурации последовательностей ДНК, а именно палиндромные повторы, богатые предрасполагающим фактором к вовлечению района 22q11.2 в различные перестройки, – транслокации, делеции, дупликации [Edelmann L. et al., 2001;

Nimmakayalu M. et al., 2003; Gotter A. et al., 2004]. В исследованиях Kurahashi et al.

показано, что участок LCR-B в районе 22q11.2 является одним из наиболее подверженных перестройкам участком человеческого генома, поскольку содержит палиндромный повтор, богатый АТ-основаниями размером 595 пар оснований (средний размер 50-100 п.о.) [Kurahashi H. et al., 2000а; Kurahashi H. et al., 2000б].

Это, в свою очередь, объясняет высокую частоту встречаемости синдрома у человека.

Характеристика типично делетируемого региона 22q11. Рубинштейна-Тейби, синдром Ангельмана, синдром Алажиля, мутации в одном гене у пациентов без делеции приводят к возникновению схожих фенотипических признаков, которые есть у пациентов с делецией [Stevens C., 2009; Dagli A. et al., 2011; Spinner N. et al., 2013]. С другой стороны, существуют микроделеционные синдромы, основные фенотипические признаки которых являются следствием гаплонедостаточности одной группы генов внутри делетированного участка.

Например, надклапанный стеноз аорты, – основной признак при синдроме Вильямса, наблюдается как у пациентов с типичной делецией 7q11.23, так и у пациентов с мутациями в гене эластина. Такой признак, как множественные хрящевые экзостозы, входящий в состав синдрома Лангера-Гидеона, является следствием мутации в гене EXT1.

исследователи предпринимали попытки к изучению типично делетируемого региона 22q11.2 для установления связи спектра фенотипических признаков при СД22q11.2 с гаплонедостаточностью только одного гена внутри этого региона, либо более крупной совокупности генов [Levy A et al., 1995; Kurahashi H. et al., 1996; Scambler P., 2000]. Распространенность СД22q11.2 в популяции человека обусловила высокий интерес именно к району 22q11.2 хромосомы 22 и таким образом, расшифровка геномного состава этого района произведена одной из первых. Результаты сиквенса хромосомы 22 впервые опубликованы в 1999 году Dunham et al. [Dunham I. et al., 1999].

Существование микроделеционных синдромов, обусловленных мутацией в одном гене, предопределило поиски такой мутации у пациентов с фенотипом СД22q11.2. Изначально попытки идентифицировать ген-кандидат были основаны на сравнении ДНК пациентов с различными размерами делеций, исходя из гипотезы, что главный ген будет в гомозиготном состоянии у всех пациентов с делецией.

Однако типичный размер делеции у большинства пациентов составляет 3 млн. п. о., что означало отсутствие большого количества генов в этом регионе при довольно широком разнообразии клинических признаков у этих пациентов. Значительные успехи были достигнуты при сравнении пациентов с интерстициальными делециями и пациентов с терминальными делециями. Эти исследования позволили предположить, что ген-кандидат скорее всего расположен в проксимальной части типично делетируемого региона 22q11.2 [Amati F. et al., 1999]. Тем не менее, поиск мутаций в генах, кодирующих белки, показал, что изменение последовательностей в исследованных генах (DGCR6-ARVCF, DGCR2) не ассоциировано с потерей их функции [Murphy K., 2005]. В дальнейшем наиболее вероятными генамикандидатами считались те, которые участвовали в развитии органов, являющихся производными эмбриональных структур, повреждаемых при делеции 22q11.2.

Поскольку при исследовании делеций с различными характерными признаками, проявляющимися у человека, конкретный ген-кандидат не выявлен, провели эксперименты на животных. Для проверки гипотезы формирования фенотипа вследствие гаплонедостаточности нескольких генов в типично делетируемом регионе 22q11.2 использовали мышиные модели. Эти эксперименты оказались возможными, поскольку гены, делетированные у пациентов с СД22q11.2, за небольшим исключением, находились в аналогичном кластере генов мышиной хромосомы 16 и оказались довольно высоко консервативны [Botta A. et al., 1997;

Puech A. et al., 1997; Sutherland H. et al., 1998]. Это привело к гипотезе, что гаплонедостаточность гена(-ов) в районе делеции приводит к нарушению развития этих структур.

Мыши, гетерозиготные по делеции части региона мышиной хромосомы 16, гомологичной типично делетируемому району хромосомы 22q11.2, имели дефекты сердца, напоминающие таковые у пациентов с СД22q11.2 [Lindsay E. et al., 1999;

Jerome L. et al., 2001; Merscher S. et al., 2001]. При делеции этого же региона под воздействием различных генетических модификаторов у мышей также обнаружены дефекты тимуса, причем признаков влияния неделетированных аллелей генов в типично делетируемом регионе не показано [Linsay E. et al.,, 2000; Taddei I. et al., 2001]. Дальнейшие трансгенные эксперименты на мышах позволили сузить интервал региона, ответственный за формирование фенотипических особенностей данной патологии [Puech A. et al., 2000; Lindsay E. et al., 2001]. На основании особенностей эмбриональной экспрессии в мезодерме фарингеальных структур, наилучшим геномкандидатом оказался TBX1. Этот ген относится к семье генов T-box - ДНКсвязывающих транскрипционных факторов. Показано, что T-box гены играют важную роль в регуляции процессов развития. Гаплонедостаточность двух T-box генов, TBX3 и TBX5, ассоциирована с генетическими болезнями – синдром Шинцеля и синдром Холт-Орама, соответственно. В 2001 году три независимые группы исследователей опубликовали работы, где в экспериментах на нуллисомных по TBX мышах продемонстрированы повреждения всех основных анатомических структур, затрагиваемых при СД22q11.2 [Jerome L. et al., 2001; Lindsay E. et al., Merscher S. et al., 2001].

гетерозиготных мышей обнаружены дефекты дуги аорты [Jerome L. et al., 2001;

Lindsay E. et al.; Merscher S. et al., 2001]. Мыши-гомозиготы по TBX1 умирали до или сразу после рождения, имея характерные для СД22q11.2 отличительные признаки, включая дефекты выводящего тракта, гипоплазию тимуса и паращитовидных желез, расщелины неба и лицевые аномалии [Jerome L. et al., 2001]. Эти данные четко свидетельствуют о том, что ген TBX1 является геном-кандидатом номер один для многих ключевых признаков СД22q11.2. Мутационный анализ TBX1 у пациентов с фенотипом, характерным для СД22q11.2, но с отсутствием делеции 22q11.2, может способствовать пониманию роли TBX1 в этиологии этих синдромов [Gong W. et al., 2001].

