WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 |

«СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ РАЗЛИЧИЯ ЦИТОПЛАЗМАТИЧЕСКИХ ИЗОФОРМ АКТИНА В НЕМЫШЕЧНЫХ КЛЕТКАХ ...»

-- [ Страница 1 ] --

На правах рукописи

ДУГИНА ВЕРА БОРИСОВНА

СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ РАЗЛИЧИЯ

ЦИТОПЛАЗМАТИЧЕСКИХ ИЗОФОРМ АКТИНА В

НЕМЫШЕЧНЫХ КЛЕТКАХ

Специальность 03.03.04 – клеточная биология, цитология,

гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени доктора биологических наук

Москва – 2014 2

Работа выполнена в отделе математических методов в биологии НИИ физикохимической биологии имени А. Н. Белозерского Федерального государственного бюджетного образовательного учреждения высшего профессионального образования «Московский государственный университет имени М. В. Ломоносова»

Официальные оппоненты:

Лагарькова Мария Андреевна, доктор биологических наук, заведующая лабораторией генетических основ клеточных технологий Федерального государственного бюджетного учреждения науки «Институт общей генетики им. Н.И. Вавилова» РАН Лепеха Лариса Николаевна, доктор биологических наук, профессор, заведующая лабораторией патоморфологии Федерального государственного бюджетного учреждения «Центральный научноисследовательский институт туберкулеза» РАМН Ширинский Владимир Павлович, доктор биологических наук, профессор, директор института экспериментальной кардиологии Российского Кардиологического Научно-производственного Комплекса Министерства здравоохранения Российской Федерации

Ведущая организация: Федеральное государственное бюджетное учреждение науки «Институт биологии развития им. Н. К. Кольцова РАН»

Защита диссертации состоится «16» декабря 2014 года в 15:30 на заседании совета Д.501.001.52 по защите докторских и кандидатских диссертаций при Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования «Московский государственный университет имени М. В. Ломоносова» по адресу 119899, Москва, Ленинские горы, МГУ, д.1, стр.12, Биологический факультет, аудитория М-1.

С диссертацией можно ознакомиться в Научной библиотеке МГУ имени М.В.

Ломоносова (Фундаментальная библиотека, Ломоносовский проспект, д.27) и на сайте биологического факультета www.bio.msu.ru.



Автореферат разослан « » сентября 2014 года.

Ученый секретарь диссертационного совета, кандидат биологических наук Калистратова Е.Н.

ОБЩАЯ ХАРАКТЕРИСТИКА ДИССЕРТАЦИИ

Актуальность темы исследования. Актины - основные структурные компоненты цитоскелета эукариотических клеток. Актиновые микрофиламенты выполняют различные функции, большинство из которых связано со способностью к сборке и разборке филаментозных структур. Актомиозиновые структуры осуществляют сократительные и двигательные функции клеток. Актиновая система отвечает за клеточную подвижность, которая лежит в основе тканеобразования в процессе эмбриогенеза и дальнейшего развития многоклеточных организмов.

Реорганизации актинового цитоскелета необходимы для осуществления нормальных биологических процессов заживления ран, регенерация тканей, иммунного ответа.

Патологическое изменение подвижности клеток с нарушением регуляции актиновой системы происходит при воспалительных, фибросократимых, сердечнососудистых заболеваниях, при опухолевой инвазии и метастазировании. Нарушение в организации актиновой систем приводит к изменению упорядоченности и ориентации, неконтролируемому росту клеток, неправильному ответу на внешние стимулы, опухолевой трансформации (Prasad, 2005; Yamaguchi, Condeelis, 2007).

Изучение процессов реорганизации актинового цитоскелета, определяющих клеточную подвижность в норме и при опухолевой трансформации, а также механизмов, специфически регулирующих эти процессы, является фундаментальной научной проблемой, на решение которой были направлены исследования автора.

Высшие позвоночные продуцируют 6 изоформ актина: 4 мышечных и немышечных. Мышечные актины тканеспецифичны, их экспрессия и строгая регуляция в процессе развития и дифференцировки предполагает функциональную значимость изоформ. Функциональная роль -гладкомышечного актина (-SMA), который может экспрессироваться и в немышечных клетках, была изучена недостаточно. В немышечных клетках экспрессируются две основные изоформы и -цитоплазматические актины (- и -CYA), различающиеся только по аминокислотам на NH2-конце. Цитоплазматические актины играют ведущую роль в ключевых клеточных процессах, таких как адгезия, миграция, поляризация, митоз.

Патологические изменения подвижности клеток с нарушением регуляции актиновой системы происходят при опухолевой трансформации, они приводят к инвазии и метастазированию. Функциональные различия - и -CYA в нормальных и неопластически трансформированных клетках не были изучены. Понимание механизмов селективной регуляции изоформ актина необходимо для поиска новых путей диагностики и избирательного воздействия на инвазивные и метастатические свойства опухолевых клеток, а также направленного воздействия на системы цитоскелета, связанные с другими патологиями и заболеваниями человека.

Степень разработанности темы исследования. Сопоставление полученных результатов с мировым уровнем. Топографическое распределение и функциональные различия между - и -CYA ранее известны не были. Механизмы построения и реорганизации разнообразных актиновых структур были изучены недостаточно. Известно, что малые ГТФ-азы семейства Rho отвечают за образование различных структур, связанных с клеточным движением. Обнаружено, что актиновые системы, построенные из разных CYAs, находятся под контролем разных малых ГТФаз семейства Rho.