детерминирующим фактором, один или несколько других генов делетируемого региона могут играть независимую или модифицирующую роль в развитии физических аномалий, характерных для синдрома. К настоящему моменту существуют данные о потенциальной значимости генов, картированных в типично делетируемом регионе 22q11.2 [Gogos J. et al., 1999; Jacquet H et al., 2002; De Lucia F. et al., 2001].

Фенотипические признаки СД22q11.2 и другие делеции, приводящие Чаще всего в качестве этологического фактора у пациентов с клинически установленной картиной этого синдрома встречается делеция 22q11.2. Реже могут встречаться атипичные дистальные делеции меньшего размера или транслокации, захватывающие часто делетируемую область в хромосоме 22 [Verhagen J. et al., 2012;

Ensenauer R. et al., 2003]. В ряде случаев, однако, даже при наличии характерного фенотипа у пациентов, делеция 22q11.2 не выявляется [Stachon A. et al., 2007]. Как правило, делеция возникает de novo, и повторный риск ее возникновения низкий [McDonald-McGinn D. et al., 2013]. В семьях, где один из родителей является носителем микроделеции 22q11.2, риск повтора может достигать 50%. Сведения о наследовании делеции 22q11.2 разноречивы: различные группы исследователей установили, что она может наследоваться в 6-28% случаев [Ryan A. et al., 1997;

McDonald-McGinn D. et al., 2001a]. В работе Torres-Juan et al. приводятся результаты мета-анализа литературных сообщений о родительском происхождении делеции 22q11.2, основным выводом которого является достоверно более высокое наследование делеции от матери, чем от отца [Torres-Juan L. et al., 2007].

Наследование делеции 22q11.2 может происходить вследствие наличия у одного из родителей мозаичного по этой микроделеции клона клеток, сбалансированных транслокаций или, наиболее часто, в связи с наличием такой же микроделеции, причем фенотип ее носителя, как правило, значительно мягче [Consevage M. et al., 1996; McDonald-McGinn D. et al., 2001a]. В таких семьях рекомендованы генетическое консультирование и пренатальная/предимплантационная диагностика с целью выявления микроделеции 22q11.2 у плода, в связи с аутосомно-доминантным типом ее наследования. Описаны случаи рождения сибсов с СД22q11.2 в семьях, где оба родителя не являются носителями делеции и это позволяет предположить возможность гонадного мозаицизма с клоном клеток, гомозиготным по району делеции 22q11.2 [Hatchwell E. et al., 1998; Sandrin-Garcia P. et al., 2002].

Размер делеции в большинстве случаев составляет 3 млн. п.о. Делеции меньшего размера (1,5-2 млн. п.о.) встречаются реже и могут не включать часть обычно делетируемой области [Ji Y. et al., 2000]. Однако связь между размерами делеции (с различными точками разрыва) и тяжестью фенотипических проявлений у пациента до настоящего времени не установлена в большинстве опубликованных исследований [Carlson C. et al., 1997; Kerstjens-Frederikse W. et al., 1999; Weksberg R.

et al., 2007]. Имеется дискордантность фенотипов у носителей делеции одного размера внутри одной семьи и даже у монозиготных близнецов с одной и той же делецией [Halder A. et al., 2012]. Таким образом, фенотипические вариации могут быть следствием различного генетического фона, воздействий окружающей среды или носить стохастический характер.

Ди Джоржи-подобный фенотип, или аномалии, характерные для СД22q11.2, в различном сочетании могут встречаться не только у пациентов без делеции 22q11.2, но и среди пациентов с делециями в локусах других хромосом.

Так, к настоящему моменту имеются сведения о примерно 100 пациентах с так называемым синдромом «Ди Джоржи II», этиологическим фактором которого является делеция в коротком плече хромосомы 10, который характеризуется типичными для СД22q11.2 лицевыми дизморфиями, гипопаратиреоидизмом, трудностями обучения, наличием пороков сердца, почек и другими патологическими признаками. Район 10p13-14, также известный как DGS II район, содержит гены, ответственные за формирование конотрункальных пороков сердца [Daw S. et al., 1996, Berend S. et al., 2000].

Потеря хромосомного материала в районе короткого плеча хромосомы 8 (8p23) ассоциирована с наличием ВПС, а делеция в районе 9q34 связана с ВПС, эпилептическими судорогами и умственной отсталостью (OMIM#610254) [Devriendt et al 1999].

Ди Джоржи-подобный фенотип также описан при терминальных делециях в районе длинного плеча хромосомы 4 (4q340qter) и короткого плеча хромосомы (17p13.3) [Tsai C. et al., 1999; Greenberg F. et al., 1988].

Таким образом, наличие фенотипических признаков, характерных для СД22q11.2, само по себе еще не означает наличие делеции. Необходима лабораторная диагностика, включающая комплекс современных молекулярных методов.

Разнообразие спектра клинических симптомов, формирующих группу СД22q11.2, осложняет дифференциальную диагностику этих заболеваний на основании только клинического обследования. В зависимости от превалирующего проявления заболевания пациенты с подозрением на СД22q11.2 могут наблюдаться специалистами разного профиля кардиологического, хирургического, иммунологического, неврологического и других. Однако, при постановке диагноза СД22q11.2 необходимо учитывать и другие возможные проявления, характерные для этой группы синдромов. Например, умственная отсталость различной степени тяжести, трудности в обучении, ассоциированные с делецией 22q11.2, наблюдаются примерно у половины пациентов, но в раннем возрасте могут еще не проявляться [Niklasson L. et al., 2001]. Существуют также достоверные данные о повышенной вероятности развития у них расстройств шизофренического спектра, которые могут проявляться в более позднем возрасте [Papolos D et al., 1996; Bassett A. et al., 1998]. В связи с этим существует необходимость в повышении осведомленности и мотивации врачей различных специальностей в проведении лабораторной диагностики при наличии характерных для СД22q11.2 клинических признаков у пациентов. Для лабораторной диагностики СД22q11.2 применяют как прямые, так и косвенные методы выявления микроделеции, основанные на молекулярном или молекулярноцитогенетическом подходах.

Микросателлитный анализ – это косвенный молекулярный метод диагностики СД22q11.2, основанный на анализе полиморфизма микросателлитных последовательностей, перекрывающих область делеции 22q11.2. Он позволяет выявить наличие делеции и оценить ее размер. Исследование проводится на основе семейного анализа с использованием образцов крови пациента и его родителей.

Недостатком исследования микросателлитных повторов является необходимость семейного анализа, кроме того, некоторые делеции могут не выявляться, поэтому возникает острая необходимость использования прямой диагностики синдромов молекулярными или молекулярно-цитогенетическими методами [Fernndez L. et al., 2005].

Наиболее распространенным в настоящее время является молекулярноцитогенетический метод диагностики делеции 22q11.2 с использованием FISHметода с локус-специфичными ДНК-зондами на критический для данной микроделеции район q11.2 длинного плеча хромосомы 22. FISH-метод в этом случае является таргетным и позволяет напрямую определить наличие или отсутствие делеции у пациента. Этот метод позволяет выявлять микроделецию 22q11.2 при ее наличии более чем в 95% случаев [Rauch A. et al., 2005].

Мультиплексная проба-зависимая лигазная реакция с последующей амплификацией (Multiplex ligation-dependent probe amplification, MLPA) является еще одним современным «прямым» количественным высокоточным методом молекулярной диагностики генного дисбаланса вообще, и делеции 22q11.2 в частности, не требующим семейного анализа.

Метод MLPA позволяет в одной реакции не только выявить делецию 22q11. (как типичную, так и атипичную), но и её размер. Современный набор P250-B DiGeorge Syndrome (MRC-Holland) для MLPA содержит не только ДНК-пробы на локусы типично делетируемого региона 22q11.2, но и пробы на локусы в других хромосомах (10p14, 4q34-qter, 8p23, 17p13.3, 9q34.3, 22q13), делеции которых обуславливают фенотипические признаки, схожие с СД22q11.2, в т.ч. пороки сердечно-сосудистой системы.

Микроделеция и ее размеры могут быть выявлены также с помощью метода современных молекулярных методов, таких как микроматричный анализ, MLPA, qPCR позволяет значительно увеличить эффективность и чувствительность диагностики субмикроскопических аберраций, в том числе CД22q11.2 [Fernndez L.

et al., 2005; Beaujard M. et al., 2009].

Секвенирование, или определение нуклеотидной последовательности гена TBX1, фенотипических признаков, характерных для СД22q11.2, может быть использовано для установления вариаций числа копий генов, т.е. наличия или отсутствия мутаций в этих областях.

1.7.1. Особенности пренатальной диагностики микроделеции 22q11. С развитием и совершенствованием технических средств при исследовании и диагностике различных генетических синдромов в настоящее время представилась постнатальном, но и в пренатальном периоде онтогенеза человека.

Одной из ключевых задач ПД является наиболее ранняя и достоверная диагностика патологии плода, которая впоследствии может приводить к гибели или тяжелой инвалидизации ребенка. В ПД традиционно существует ключевой вопрос формирования среди беременных женщин групп риска по такой частой патологии, как ХА у плодов. Пренатальный комбинированный скрининг беременных, включающий измерение уровней сывороточных маркеров в крови матери, а также выявление пороков развития и ультразвуковых маркеров ХА при эхографическом исследовании плода, позволяет сформировать среди беременных женщин группу риска по наиболее частым числовым хромосомным синдромам. При этом структурные аберрации, в частности микроделеции, составляющие значительную часть ХА, не выявляют при этих методах ПД..

В отличие от анеуплоидий, фенотипические проявления при многих микроделеционных синдромах в пренатальный период развития, как правило, не выражаются грубыми пороками развития. В ранние сроки беременности единственным методом, позволяющим исследовать фенотип плода является ультразвуковое исследование Поиск специфических эхографических маркеров и их ассоциаций, способных отражать полиморфную клиническую картину, присущую микроделеционным синдромам, является новым актуальным аспектом ПД.

Диагностика редких хромосомных синдромов, обусловленных мелкими проблематична, т.к. требует использования нестандартных дополнительных эхографических маркеров и молекулярных методов исследования для постановки диагноза. В постнатальном периоде эти синдромы часто сопровождаются задержкой развития, врожденными пороками и микроаномалиями развития, широким спектром неспецифических лицевых дизморфий, и составляют значительную долю среди пациентов с недифференцированной УО. Их диагностика возможна лишь при использовании современных молекулярных методов (FISH, CGH, MLPA).

Суммарная частота редких структурных ХА среди новорожденных достаточно высока, достигая по результатам Европейского мультицентрового исследования 17% среди всех выявленных ХА [Wellesley D. et al., 2012]. Важным является составление регистров и определение частоты и вида патологии, обусловленной редкими ХА в различных регионах Европы. Отмечено, что примерно в половине случаев при редких ХА наблюдались различные отклонения в развитии, которые могут быть выявлены при эхографии плода [Baena N. et al., 2003; Wellesley D. et al., 2012].

В ранние сроки беременности обнаружение фенотипических особенностей у плода, характерных для того или иного генетического синдрома, является сложной задачей. В большинстве случаев в ходе УЗИ у плода выявляются либо пороки развития, либо «мягкие» эхографические маркеры, при которых могут быть заподозрены как крупные ХА, хорошо различимые при использовании GTG-метода, так и мелкие структурные аберрации или нормальный кариотип. К эхографическим маркерам, которые могут встречаться при микроделециях у плода, относятся:

дефекты сердечно-сосудистой системы, дисплазия почки, поликистоз почки, относительное укорочение трубчатых костей, сколиоз, аномалии кистей и стоп, аномалии головного мозга, лицевые расщелины, аномалии глаз, носа, ушных раковин и др.[Baena N. et al., 2003]. Их перечень может быть обширным, а выявление во многом зависит от квалификации и мотивации врачей ультразвуковой диагностики, технической оснащенности, т.е. класса аппаратуры для УЗИ.

Описание необычных пренатальных фенотипов, совершенствование техники эхографических исследований, а также квалификация и мотивация врачей ультразвуковой диагностики к раннему выявлению генетических синдромов, являются крайне актуальными для ПД генетических нарушений у плода. Поиск дополнительных эхографических маркеров, способных отражать полиморфную клиническую картину, присущую микроделеционным синдромам, является новым актуальным аспектом ПД.

В дородовом периоде единственным методом распознавания у плода фенотипических нарушений развития, в том числе, связанных с возможными микроперестройками хромосом, является УЗИ плода. Однако многие клинические проявления СД22q11.2 в постнатальном периоде невозможно или трудно выявить с помощью УЗИ. В пренатальном периоде при обнаружении различных стигм дисэмбриогенеза или «мягких» эхографических маркеров у плодов с нормальным кариотипом расширенное молекулярно-цитогенетическое исследование могло бы способствовать выявлению микроделеционных синдромов. В этих случаях «классический» GTG-метод анализа хромосом может быть недостаточным для постановки точного диагноза, а заранее спланировать расширенное молекулярноцитогенетическое исследование плода сложно, т.к. всегда имеется ограничение материала, полученного при инвазивном вмешательстве. В этих случаях следует архивировать некоторое количество плодного материала (клеток) для последующего дополнительного молекулярного исследования в виде запасных хромосомных препаратов, образцов клеток крови или ДНК плода [Hollis B. et al., 2001; Lautrup C. et al., 2008; Besseau-Ayasse J. et al, 2014].