В данной работе впервые показана топографическая, структурная и функциональная разница между CYAs в клетках млекопитающих. Характер подвижности (скорость и направленность движения) нормальных фибробластов, лишенных - или -CYA, различается, т.е. CYAs играют разные роли в клеточной подвижности. С помощью специфического уменьшения экспрессии CYAs методом РНК-интерференции (siRNA) продемонстрирована преобладающая роль -CYA в направленном движении клеток (Dugina et al., 2009). Локализация мРНК -CYA на ведущем крае связывают с направленным движением нормальных клеток (Condeelis, Singer, 2005). У опухолевых клеток та же локализация редуцирует хемотактически зависимую подвижность, инвазивность и метастатический потенциал (Lapidus et al., 2007). С представленными результатами согласуются данные, полученные на клетках нейробластомы:

-CYA siRNA блокирует их миграцию (Shum et al., 2011). Угнетение миграционного потенциала эмбриональных фибробластов с выключенным геном ACTB происходит из-за компенсаторной экспрессии -SMA и повышения сократимости, ингибирование которой восстанавливало миграционную способность клеток без -CYA, но с -CYA (Tondeleir et al., 2012).

При опухолевой трансформации происходит реорганизация актинового цитоскелета, ведущая к изменению клеточной подвижности. Отмечена корреляция между исчезновением актиновых стресс - фибрилл и повышением миграционной активности и/или метастатического потенциала опухолевых клеток (Pokorna et al., 1994; Sahai, Marshall, 2003). Описано изменение мышечных изоформ актина в некоторых опухолях, а также исчезновение -SMA при опухолевой трансформации (Leavitt et al., 1985; Okamoto-Inoue et al., 1990). Дальнейшее исследование изменений распределения и экспрессии изоформ актина, а также их регуляции в нормальных и опухолевых клетках, было важно для понимания функций изоформ.

Цель и задачи исследования. Целью данной работы было установить потенциальные морфологические и функциональные различия изоформ актина в нормальных и неопластически трансформированных фибробластах и эпителиальных клетках. Для достижения поставленной цели были сформулированы следующие экспериментальные задачи:

1. Сравнить морфологические и цитоскелетные характеристики фибробластов различного тканевого происхождения в зависимости от экспрессии -SMA в стрессфибриллах.

2. Исследовать изменения актинового цитоскелета и фокальных контактов (ФК) в зависимости от индукции -SMA на модели дифференцировки миофибробластов под действием ростового фактора TGF- в культуре.

3. Получить данные о взаимной пространственной локализации белков ФК, изоформ актина, клеточного фибронектина (ED-A FN), а также рецепторов к фибронектину (FN) – интегринов, с помощью лазерной сканирующей микроскопии (LSM) с последующей трехмерной реконструкцией изображения.

4. Исследовать функциональную роль -SMA в миофибробластах с помощью ингибирования NH2-концевым декапептидом -SMA, а также специфическими ингибиторами актомиозинового взаимодействия.

5. Сопоставить структурное и пространственное распределение - и -CYA в фибробластах и эпителиальных клетках с помощью LSM, используя моноклональные антитела (mAbs) и специфические ингибиторы Rho/Rac сигнальных путей и актиновой полимеризации.

6. Охарактеризовать морфо-функциональные различия между CYAs в фибробластах и эпителиальных клетках с помощью метода siRNA с избирательным уменьшением экспрессии - и -CYA.

7. Исследовать распределение - и -CYA в нормальных и неопластически трансформированных клетках различных моделей в культуре. Провести сравнение взаимной организации CYAs в нормальной и опухолевой ткани молочной железы и шейки матки человека.

Научная новизна, теоретическая и практическая значимость. В результате проведенного анализа организации актиновых структур с использованием LSM и других современных методов клеточной биологии впервые установлены морфофункциональные различия между изоформами актина в немышечных клетках.

Показано, что экспрессия -SMA и включение его в состав пучков микрофиламентов вызывает увеличение размеров ФК (созревание). Впервые описана особая стадия развития ФК – формирование «суперзрелого» ФК. С помощью LSM с 3D реконструкцией изображения исследована и описана структура «суперзрелого» ФК и условия его возникновения. Показана строгая зависимость формирования «суперзрелых» ФК от молекулярного состава стресс-фибрилл и ECM. При образовании «суперзрелых» ФК необходимыми условиями являются синтез и встраивание в пучок -SMA, ответственного за повышенную сократимость.

Впервые показано, что - и -CYA по-разному локализованы в нормальных мезенхимальных и эпителиальных клетках, и что они образуют различные филаментозные структуры. Впервые при сравнительном изучении клеток различной степени неопластической трансформации проведен анализ организации актиновых структур с использованием LSM с применением 3D реконструкции изображения.

Полученные результаты не имели аналогов в литературе. Топографическое распределение и функциональные различия между этими двумя изоформами ранее не были известны. Сравнительного морфологического исследования изоформ актина, а именно изменений в распределении и экспрессии CYAs, исследования регуляции CYAs в нормальных и опухолевых клетках ранее не проводилось.

Проведенные в данной работе эксперименты внесли существенный вклад в исследования в данной области. Впервые были проведены функциональные эксперименты с помощью NH2-концевых пептидов, специфических низкомолекулярных ингибиторов, а также метода siRNA с избирательным уменьшением экспрессии одной из изоформ актина при сохранении экспрессии другой изоформы в нормальных фибробластах и эпителиальных клетках. Сочетание функциональных исследований после уменьшения экспрессии CYAs и метода LSM с одновременным использованием нескольких флуоресцентных маркеров дали уникальную возможность исследования динамики и структуры актинового цитоскелета клетки в норме и при патологических изменениях. Использованные подходы по сочетанию молекулярно-биологических и других современных методов клеточной биологии соответствуют мировому уровню.

Впервые показана связь трансформации клетки с реорганизациями CYAs и модуляциями в их экспрессии. Результаты, полученные в условиях культивирования нормальных и трансформированных клеток, а также в иммуногистохимических исследованиях нормальной и опухолевой ткани молочной железы и шейки матки человека позволяют предположить, что уменьшение экспрессии -CYA при сохранении гомогенного распределения -CYA можно считать характерным признаком опухолевой трансформации. Результаты данной работы свидетельствуют о перспективности дальнейших исследований молекулярных механизмов регуляции цитоскелетных систем, построенных из различных изоформ актина.