Впервые ПД СД22q11.2 начали осуществлять в середине 1990-х годов [Driscoll D. et al., 1993; Van Hemel J. et al.,1995; Raymond F. et al., 1997]. Однако ПД этого синдрома до сих пор широко не распространена, особенно в нашей стране. Хотя, частота встречаемости данного синдрома в популяции человека позволяет сделать предположение о целесообразности включения его в перечень заболеваний, охваченных программой неонатального скрининга. Многие клинические проявления этой патологии в постнатальном периоде (задержка речевого, психомоторного развития, умственная отсталость, некоторые лицевые дизморфии) невозможно или трудно выявить с помощью УЗИ.

Нарушения эмбриогенеза и органогенеза, происходящие вследствие делеции 22q11.2, и возникающие в этой связи структурные поражения, такие как различные пороки сердечно-сосудистой системы, аплазия и гипоплазия тимуса и паращитовидных желез, лицевые дизморфии и расщелины губы и/или неба, могут предопределить подходы к диагностике подобных аномалий у плода уже внутриутробно.

В первом триместре важным эхографическим маркером ХА у плода является увеличенное ВП. По данным европейских мультицентровых исследований 2003гг. показано, что в среднем в 30% наблюдений с расширенным ВП выявляют числовые ХА у плода, что значительно выше, чем при отсутствии этого признака (1th World Congress on Ultrasound in Obstetrics and Gynecology, 2004]. Частота выявления ХА у плодов с увеличенным ВП в I триместре возрастает в зависимости от абсолютной величины этого показателя [Николаидес К., 2007; под ред. Юдиной Е.В., Медведева М.В., 2000].

Увеличенное ВП в I триместре является полипотенциальным фактором риска, поскольку при его наличии у плодов резко увеличивается не только вероятность выявления ХА, но и пороков развития [14th World Congress on Ultrasound in Obstetrics and Gynecology, 2004; Hyett J. et al., 1999]. Некоторые исследователи считают, что риск обнаружения патологии сердечно-сосудистой системы у плодов с расширенным ВП выше, чем других пороков [Galindo A. et al., 2003: Makrydimas G.

Et al., 2003; Westin M. et al., 2006; Simpson L. et al., 2007]. Выявление у плода расширенного ВП в I триместре является показанием для детальной динамической оценки анатомии плода с применением всех возможных эхографических технологий уже во II триместре беременности.

Показано, что часто беременность плодами с увеличенным ВП протекает с осложнениями и может закончиться неблагоприятно. По данным Bilardo et al., неблагоприятно, т.е. рождением ребенка не только с аномалиями развития, но и с задержкой роста и/или психомоторного развития, которая впоследствии может проявиться умственной отсталостью разной степени тяжести и быть признаком различных генетических синдромов [Bilardo C. et al., 2007]. Именно в этой подгруппе детей могут быть диагностированы структурные ХА, которые не подлежат диагностике с помощью стандартного цитогенетического исследования GTG-методом, в том числе микроделеции 22q11.2.

Первый случай пренатального выявления делеции 22q11.2 у плода с увеличенным ВП описан Lazanakis at al. [Lazanakis M. et al., 1998]. Однако позднее при исследовании больших выборок плодов с расширенным ВП другими авторами делеция 22q11.2 не выявлена [Hollis B. et al., 2001; Donnenfeld A. et al., 2006; Lautrup C. et al., 2008]. В то же время, другие исследователи выявляли делецию 22q11.2 в единичных случаях у плодов с расширенным ВП и/или развившимися впоследствии ВПС [Machlitt A. et al., 2002; Zosmer N. et al., 1999; McAuliffe F. et al., 2004].

характеристики гораздо большего количества органов и структур. В период с 15 по 17 неделю беременности при использовании аппаратуры для УЗИ с высоким разрешением и с применением объемной реконструкции становится возможным пренатальное определение патологии различных структур сердца, тимуса, дефектов развития мочеполовой системы, других стигм дисэмбриогенеза. По данным некоторых авторов, у плодов с внутриутробно диагностированной патологией сердца, СД22q11.2 может быть выявлен в 3-5,5% наблюдений [Moore J. et al., 2004;

Bretelle F. et al., 2010]. При УЗИ можно определить у плода форму и расположение ушных раковин, особенности формирования глаз, носа и т.п.. В эти сроки беременности достоверно диагностируются некоторые другие пороки развития плода (например, расщелины губы/неба, дефекты тимуса, почек) [Felker R. et al., 1989; Chaoui R et al., 2002; Zalel Y. et al., 2002; Козлова Ю.О. и др., 2012].

В обширном мультицентровом исследовании, проведенном во Франции, представлены результаты 272 беременностей плодами с делецией 22q11.2.

Проанализированы эхографические и аутопсийные исследования, а также исходы беременностей. Авторы из 39 пренатальных центров отметили сложности и особенности ПД СД22q11.2. В работе продемонстрировано, что пороки развития почек, тимуса и лицевые дизморфии у плода трудно диагностируются при УЗИ даже во II триместре беременности. Подробное эхографическое исследование плодов в этом периоде требует не только длительного времени самого исследования и высокой квалификации врачей, но и использования аппаратуры современного класса (3D/4D) [Besseau-Ayasse J. et al., 2014]. По сравнению с результатами аутопсийных диагнозов пороки развития мочеполовой системы (МПС), тимуса и лицевых структур распознают при эхографической диагностике в 3, 14 и 12 раз реже, соответственно [Besseau-Ayasse J. et al., 2014].

В настоящее время показаниями для ПД делеции 22q11.2 у плода считаются выявленные при эхографическом исследовании конотрункальные пороки сердца, наличие в семье ребенка с СД22q11.2, случаи носительства данной микроделеции или транслокации с вовлечением хромосомы 22 у одного из родителей.

Также необходимо упомянуть о технологии современного мультиплексного пренатального анализа с помощью сферических биочипов для молекулярного кариотипирования (BoBs-on-Beads) в целях выявления анеуплоидий хромосом 21, 13, 18, X и Y и десяти микроделеционных синдромов, включая СД22q11.2 [Vialard F.

et al., 2011]. Этот метод с одной стороны, позволяет получить необходимые данные о наличии или отсутствии патологии у плода, а с другой стороны не дает лишних трудно интерпретируемых сведений о носительстве полиморфных вариантов неясной значимости (SNP,CNV) у плода.

Несмотря на большую разрешающую способность современных молекулярных методов в диагностике генетических дефектов таких, как arrayCGH, BoBs и MLPA для ПД в целом, и для диагностики СД22q11.2 в частности, к их недостаткам можно отнести высокую стоимость анализа, трудности и нередко – неоднозначность интерпретации полученных результатов, ограниченность инвазивного материала и, как следствие, сложность в повторном или расширенном молекулярном исследовании, а также проблемы в воспроизводимости тестов [Mademont-Soler I. et al., 2012].

Как уже говорилось ранее, среди пациентов с подтвержденной микроделецией 22q11.2 отмечается выраженный клинический полиморфизм. У пациентов с этим синдромом описано более 180 клинических признаков в различном сочетании, затрагивающих почти все органы и системы органов человека. Спектр клинических проявлений, характерных для СД22q11.2, довольно широк и перекрывается со спектром проявлений, характерным и для других синдромов, таких как с. СмитМагенис, с. Нунан, с. Вильямса, с. Шерешевского-Тернера, с. Алажиля, с.

Гольденхара, с. Смит-Лемли-Опитца, ассоциацией CHARGE [Shprintzen R., 2001;

Pagon R., 1987; McDonald-McGinn D. et al., 1996; McDonald-McGinn D. et al., 2013].

Клинический полиморфизм, присущий СД22q11.2, затрудняет однозначную постановку диагноза на основании только лишь фенотипических проявлений синдрома.

подтвержденной делецией 22q11.2 являются ВПС, иммунодефицит средней и тяжелой степени, гипокальциемия примерно у половины пациентов, аномалии почек и дисфагические явления у трети больных, аномалии развития более, чем у 90% пациентов [Sullivan K. et al., 1998; McDonald-McGinn D. et al., 1997а; McDonaldMcGinn D. et al., 1997б; Sullivan K. et al., 2005].

ВПС выявляются в 75% случаев у пациентов с СД22q11.2 и являются основной причиной смертности этих больных (90%) [McDonald-McGinn D. et al., 2001; Ryan A. et al., 1997]. В исследовании McDonald-McGinn D. et al. наиболее частыми ВПС при СД22q11.2 являлись тетрада Фалло – в 22% случаев, прерванная дуга аорты – в 15% и дефект межжелудочковой перегородки – в 13% случаев. Также отмечены общий артериальный ствол (7%), сосудистое кольцо (5%), дефект межпредсердной перегородки (3%), аномалии дуги аорты (3%), сочетание дефекта межжелудочковой перегородки с дефектом межпредсердной перегородки (4%) и другие (4%) [McDonald-McGinn D. et al., 2001].

Аномалии строения черепно-лицевых структур у пациентов с СД22q11. включают аномалии строения и расположения ушных раковин, аномалии строения носа (выступающий корень носа, большой нос, гипоплазия крыльев носа, раздвоение кончика носа), узкие глазные щели, гипертелоризм, расщелины губы и неба, асимметрия лица и краниосиностоз [Gripp K. et al., 1997; McDon-McGinn D. et al., 2005б]. Однако наличие только этих черепно-лицевых аномалий, в том числе вытянутого лица, не является патогномоничным и может варьировать, особенно с учетом расовой принадлежности пациентов [McDon-McGinn D. et al., 2005в].

Гипоплазия или аплазия тимуса у пациентов с СД22q11.2 вызывает иммунодефицит, который в первую очередь проявляется недостаточностью Тклеточного звена иммунитета. В исследовании 60 пациентов с подтвержденной делецией 22q11.2 в возрасте старше 6 месяцев в 77% случаев отмечен и подтвержден иммунодефицит вне зависимости от наличия или отсутствия его клинических проявлений [Sullivan K. et al., 1998; Sullivan K. et al., 2004]. Дополнительным частым признаком у больных с СД22q11.2 является аспирационная пневмония, связанная как с дисфагическими явлениями (частые поперхивания вследствие неправильного строения велофарингеальных структур), так и со снижением иммунологического статуса.

Аномалии строения неба встречаются у 69% пациентов с СД22q11. [McDonald-McGinn D. et al., 2013]. При этом велофарингеальная недостаточность, которая может выражаться как в дефектах строения неба (короткое небо), так и в нарушении функции (гипотония велофарингеальной мускулатуры), или в их комбинации проявляется в 27% случаев [Zori R. et al., 1998]. Таким образом, около трети пациентов с СД22q11.2 в возрасте до года имеют трудности вскармливания, часто проявляющиеся в виде тяжелой дисфагии с необходимостью использования назогастрального зонда или гастростомии, назофарингеальный рефлюкс [Eicher P. et al., 2000]. Это может, в свою очередь, приводить к недостаточному питанию пациентов и дальнейшему нарушению иммунного статуса.

Также в 16% случаев СД22q11.2 встречаются подслизистая расщелина неба и в 11% – открытая расщелина неба [McDonald-McGinn D. et al., 1999]. Около 17% пациентов с синдромом не имеют фенотипических проявлений, связанных с аномалиями строения неба [McDonald-McGinn D. et al., 2001].

Гипокальциемия, обусловленная патологией паращитовидных желез, выявляется у 17-60% пациентов с СД22q11.2 и обычно имеет самые серьезные осложнения в неонатальном периоде. Несмотря на то, что уровень кальция может приходить в соответствие с нормой при взрослении пациентов, не исключено проявление гипокальциемии в критические периоды развития индивида (пубертатный период, стресс, беременность, болезнь) [McDonald-McGinn D. et al., 2013].

Психомоторное развитие пациентов с СД22q11.2, как правило, задержано. У многих пациентов с СД22q11.2 наблюдают гипотонию в неонатальном периоде, средний возраст начала хождения составляет 18 месяцев. Отмечают задержку речевого развития (начало в 2-3 года), аутистические нарушения примерно у 20% пациентов и трудности в обучении в школьном возрасте, однако специфические нарушения со стороны центральной нервной системы не характерны [Fine S. et al., 2005; Moss E. et al., 1995].

импульсивность с одной стороны, и застенчивость и замкнутость, с другой.

Наблюдается дефицит внимания, тревожность, сложности социализации [Niklasson L. et al., 2001]. Частота психиатрических расстройств, включая шизофрению, биполярные расстройства, депрессию, у таких пациентов повышена [Bassett A. et al., 2005; Oskarsdottir S. et al., 2005].

Аномалии со стороны мочеполовой системы наблюдаются примерно у трети пациентов с СД22q11.2 и включают аплазию одной почки, эхогенные включения в почках, поликистоз почек, подковообразную почку, гидронефроз [Wu H. et al., 2002].