Данное исследование имеет не только теоретическое, но и важное практическое значение. Обнаружена фенотипическая нормализация трансформированных и опухолевых клеток разного происхождения под воздействием митохондриальнонаправленных антиоксидантов группы SkQ, что позволяет рассматривать вещества этой группы как потенциальные средства превентивной и поддерживающей противоопухолевой терапии.

Результаты исследования предполагают возможность использования специфических mAbs к изоформам актина в качестве дополнительных иммуногистологических маркеров для дифференциального диагноза между доброкачественными и злокачественными новообразованиями молочной железы, шейки матки и других онкологических заболеваний.

Методология исследования. Изучение структуры и динамики актинового цитоскелета, играющего ведущую роль в клеточной подвижности, проводится в течение многих лет, но отсутствие специфических mAbs к -CYA не позволяло ранее проводить сравнительное исследование изоформ актина. Из предыдущих исследований возникла гипотеза о том, что: 1) спектр актиновых изоформ, мышечных и немышечных, может определять морфологические свойства, тип адгезионных структур и другие параметры, связанные с распластыванием и движением клеток; 2) возможно существование морфо-функциональных различий между изоформами актина. Использование спектра новых специфических mAbs к изоформам актина, методов двумерного (2D) электрофореза и иммуноблоттинга белков, функциональноблокирующих пептидов и специфических ингибиторов, применение LSM позволило детально исследовать эти различия. При исследовании формирования и реорганизации актиновых структур использована прижизненная LSM клеток, трансфицированных плазмидами, несущими ДНК различных актиновых изоформ и белков ФК, соединенных с флуорохромами и классическая имунофлуоресценция с широким спектром Abs. При исследовании регуляции реорганизации CYAs в клетке важные результаты были получены при помощи специфического уменьшения экспрессии CYAs методом siRNA. Иммуноморфлогическое исследование тканевых срезов дополнило данные, полученные в условиях культивирования клеток.

Степень достоверности и апробация результатов работы. Основные результаты были представлены на всероссийских конференциях: 2-м съезде биофизиков России (1999); “Цитоскелет и клеточная регуляция” (Пущино, 2000);

«Биология клетки в культуре» (С.-Петербург, 2003, 2006); «Молекулярные механизмы процессов онтогенеза: эмбриогенез, геномы, эволюция» (Москва, 2006);

«Фундаментальная онкология – Петровские чтения» (С.-Петербург, 2006, 2008, 2009);

XIII Российском онкологическом конгрессе (Москва, 2009); Школе-семинаре по проблемам организации внутриклеточного транспорта, цитоскелета и путей передачи сигнала (С.-Петербург, 2009, 2011); на международных конференциях: “Mechanisms involved in tissue repair and fibrosis” (Лион, 1997); 14th Meeting of ECF (Оэрас, 1999);

17th Meeting of ECF (Нион, 2002); Gordon Research Conference on Tissue Repair and Regeneration, 2003; 18th ECF Meeting-EMBO/FEBS (Госау, 2003); «From Cell Biology to Development and Disease», FEBS (Хельсинки, 2004); “Tissue Repair, Contraction and the Myofibroblast” (Нион, 2004); FEBS-ESF “Integrated Approaches in Cytoskeleton Research” (Люксембург, 2005); SGED/SSED Annual Meeting (Берн, 2005); Swiss Biomedical Research SSEB Annual Meeting (Женева, 2006); CIBMG1 (Тунис, 2007);

ASCB-ECF (Дижон, 2007); FEBS “Mechanics and Dynamics of the Cytoskeleton” (Потсдам, 2008); SEB-ECF "The Cytoskeleton in Cell Morphogenesis" (Дюрам, 2009);

ECF/EMBO «The Cytoskeleton in Development and Pathology» (Стокгольм, 2010);

«Биологическая подвижность» (Пущино, 2010); International Workshop (Жиф-сюрИветт, 2010); ECF “Actin-based motility. From molecules to model organisms” (2011);

37th FEBS (Севилья, 2012); ECF “The cytoskeleton in tissue repair and diseases” (Фрибург, 2013); научных конференциях НИИ канцерогенеза РОНЦ РАМН и НИИ ФХБ им.А.Н. Белозерского МГУ им. М.В. Ломоносова; Ученом Совете НИИ ФХБ им.

А.Н.Белозерского МГУ им. М.В. Ломоносова 02.12.2013 г.; Московском семинаре по клеточной биологии в МГУ им. М.В. Ломоносова 02.04.2014 г.

Достоверность полученных результатов подтверждается публикациями в рецензируемых научных журналах, показателями их цитируемости в системах Web of Science (543) и Scopus (634).

По теме диссертации опубликовано 74 печатные работы, из них статей в российских и международных журналах, соответствующих перечню ВАК РФ - 20, обзорных глав в сборниках – 2, тезисов докладов в журналах и материалах конференций – 52.

Непосредственное участие автора заключалось в планировании и организации исследований, методической разработке и постановке экспериментов, компьютерной обработке и анализе результатов исследований, написании статей. Соавторы указаны в публикациях.

Структура и объем диссертации. Диссертация изложена на 235 страницах машинописного текста, содержит 79 рисунков, 9 таблиц. Состоит из разделов:

«Введение», «Обзор литературы», «Материалы и методы», «Результаты исследования и обсуждение» в 4-х частях, «Заключение», «Выводы», «Список литературы».

Библиография включает 458 ссылок.

В результате выполнения диссертационной работы были сформулированы следующие ПОЛОЖЕНИЯ, ВЫНОСИМЫЕ НА ЗАЩИТУ:

ПОЛОЖЕНИЕ 1:

-SMA-позитивные и -SMA-негативные варианты фибробластов, культивируемых из различных органов и тканей, обладают важными фенотипическими отличиями. Экспрессия -SMA и включение его в состав стрессфибрилл вызывает увеличение размеров ФК (созревание). Для образования «суперзрелого»

внеклеточного матрикса, адгезионных структур и актиновых стресс-фибрилл. Таким образом, формирование и поддержание структуры «суперзрелого» ФК у миофибробластов определяется -SMA-зависимой сократимостью.

ПОЛОЖЕНИЕ 2: В нормальных фибробластах и эпителиальных клетках происходит сегрегация CYAs, наиболее выраженная при реорганизациях актинового цитоскелета; - и -CYA образуют различные структуры в клетке. В нормальных немышечных клетках существуют функциональные различия между CYAs.

ПОЛОЖЕНИЕ 3: При неопластической трансформации происходит нарушение системы -CYA содержащих пучков при сохранении густой кортикальной и ламеллиподиальной сети -CYA микрофиламентов.

ОСНОВНОЕ СОДЕРЖАНИЕ РАБОТЫ

Культивирование клеток и реагенты. Первичные культуры подкожных фибробластов человека (HSCF), мышей и крыс были получены из эксплантов тканевых образцов. Эпителиальные линии: PtK2 кенгуровой крысы; MDCK нормального эпителия почки собаки; HaCaT кератиноцитов человека и их RASтрансформированные производные; C-33A, SiHa, Caski рака шейки матки.

Мезенхимальные линии: эмбриональные легочные фибробласты человека WI38 и их SV-40 - производные WI38-VA13; MRC5 и их SV-40 - клональные производные MRC5-V1 и MRC5V2, эмбриональные легочные фибробласты человека (HEL), крысиные эмбриональные фибробласты REF-52, Rat-1, Rat-2; клонированная сублиния мышиных спонтанно трансформированных фибробластов 152/15. Клетки культивировали в стандартных условиях.

Клетки при распластывании инкубировали с селективными ингибиторами Rhoкиназы (Y-27632, 10 мкM, 2 ч), Rac1 ГДФ/ГТФ активности (NSC23766, 50-100 мкM, 4 ч), немышечного миозина II (блеббистатин, 25 мкM, 4 ч), N-WASP (вискостатин, 5мкM, 30 мин) и с агентами, нарушающими полимеризацию актина (цитохалазин Д, CD, 0,1 мкM, 30 мин и латрункулин А, 0,1-0,2 мкM, 30 мин). Ингибиторы добавляли в конце 7 ч периода распластывания. В экспериментах на легочных фибробластах: ингибитор актомиозиновых взаимодействий БДМ (2,3-бутандион- 2моноксим, 30 мкМ, 3 ч); ингибитор киназы легких цепей миозина МЛ-7 (1-(5йодонафтален-1-сульфонил)-1H-гексогидро-1,4-диазепин гидрохлорид, 20 мкМ, 3 ч).

Для индукции миофибробластной дифференцировки использовали TGF1/2, 5нг/мл.

Специфические MAPK ингибиторы: активации MEK-1, PD098059, 5-50 мкM;

SB203580, p38 MAPК, 20-50 мкM. Клетки инкубировали в среде без сыворотки с MAPK ингибиторами 4 ч до добавления TGF. Опухолевый промотор 12-Oтетрадеканоил-форбол-13-ацетат (ТФА, 2-5 нг/мл). Рекомбинантный мышиный HGF/SF (1нМ) был очищен из клеток мышиной миеломы (Dugina et al., 1995). Для стимуляции ЭМП в культурах карцином шейки матки человека использовался эпидермальный фактор роста (ЭФР, 5-10 нМ). Митохондриально-направленные антиоксиданты SkQ1 (10-(6’-пластохиноил) децилтрифенилфосфоний) и SkQR1 (10пластохиноил) децилродамин 19) («Митотехнологии», 10-40 нМ).

Иммунофлуоресцентная микроскопия. mAbs: мышиные IgG2a к -SMA ( SM-1, Skalli et al., 1986), IgG1 к винкулину (VIN-11-5, Sigma), IgG1 к паксиллину (Transduction Laboratories), IgG2b к тензину и IgG1 к FAK (Transduction Laboratories);

SAM-1, IgG2b к 51 интегрину; IgG1 к ED-A FN (Ist-9); кроличьи поликлональные Abs к: FN (Sigma); 51 интегрину; -74 к -CYA (Yao et al., 1995). Вторые Abs:

FITC и TRITC-конъюгированные антимышиные IgG2a, IgG2b и IgG1 (Southern Biotech.), FITC, TRITC, AlexaTM488 - конъюгированные антимышиные и антикроличьи IgG (Jackson, Molecular Probes); Texas Red (Anawa) и AlexaTM488стрептавидин - для детекции биотинилированного rED-A фрагмента. Для выявления F-актина: FITC- и AlexaTM488-конъюгированный фаллоидин. Микроскопы: Zeiss Axiophot, объектив Plan-Neofluar 40x/1,3; Axioplan, объектив Plan-Neofluar 40х/0,75 и 100x/1,3 (Zeiss).

Морфометрия клеток и фокальных контактов. Культуры фибробластов окрашивали mAbs к -SMA для определения -SMA- позитивных и негативных клеток. Контуры клеток получали с использованием фотоувеличителя и вводили в PCAT компьютер с помощью цифрового планшета (Summasketch II, Summagraphics, UK). TRACER V1.0 (Copyright Dr. A. Brown). По контурам определяли математические характеристики формы клеток: площадь проекции, занимаемую клеткой на субстрате, периметр и отношение периметра к площади, индексы элонгации и дисперсии (Dunn, Brown, 1986). Для морфометрии ФК клетки окрашивали mAbs к винкулину и -SMA. Морфометрия краевых ФК проводилась с использованием микроскопа Leitz Aristoplan по негативным фото-изображениям, а также по одиночным конфокальным оптическим срезам.