необходимость в комплексном подходе к диагностике и лечению таких пациентов определяет большую значимость их раннего выявления и клинического ведения. В связи с развитием паллиативной медицинской помощи, в первую очередь кардиохирургии, смертность таких больных становится относительно низкой (около 4%) и зависит от тяжести имеющихся пороков развития [Bassett A. et al., 2011]. Тем не менее, в связи с наличием фенотипических проявлений, приводящих к серьезным медицинским проблемам (ВПС; гипокальциемические судороги; иммунодефицит, часто связанный с аномалиями развития тимуса; аномалии неба; отставание в развитии; аномалии поведения и психические заболевания), пациенты с этим синдромом нуждаются в различных видах медицинской помощи. Таким образом, пациенты с СД22q11.2, как правило, постоянно находятся под наблюдением того или иного специалиста, однако значительная вариабельность клинических проявлений, включая легкие формы с асимптоматическим, часто не позволяет своевременно заподозрить заболевание и провести лабораторную диагностику. В то же время ранняя диагностика очень важна для эффективной профилактики осложнений заболевания и медико-генетического консультирования семьи по поводу прогноза потомства.

В Российской Федерации до сих пор не проведено сколько-нибудь значительного исследования в контингентах пациентов с клиническими проявлениями, характерными для СД22q11.2. Из обзора данных литературы видно, что такие пациенты могут находиться под наблюдением различных специалистов, в зависимости от превалирующего проявления заболевания и в то же время иметь ряд других, не менее тревожащих симптомов, не только физических, но и когнитивных, таких, как девиантное поведение, низкая социализация и проблемы шизофренического спектра. Проведение исследования позволит описать частоту встречаемости синдрома, спектр клинических проявлений у пациентов и привлечь внимание врачей различных специальностей к комплексному обследованию пациентов с подозрением на СД22q11.2.

ГЛАВА 2. МАТЕРИАЛЫ И МЕТОДЫ

Определение частоты и спектра клинических проявлений, лабораторная и пренатальной – при исследовании плодов с эхографическими маркерами СД22q11.2, и постнатальной – при исследовании пациентов с комплексом фенотипических отклонений, характерных для CД22q11.2.

Формирование и методы исследования пренатальной группы Для изучения проявлений СД22q11.2 в пренатальном периоде развития, что являлось одной из задач диссертационного исследования, сформирована выборка из 60 беременных женщин и проведено пренатальное исследование в двух группах: наблюдения плодов в I и 38 наблюдений – во II триместре беременности.

Показанием для направления на ПД CД22q11.2 в I триместре являлось наличие одного из следующих признаков: увеличенное ВП, ВПС, лимфатические образования в области шеи плода. Именно эти признаки можно выявить при УЗИ плода в I триместре и, согласно литературным данным, они могут являться маркерами СД22q11.2 в пренатальном периоде развития.

Во II триместре показанием к исследованию являлось наличие одного из следующих признаков: ВПС, пороки развития МПС, задержка внутриутробного развития плода (ЗВРП), аномалии развития неба, гиперэхогенные включения в желудочках сердца плода. Эти проявления являются характерными для СД22q11.2 в постнатальном периоде развития, могут быть распознаны пренатально и служить показанием к лабораторной диагностике синдрома в дородовом периоде.

Цитогенетическое пренатальное исследование в I триместре проводили по стандартному протоколу на полупрямых препаратах ворсин хориона/плаценты, во II триместре – на препаратах из культуры лимфоцитов пуповинной крови плодов (КЛПК), полученных по стандартному протоколу с использованием GTGокрашивания хромосом. Основным методом пренатальной молекулярноцитогенетической диагностики СД22q11.2 в представленном исследовании являлся метод FISH с локус-специфичным ДНК-зондом TUPLE1/ARSA (Abbott Molecular) на критический по данной микроделеции регион 22q11.2 по протоколу фирмыпроизводителя. Кариотипы всех плодов, отобранных для последующей молекулярно-цитогенетической диагностики, оказались нормальными при исследовании GTG-методом.

трансвагинальным доступом с использованием ультразвуковых аппаратов среднего или экспертного уровня (EnVisor – производителя Philips, SA X8 – производителя Medison, Voluson E8 производителя GE). Измерение ВП проводилось в интервале 11недель, при копчико-теменном размере плода 45-85 мм в строго саггитальной нормативных для срока значений [под ред. Медведева М.В., 2002].

Разработка карты-анкеты для направления на лабораторную диагностику СД22q11.2 и формирование постнатальной группы пациентов При анализе литературных данных с описанием фенотипических признаков, характерных для СД22q11.2 определено 10 критериев, – наиболее характерных проявлений синдрома, – которые вошли в карту-анкету. Карта-анкета использована для формирования группы риска и направления пациентов на молекулярноцитогенетическое исследование СД22q11.2 в постнатальном периоде (Рисунок 3).

молекулярно-цитогенетическую диагностику микроделеции 22q11. При рождении: масса_, рост_, окр. головы_, окр.

груди_ Показания для направления на исследование (отметить признаки, имеющиеся у ребенка) Врожденный порок сердца (указать форму порока) Отсутствие/гипоплазия тимуса Снижение иммунитета Гипокальциемия (указать уровень Са крови) Расщелина неба Длинные, тонкие пальцы рук Большой нос с узким основанием крыльев Узкие глазные щели Маленькая нижняя челюсть Аномалии ушных раковин (указать какие) Другие аномалии и пороки развития (Если при УЗИ, рентгенографии и др. исследованиях внутренних органов аномалий не выявлено, просьба указать отсутствие патологии и дату исследования) Заболевания и операции Откуда направлен, контактный телефон Рисунок 3. Карта-анкета для формирования группы риска.

Карта-анкета включает основные данные: фамилию, имя и отчество пациента, дату рождения, пол, краткие биометрические данные и наиболее характерные фенотипические проявления СД22q11.2. Наряду с наиболее распространенными признаками, характерными для синдрома, такими, как ВПС, расщелины неба, картаанкета включает специфические лицевые дизморфии и перечень микроаномалий развития, наиболее часто встречающиеся у пациентов с СД22q11.2. Это было сделано для акцентирования внимания врачей на микропризнаках, тем не менее, важных для характеристики фенотипа. В анкету также был включен отдельным пунктом такой признак, как гипокальциемия. Поскольку неонатальная гипокальциемия, возникшая вследствие гипопаратиреоидизма, так же как и иммунологические расстройства, статистически достоверно связаны с наличием делеции 22q11.2 [Monteiro F. et al., 2013]. До проведения данного исследования и составления карты-анкеты врачи различных специальностей направляли пациентов на лабораторную диагностику СД22q11.2 по превалирующему симптому заболевания, как правило, своего профиля, без учета других признаков. Или вовсе диагноз ставили только клинически, без лабораторного исследования.