Лазерная Сканирующая Конфокальная микроскопия. Клетки отмывали DMEM с 20мM Hepes при 37°C, фиксировали в 1% PFA на DMEM/Hepes при 30-25°C 15 мин, затем 5 мин MeOH при -20°C. Первые Abs: мышиные анти--CYA (4C2, IgG1), -CYA (2A3, IgG2b); -CYA (AC-74, IgG2a, Sigma); -SMA (SM-1); VASP (IE273, ImmunoGlobe); тропомиозин (TM311, Sigma); Е-кадгерин (BD Transduction);

виментин (V9, DAKO) и кроличьи поликлональные Abs к: p34-Arc (Upstate), спектрину (Biomakor) и немышечному миозину IIA (MHC-A, Covance); вторые Abs:

козьи антимышиные IgG1, IgG2b с FITC и TRITC (Southern), IgG, IgG1, IgG2b Alexa488 (Molecular Probes) и козьи антикроличьи IgG TRITC (Jackson). DRAQ (Biostatus), DAPI (Sigma) - для выявления ДНК. LSM 410, LSM510 (Zeiss) с объективами Plan-Neofluar 63x/1,4; Plan-Fluar 100x/1,45. Обработка изображения:

LSM5-Image Examiner. 3D-реконструкция: программы IMARIS.

Трансфекция siRNA. Последовательность - мишень siRNA -CYA человека (NM_001101) [-CYA siRNA1: AATGAAGATCAAGATCATTGC; -CYA siRNA2:

TAGCATTGCTTTCGTGTAAAT и -CYA siRNA 3: CAAATATGAGATGCATTGTTA]

и -CYA (NM_001614) [-CYA siRNA 1: AAGAGATCGCCGCGCTGGTCA и -CYA siRNA 2: CAGCAACACGTCATTGTGTAA] (Qiagen). Не достигшие монослоя клетки в среде OptiMEM без сыворотки и антибиотиков трансфицировали 50-100 нM siRNA с помощью Lipofectamine 2000 (Invitrogen). Эффективность трансфекции (80-90%) оценивали по совместной трансфекции с флуоресцентным BLOCK-iT™ (Invitrogen).

Морфометрия клеток в экспериментах с siRNA. HSCF трансфицировали с siRNA, через 2 сут пересаживали на покровные стекла, фиксировали и окрашивали на - и -CYA через 3 сут после трансфекции. Для морфометрии контуров клеток после siRNA трансфекции (площади поверхности, периметра и циркулярности (4A/P2)) использовали программу ImageJ (NIH, http://rsb.info.nih.gov/ij/).

Прижизненная микроскопия после siRNA трансфекции. Прижизненную микроскопию проводили на микроскопе Axiovert 100M (Zeiss) при 37°C в 5% CO2, с использованием CCD камеры (Hamamatsu Photonics) с Openlab software. HSCF трансфицировали с 50 нM siRNA и 50 нM BLOCK-iT™ Fluorescent Oligo (Invitrogen) для маркировки трансфицированных клеток. Анализ кимограмм проводили на чашках со стеклянным дном (MatTek), изображения сохраняли каждые 2 сек в течение 5 мин.

Кимограммы из последовательности изображений получали (Hinz et al., 1999) с помощью программы Metamorph. Длительные наблюдения за подвижностью клеток проводили на ImageXpressMicro при 37°C с 5% CO2. Через 2 сут после трансфекции с нM siRNA и 50 нM BLOCK-iT™, HSCF сажали с низкой плотностью на чашки Costar 3904. Изображения сохраняли каждые 5 мин в течение 13 час, объектив 10x/0. (W.D 1,20 mm S Fluor, Nikon). Если клетки входили в митоз или покидали поле зрения в течение эксперимента, то они не учитывались при анализе результатов. Средняя скорость (мкм/час, длина трека/время эксперимента), скорость (мкм/час, только в периоды движения), общая и кратчайшая дистанции определялись по положению ядра клетки с использованием функции Track Point. D/T - кратчайшее расстояние от стартовой до конечной точки (D)/длина трека (T).

Характеристика mAbs к CYAs. Мышей иммунизировали N-концевым конъюгированными с гемоцианином. Отобранные методом ELISA гибридомы были дважды клонированы, охарактеризованы на криостатных тканевых срезах и иммуноблоттингом (Dr. Chaponnier, университет г. Женевы). Блокирующие эксперименты с N-концевым пептидом -CYA проведены на тканевых срезах (иммунофлуоресценция) и экстрактах аорты (иммуноблоттинг). Электрофорез и иммуноблоттинг проводили также с БСА-конъюгированными пептидами 6-ти изоформ.

Электрофорез белков и иммуноблоттинг. Белки экстрагировали в буфере для SDS-PAGE или в Iso буфере для 2D-GE. Мембраны инкубировали с mAbs анти-: CYA (4C2), -CYA (2A3), -SMA (анти-sm-1, 1A4), актин (пан-актин, C4), виментин (V9, Dako), -тубулин (B-5-1-2, Sigma); затем - с HPR-конъюгированными антимышиными Ig козы (Jackson). Для проявления использовали систему ECL.

Cканирование изображений и денситометрический анализ проводили с помощью программ Optiquant и ImageJ.

Статистический анализ. Результаты представлены как среднее ± стандартная ошибка среднего; данные получены, по крайней мере, по 3-м независимым экспериментам. Статистический анализ проводили с помощью t-теста. Значения p0.001 (***), p0.01 (**) и p0.05 (*) считали статистически значимыми.