В дальнейшем пациентов направляли на диагностику микроделеции 22q11. преимущественно из клинических педиатрических отделений кардиологического профиля при наличии и/или сочетании следующих фенотипических признаков: ВПС, характерные черепно-лицевые дизморфии (большой нос с узким основанием крыльев, узкие глазные щели, маленькая нижняя челюсть, расщелины неба и/или губы), аномалии ушных раковин, длинные тонкие пальцы рук. Дополнительно, по возможности, в анкете учитывался такой признак, как гипокальциемия.

За период с 2010 по 2012 годы включительно цитогенетически и молекулярноцитогенетически обследовано 140 пациентов с фенотипом, характерным для группы синдромов, связанных с микроделецией 22q11.2. Обследованная выборка по полу включала 62 мальчика и 78 девочек. Возраст пациентов варьировал от нескольких дней до 15 лет. Средний возраст составил 1,1 года. Среди 140 пациентов большинство поступило на диагностику в возрасте до 1 года (129 пациентов), пациентов в возрасте от 1 года до 7 лет и 4 пациента в возрасте от 7 до 15 лет.

Методы исследования постнатальной группы пациентов В ходе работы использованы различные лабораторные методы исследования, а также статистические методы обработки полученных данных.

2.3.1. Цитогенетическое исследование Во всех случаях проведено стандартное цитогенетическое исследование GTGметодом на уровне 500 бэндов. В 2 из 140 случаев у пациентов выявлены ХА. Эти наблюдения не вошли в дальнейшее исследование.

2.3.2. Молекулярно-цитогенетическое исследование Молекулярно-цитогенетическая диагностика проведена методом FISH в случаях пациентам с нормальным кариотипом на препаратах из культур лимфоцитов периферической крови с локус-специфичным ДНК-зондом TUPLE1/ARSA (Abbott Molecular) на критический регион по микроделеции 22q11.2, использованный в соответствии с протоколом фирмы-производителя.

2.3.3. Мультиплексная лигазная полимеразная цепная реакция (MLPA) Для расширения диагностических возможностей при наличии доступного для исследования материала, параллельно с FISH исследованием использован метод MLPA (n=77). Материалом для исследования служили образцы ДНК, выделенной из лимфоцитов периферической крови пробандов, взятой с ЭДТА, методом фенолхлороформной экстракции и из взвесей клеток культуры лимфоцитов, зафиксированных в фиксаторе Карнуа. В последнем случае выделение ДНК проводили с помощью набора Wizard® Genomic DNA Purification Kit (Promega, USA) по протоколу производителя. В исследовании методом MLPA для выявления аберраций в локусе 22q11.2 использовали набор P250-B1 DiGeorge Syndrome (MRCHolland) согласно протоколу производителя. Кроме 29 проб, маркирующих типично делетируемый регион 22q11.2, в набор P250-B1 включены ДНК-пробы на локусы других хромосом: 10p14, 4q34-qter, 8p23, 17p13.3, 9q34.3, 22q13. Делеции в этих локусах обуславливают фенотипические признаки, схожие с таковыми при СД22q11.2, в том числе пороки сердечно-сосудистой системы. Анализ данных проводили относительно пяти здоровых контрольных образцов с помощью программного обеспечения Coffalyser V8 (MRC-Holland).

Поиск мутаций в гене TBX1 осуществлялся методом прямого автоматического секвенирования по Сенгеру, как с прямого, так и с обратного праймеров, на приборе ABI Prism 3100 (Applied Biosystems) с использованием протокола фирмы производителя. В качестве матрицы для секвенирования использовали фрагменты ДНК, полученные после проведения ПЦР с использованием оригинальных олигонуклеотидных праймеров, которые синтезировались в ЗАО «Евроген». Анализ результатов секвенирования осуществлялся с помощью программ Chromas и BLAST (http://www.ncbi.nlm.nih.gov/blast).

секвенирования гена TBX1 представлена в таблице 1. Полиморфизмы проверяли по базе SNP (NCBI) www.ncbi.nlm.nih.gov/snp/.

2.3.5. Статистические методы обработки полученных данных Статистическую обработку фенотипических данных пациентов постнатальной группы проводили с помощью критерия.

TBX1C

5’ CCCACCCCAGATCCTCAGC

CAACTGAAAATTACACCCGCTTTTCC

Таблица 1. Последовательность праймеров для секвенирования гена TBX1 и условия для проведения ПЦР.

ГЛАВА 3. РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

3.1. Результаты исследования пренатальной группы Пренатальная диагностика редких хромосомных синдромов, обусловленных представляет некоторые затруднения в связи со сложностью выявления и интерпретации эхографических признаков и их сочетаний. Использование УЗаппаратуры высокого разрешения для поиска нестандартных дополнительных эхографических маркеров, а также высокая компетенция специалистов могут способствовать повышению эффективности пренатального выявления микроделеционных синдромов. При этом методами лабораторного исследования должны быть современные молекулярные технологии.

В данной работе представлен подход к пренатальному исследованию и результаты диагностики СД22q11.2. Это включает в себя определение критерие в наблюдениях плодов с различными эхографическими маркерами в I и во II триместрах беременности (22 наблюдения в I и 38 – во II триместре) и нормальным кариотипом при GTG-исследовании. Для диагностики микроделеции 22q11. методом FISH исследованы плоды с наличием в I триместре одного из следующих признаков: увеличенного ВП, ВПС, лимфатических образований в области шеи плода. Во II триместре показаниями к исследованию служило наличие одного из следующих признаков: ВПС, пороки развития МПС, ЗВРП, аномалии развития неба, гиперэхогенные включения в желудочках сердца плода.

В этих случаях первоначально необходимо выполнять стандартное исследование кариотипа для исключения из дальнейших молекулярных исследований случаи, где выявляются частые, различимые при стандартном микроскопировании, ХА.

Сложностью цитогенетической ПД является ограниченность материала, полученного в ходе инвазивного вмешательства и срочность постановки диагноза. В связи с этим, выработана тактика исследования образцов клеток плодов с эхографическими маркерами. Для стандартной цитогенетической диагностики, как правило, использовали 1-2 препарата (из обычно доступных четырех), чтобы в случае выявления нормального кариотипа плода на резервных препаратах провести расширенное молекулярно-цитогенетического исследование [Donnenfeld A. et al., 2006].

В I триместре FISH-методом исследовано 22 образца ворсин хориона, где стандартным «полупрямым» методом определен нормальный кариотип. Основным показанием для проведения данного исследования являлось наличие расширенного (больше 95 процентиля) ВП (n=17) у плода. Средняя величина ВП у плодов в этой выборке составила 4,56 мм. Также в подгруппу вошли плоды с наличием изолированного ВПС или сочетания его с ВП (n=2) и наличием анэхогенных образований в области шеи плода (n=3). В этой группе микроделеция 22q11. диагностирована в одном наблюдении. Данные представлены в таблице 2.

Таблица 2. Результаты молекулярно-цитогенетической диагностики делеции 22q11.2 у плодов в I триместре.

Лимфатические образования в Случай 1. Делеция 22q11.2 обнаружена у плода пациентки 39 лет. При эхографическом исследовании в 13 недель беременности выявлено круглое анэхогенное включение в области шеи плода диаметром 6,7 мм. Беременность, третья по счету, наступила в результате ЭКО (Рисунок 4).

Во II триместре исследовано 38 образцов КЛПК. Основными показаниями для направления на FISH-исследование у плодов с нормальным GTG-кариотипом являлись следующие эхографические маркеры: различные ВПС (n=21), такие как транспозиция магистральных сосудов, тетрада Фалло, прерванная дуга аорты, атриовентрикулярный канал; гиперэхогенный фокус в желудочках сердца плода (n=10);

аномалии развития МПС (пиелоэктазия, мегалоуретер, многоводие); аномалии неба;

ЗВРП; аплазия тимуса и сочетание этих признаков (n=7). Микроделеция 22q11.2 в этой группе обнаружена у двух плодов. Данные представлены в таблице 3. На рисунке 5 показано изображение FISH на метафазной пластинке и в интерфазном ядре с отсутствием делеции локуса TUPLE1 района 22q11.2.

Случай 2. У плода первобеременной пациентки 27 лет при эхографическом исследовании в 20 недель беременности обнаружен комбинированный ВПС:

прерывание дуги аорты, атриовентрикулярный канал и аплазия тимуса. Делеция 22q11.2 диагностирована FISH-методом на препарате из КЛПК плода с ДНК-зондом TUPLE1/ARSA (Abbott Molecular).

Случай 3. У пациентки 36 лет при УЗИ плода в 17 нед беременности обнаружена двусторонняя пиелоэктазия, мегалоуретер и многоводие. При FISHисследовании препаратов КЛПК выявлено наличие у плода микроделеции 22q11.2.

Рисунок 4. FISH на препарате из культуры лимфоцитов пуповинной крови плода с ДНК-зондом TUPLE1/ARSA (Abbott Molecular), локус TUPLE1 мечен красным флуорохромом, контрольный локус ARSA – зеленым флуорохромом.

Делеция локуса TUPLE1 на метафазной пластинке и в интерфазном ядре.

Рисунок 5. FISH на препарате из культуры лимфоцитов пуповинной крови плода с ДНК-зондом TUPLE1/ARSA (Abbott Molecular), локус TUPLE1 мечен красным флуорохромом, контрольный локус ARSA – зеленым флуорохромом.

Отсутствие делеции локуса TUPLE1 района 22q11.2, метафазная пластинка и интерфазное ядро.

Таблица Результаты молекулярно-цитогенетической диагностики микроделеции 22q11.2 у плодов во II триместре беременности.



Pages:   || 2 | 3 |
 


Похожие работы:

«Бабоша Александр Валентинович МНОГОФАЗНЫЙ ХАРАКТЕР КОНЦЕНТРАЦИОННОЙ ЗАВИСИМОСТИ ДЕЙСТВИЯ ФИЗИОЛОГИЧЕСКИ АКТИВНЫХ ВЕЩЕСТВ НА РОСТ РАСТЕНИЙ И УСТОЙЧИВОСТЬ К ФИТОПАТОГЕНАМ Специальность 03. 01. 05 – Физиология и биохимия растений Диссертация на соискание ученой степени доктора биологических наук Москва – 2014 СОДЕРЖАНИЕ ВВЕДЕНИЕ Основные представления о природе...»

«Лыкшитова Людмила Станиславовна ЭКОЛОГО - БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ АДАПТАЦИИ MALUS BACCATA (L ), ULMUS PUMILA (L ), SYRINGA VULGARIS( L. ) К ВОЗДЕЙСТВИЮ ФАКТОРОВ ГОРОДСКОЙ СРЕДЫ 03.02.01 – ботаника (биологические науки) 03.02.08 – экология (биологические науки) ДИССЕРТАЦИЯ на соискание ученой...»

«Орлова Ольга Геннадьевна ВЗАИМОДЕЙСТВИЕ МИКРООРГАНИЗМОВ С ПРОДУКТАМИ ГИДРОЛИЗА ИПРИТА Специальность 03.00.07 - микробиология ДИССЕРТАЦИЯ на соискание ученой степени кандидата биологических наук Научный руководитель : д.т.н. Медведева Н.Г. Научный консультант : к.б.н.Зайцева Т.Б. Санкт-Петербург ОГЛАВЛЕНИЕ стр. ВВЕДЕНИЕ.. Глава 1. Обзор литературы.....»

«СЕРГЕЕВА ЛЮДМИЛА ВАСИЛЬЕВНА ПРИМЕНЕНИЕ БАКТЕРИАЛЬНЫХ ЗАКВАСОК ДЛЯ ОПТИМИЗАЦИИ ФУНКЦИОНАЛЬНО-ТЕХНОЛОГИЧЕСКИХ СВОЙСТВ МЯСНОГО СЫРЬЯ И УЛУЧШЕНИЯ КАЧЕСТВА ПОЛУЧАЕМОЙ ПРОДУКЦИИ Специальность 03.01.06 – биотехнология ( в том числе бионанотехнологии) Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель Доктор биологических наук, профессор Кадималиев Д.А. САРАНСК ОГЛАВЛЕНИЕ ВВЕДЕНИЕ.....»

«Захаров Алексей Борисович Дендроиндикация загрязненности окружающей среды урбанизированных территорий на примере искусственных популяций сосны обыкновенной (Pinus sylvestris L.) Балахнинской низменности 03.02.08 – экология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель :...»

«Робенкова Татьяна Викторовна ПСИХОТИПОЛОГИЧЕСКИЕ АСПЕКТЫ АДАПТАЦИИ СТУДЕНТОВ КОЛЛЕДЖА 03.00.13 – физиология Диссертация на соискание ученой степени кандидата медицинских наук Научный руководитель : доктор биологических наук, профессор В.Н. Васильев Томск - 2003 ОГЛАВЛЕНИЕ. ВВЕДЕНИЕ..7 ГЛАВА 1. ОБЗОР ЛИТЕРАТУРЫ.. 1.1.Современный подход к проблеме адаптации студентов. 1.1.1. Роль стресса в...»

«Баканев Сергей Викторович Динамика популяции камчатского краба (Paralithodes camtschaticus) в Баренцевом море (опыт моделирования) Специальность 03.00.18 – Гидробиология Диссертация на соискание ученой степени кандидата биологических наук Научный руководитель – доктор биологических наук, профессор А. В. Коросов Мурманск – 2009 Содержание Введение... Глава 1....»








 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.