Сравнительное иммуноморфологическое исследование нормальной и опухолевой ткани молочной железы человека. Были исследованы образцы опухолей 99 пациентов, перенесших частичную или радикальную мастэктомию в РОНЦ РАМН в 1995-2008 гг., без предварительной терапии. Диагностику проводили согласно Международной классификации, предложенной экспертами ВОЗ. По клинико-лабораторным данным РОНЦ образцы были разделены на группы по характеру экспрессии РЭ (рецептор эстрогена), РП (рецептор прогестерона) и HERneu (рецептор эпидермального фактора роста 2 Neu, продукт онкогена ErbB2).

Использовали серийные (5 мкм) срезы: криостатные (1% PFA 15 мин, MeOH C, 5 мин) и архивного материала (формалин-парафин). Демаскировку антигенов проводили в 0,01 M TRIS/0,001M EDTA pH 9,0 в микроволновой печи, 20 мин/95°C (для актинов) и 95-100°C (для кератинов). Мышиные mAbs: к -CYA (4С2); -CYA (2A3); -SMA (SM-1); кератину 8 (К8, H1, IgG1), кератину 17 (К17, E3, IgG2b);

кератину 5/6 (К5/6, Dako) и р63 (4А4, BioGenex). Исследование проводили с помощью непрямой иммунофлуоресценции и пероксидазной техники (En Vision, Dako), микроскопа Axioplan (Zeiss) с объективами 20х/0,50 и 40х/0,75 Plan-Neofluar.

Сравнительное иммуноморфологическое исследование нормальной и опухолевой ткани шейки матки. Исследованы образцы опухолей 53 пациентов ФГБУ РОНЦ РАМН после оперативного вмешательства, без предварительной терапии. Гистологическая диагностика проведена согласно Международной классификации (Benedet et al., 2000). Иммуноморфологическое исследование проводили методом непрямой иммунофлуоресценции и пероксидазной техники.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ОБСУЖДЕНИЕ

ЧАСТЬ 1. Исследование цитоскелетных характеристик и организации адгезионных структур -SMA – позитивных и -SMA – негативных культивируемых крысиных фибробластов различного происхождения -SMA экспрессируется в фибробластах in vivo в процессе заживления ран и в большой степени коррелирует с сокращением поверхности раны. Присутствие в культуре клеток, экспрессирующих и не экспрессирующих эту изоформу актина (SMA – позитивных и -SMA – негативных клеток) в различных пропорциях, является характеристикой популяции фибробластов из определенных органов и тканей.

Возможно, механизмы, контролирующие экспрессию изоформ актина, играют основную роль в организации формы клетки, адгезионных характеристик и подвижности. Мы сравнили характеристики формы клеток, цитоскелета и организацию контактных структур в -SMA – позитивных и негативных крысиных фибробластах из различных органов или тканей. Внутри каждой категории, т.е. в SMA – позитивных или негативных фибробластах (по иммунофлуоресцентному окрашиванию моноспецифическими mAbs к -SMA), не было обнаружено значительных морфологических отличий по изучаемым признакам между популяциями различного тканевого происхождения. Напротив, -SMA–позитивные и негативные фибробласты значительно различались, независимо от их происхождения:

-SMA – позитивные клетки занимали большую среднюю площадь на субстрате, имели большее количество узких выростов на краях клеток, большие размеры ФК и более выраженную сеть FN, чем -SMA – негативные фибробласты. Т.о., -SMA – позитивные и негативные варианты, присутствующие в стандартных условиях культивирования в популяциях фибробластов, обладают важными фенотипическими отличиями, возможно, связанными с различной функциональной активностью систем актинового цитоскелета.

Морфометрия -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. Морфология -SMA – позитивных клеток отличалась от таковой у -SMA – негативных клеток во всех изученных популяциях фибробластов. Форма края -SMA – негативных клеток была гладкая, а -SMA – позитивные клетки имели противоположные характеристики:

многочисленные узкие выросты и инвагинации края. Средние площади, занимаемые клетками на субстрате, и периметры у -SMA – негативных были значительно меньше, чем у -SMA – позитивных фибробластов во всех изучаемых культурах.

При использовании нового критерия для характеристики изрезанности края – количество тонких пальцеобразных выростов, “capes”, различия в форме края клетки между -SMA–негативными и позитивными фибробластами становились более очевидными: среднее количество “capes” у -SMA – позитивных клеток было значительно больше, чем у -SMA–негативных в разных популяциях фибробластов.

Цитоскелетные структуры и фокальные контакты (ФК) у -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. Иммунофлуоресцентное окрашивание фибробластов на F-актин и -SMA показало, что в -SMA – позитивных клетках эта изоформа актина локализована преимущественно в стресс-фибриллах. Стресс-фибриллы выявлялись как в -SMA – позитивных, так и в -SMA – негативных фибробластах, но в -SMA – позитивных клетках эти структуры были контрастнее и толще.

Различное распределение белка ФК винкулина было отмечено в -SMA – позитивных и негативных фибробластах: в -SMA – позитивных клетках были выявлены длинные ФК под многочисленными выростами клеточного края; в -SMA – негативных клетках чаще выявлялись точечные краевые контакты, более вытянутые ФК окрашивались в центральных частях клеток. Средняя длина ФК была больше у SMA – позитивных, чем у -SMA – негативных клеток. Количество контактов на клетку было, в среднем, меньше у -SMA – позитивных, чем у негативных клеток.

Организация клеточного фибронектина (ED-A FN) у -SMA – позитивных и -SMA – негативных клеток в популяциях фибробластов различного происхождения. В большей части -SMA – позитивных клеток были выявлены ED-A FN фибриллы, параллельные -SMA стресс-фибриллам, в -SMA – негативных клетках чаще всего не выявлялся ED-A FN. -SMA – позитивные и негативные варианты, содержащиеся в разных пропорциях в популяциях фибробластов, культивируемых из различных органов и тканей, обладали фенотипическими отличиями, предположительно связанными с различными функциями.

ЧАСТЬ 2. Динамическая молекулярная организация контактов клеткаэкстраклеточный матрикс при модуляциях экспрессии -SMA Анализ разнообразия и характеристика категорий ФК. Для изучения роли -SMA на разных стадиях созревания ФК, а также анализа категорий ФК были использованы подкожные фибробласты человека в процессе миофибробластного перехода, который моделируется в культуре фибробластов с помощью TGF, -SMA –позитивных клеток в контрольных условиях было не более 1-5%, а после 4 сут инкубации с TGF достигало 60-80%. -SMA – позитивные клетки принимали полигональную форму и занимали большие площади на субстрате, чем -SMA – негативные фибробласты из тех же или из контрольных культур. ФК были длиннее и толще у -SMA–позитивных, чем у SMA – негативных клеток. Данные морфометрии легочных фибробластов с высоким содержанием -SMA – позитивных клеток похожи на данные -SMA–позитивных фибробластов после инкубации с TGF. Выделено категории ФК по значениям длины/площади: незрелые – площадь менее 2 мкм2, зрелые – 2-6 мкм2 и суперзрелые – более 6 мкм2. В контроле преобладали незрелые (60%) и зрелые (40%) ФК. После 5 сут с TGF практически исчезали незрелые ФК, оставалось 40% зрелых ФК и появлялось 55% суперзрелых ФК. Распределение ФК по размерам при инкубации с TGF в присутствии рекомбинантного фрагмента клеточного FN (rED-A) занимало промежуточное положение, количество суперзрелых ФК существенно уменьшалось. Структура незрелых, зрелых и суперзрелых ФК была проанализирована с помощью компьютерных программ 3D реконструкции LSM. Незрелые ФК были выявлены, в основном, в -SMA-негативных клетках в контроле и после 1-2 суток с TGF. Структуры (длиной 1,60 ± 0,45 мкм, шириной 0,78 ± 0,21 мкм) вблизи края и в центральной части ламеллы (Рис.1А), были часто связаны с -CYA-пучками. Эти винкулин- и паксиллин-позитивные ФК были колокализованы с 51интегрином (Рис.2A), тензин- и FAK- негативны. Пучки актина продолжали тонкие фибриллы ED-A FN на периферии клеток (Рис.3А).

Зрелые ФК были выявлены как в -SMA-позитивных клетках контрольных культур, так и в -SMA-позитивных клетках после 1-2 сут с TGF. Такие ФК были локализованы на нижней поверхности ламелл на расстоянии от края клетки, их средняя длина – 4,16 ± 2,43 мкм, ширина – 1,07 ± 0,46 мкм, связаны с -SMA– негативными или позитивными стресс-фибриллами. Данный тип ФК окрашивался на винкулин, паксиллин, тензин и FAK. Интегрин 51 был локализован на вентральной стороне винкулиновых контактов (Рис. 2А). Эти ФК были связаны с параллельными фибриллами ED-A FN на базальной поверхности клеток. Суперзрелые ФК обнаруживались в -SMA-позитивных клетках после 3-5 сут инкубации с TGF и в легочных фибробластах. Вытянутые цилиндрические, часто конические образования, в которых винкулин (Рис.1Б), паксиллин, тензин и FAK окружали концы -SMAпозитивных стресс-фибрилл. 3D реконструкция выявила 51-интегрин-позитивные слои параллельно цилиндрическим структурам винкулина (Рис.2Б, В). Средняя длина 16.07 ± 6.79, ширина 2.77 ± 1.48 мкм.

3D реконструкция выявила кисточко-подобные структуры ED-A FN фибрилл под нижней и над верхней поверхностями клетки, связанные с концами -SMAпозитивных пучков (Рис.3Б) и концами винкулин-содержащих ФК. ED-A FN фибриллы окружали 51структуры.

Биохимическая характеристика ФК-ассоциированных белков. Иммуноблоттинг для количественной оценки экспрессии паксиллина, винкулина и актина в цитоскелетной фракции фибробластов был проведен до и после 5 сут инкубации с TGF (максимальная экспрессия -SMA). Винкулин и паксиллин выявлены в цитозольной и цитоскелетной фракциях в контроле. TGF слегка повышал экспрессию винкулина и более значимо – паксиллина и актина. Включение этих белков в цитоскелетную фракцию увеличивалось при инкубации с TGF от 30% до 55% для винкулина, от 40% до 70% для паксиллина и от 50% до 80% для актина. В легочных фибробластах: включение в цитоскелетную фракцию винкулина около 40%, паксиллина - 90% и актина - 80%.

Действие rED-A на организацию FN сети и созревание ФК. При инкубации с TGF возрастала экспрессия ED-A FN и выявлялась система толстых параллельных FN-фибрилл, нарушаемая при добавлении rED-A в среду с TGF Выявление биотинилированного rED-A и FN показало, что rED-A колокализован с утолщенными лентообразными структурами FN. Добавление rED-A при инкубации с TGF блокировало экспрессию -SMA, приводило к дезориентации пучков актина (Рис.1В) и преобладанию незрелых и зрелых ФК, что означало rED-A-индуцированное ингибирование суперсозревания ФК (Рис.1В). При добавления rED-A на короткий срок обнаружено его преимущественное связывание с ФК (Рис.4А, Б).

Было проверено, может ли rED-A в бесклеточной системе декорировать FN матрикс, продуцируемый фибробластами. К DOC - нерастворимому матриксу добавили биотинилированный rED-A, который колокализовался с толстыми FN фибриллами. Эти результаты вместе с данными о том, что rED-A преимущественно связывается с FN в ФК, означали, что rED-A предпочтительнее встраивается в натянутые фибриллы FN. Для проверки этой гипотезы было исследовано, меняется ли встраивание rED-A в FN сеть после инкубации фибробластов с МЛ-7, ингибитором киназы легкой цепи миозина. rED-A встраивание было нарушено в клетках после инкубации с МЛ-7 по сравнению с контролем.

Рис.1. Изменение структуры ФК и стресс-фибрилл после инкубации фибробластов с TGF. Винкулин (красный) и (А) -CYA (зеленый) в контроле, незрелые (стрелка) и зрелые (головка стрелки) ФК; (Б) -SMA (зеленый), 5 сут с TGF; (В) -CYA (зеленый), 5 сут с TGF и rED-A. -SMA в стресс-фибриллах не выявлен. LSM. 3D-проекции, вид с базальной стороны клетки. Масштаб: 10 мкм.

Рис.2. Трехмерная структура винкулина и 51 интегрина в ФК. (А) Контроль:

незрелые (стрелка) и зрелые (головка стрелки) ФК; 51 (красный), винкулин (зеленый), колокализация (желтый). (Б, В) TGF, 5сут. (Б) 51 экранирует винкулин. (В) колокализация 51 и винкулина (желтый) в ФК (базальные срезы удалены). 3D LSM (вид с базальной стороны). Масштаб:10 мкм.

Рис.3. Организация ED-A FN и актина после инкубации с TGF. ED-A FN (зеленый) и (А) -CYA (красный) в контроле; (Б) -SMA (красный) после инкубации с TGF. LSM. 3D-проекции. Вид с базальной стороны. Масштаб: 10 мкм.

Рис. 4. Локализация биотинилированного фрагмента rED-A при встраивании в ED-A FN. HSCF 4 сут с TGF, затем 3 часа с 50 мкг/мл биотинилированного rED-A).

А: Биотинилированный rED-A (красный) встраивается (желтый) преимущественно в толстые фибриллы ED-A FN сети (зеленый); Б: винкулин (красный) в ФК частично колокализуются (желтый) с фибриллами rED-A (зеленый). LSM. Масштаб: 10 мкм.

Инкубация легочных миофибробластов с ингибиторами актомиозиновых взаимодействий BДM или MЛ-7 приводила к реорганизации системы стресс-фибрилл и исчезновению -SMA. Изменение длины ФК после инкубации с ингибиторами подтверждено морфометрически: средняя длина уменьшается в 3-6 раз (11,17 ± 0. мкм в контроле; 2.2 ± 0.25 мкм БДМ; 4.1 ± 0.21 мкм МЛ-7). ФК контрольных миофибробластов часто достигали 30 мкм. Распределение ФК по длине показало, что 60% ФК были более 8 мкм, после инкубации с ингибиторами контрактильности не оставалось ФК более 10 мкм, длина 75 % ФК была менее 5 мкм.

Суперсозревание ФК зависит от повышенной сократимости, связанной с экспрессией -SMA. При распластывании миофибробластов REF-52 формирование пучков -CYA предшествует встраиванию -SMA в стресс-фибриллы, что коррелирует с созреванием ФК и значительно повышает адгезивность фибробластов.

Ингибирование сократимости с помощью NH2-концевого декапептида -SMA (SMAFP) уменьшало адгезию миофибробластов до уровня -SMAнегативных клеток, а также приводило к диссоциации ФК. Для исследования динамики ФК и роли -SMA в их развитии с помощью видеомикроскопии, REF-52 с флуоресцентно-меченными маркерами ФК (3-интегрин), фибриллярных адгезий (5-интегрин) и паксиллином, сажали на эластичные субстраты с микро-рисунком, позволяющим наблюдать сократимость клетки и изменение интенсивности флуоресценции белков ФК под действием SMA-FP. Следующая динамика событий была выявлена после добавления SMA-FP: сначала уменьшалась сократимость суперзрелых ФК, затем снижались интенсивность флуоресценции паксиллина, плотности 3-интегрина и паксиллина.

Изменения 5-интегрина выявлено не было. Т.о., образование и стабильность суперзрелых ФК зависит от повышенной сократимости, определяемой -SMA (Hinz, Dugina et al, 2003).

Действие ингибиторов MEK1 и p38 на полимеризацию FN и экспрессию SMA. Влияние ингибиторов MAP-киназ на полимеризацию FN и экспрессию -SMA было проверено на TGF-дифференцированных миофибробластах. Ингибитор MEK не влиял на миофибробластную дифференцировку, индуцируемую TGF, тогда как преинкубация с ингибитором активации p38 блокировала полимеризацию ED-A FN и экспрессию -SMA.

Функция -SMA связана с модуляцией ФК при дифференцировке миофибробластов. Полученные результаты показали, что после инициации и созревания ФК подвергаются дальнейшей реорганизации, для обозначения которой мы предложили термин «суперсозревание». Обнаружено, что суперсозревание ФК, как постоянное свойство легочных фибробластов, либо индуцируемое TGF, соответствует появлению миофибробластных характеристик. Суперзрелые ФК всегда связаны с -SMA-позитивными стресс-фибриллами. При инкубации с TGF содержание винкулина, паксиллина и -SMA на клетку и размеры ФК увеличивались, а также увеличивалось включение винкулина, паксиллина и актина из цитоплазматической фракции во фракцию суперзрелых ФК.

Равновесие натяжения, определяемого актомиозиновым цитоскелетом, и устойчивостью внеклеточного матрикса в суперзрелых ФК. Ранее было показано (Bershadsky et al., 1996; Chrzanowska-Wodnicka, Burridge, 1996; Pletjushkina et al., 1998), что актомиозиновая сократимость клетки играет важную роль в преобразовании незрелых инициальных контактов в зрелые ФК. Подобным образом, увеличение цитоскелетного натяжения необходимо для сборки суперзрелых ФК.

Вероятно, механическая устойчивость FN сети клетки к натяжению необходима для суперсозревания ФК. В наших экспериментах ингибирование суперсозревания ФК было вызвано инкубацией с рекомбинантным фрагментом rED-A или редукцией актомиозиновой контрактильности. Таким образом, конечная стадия созревания ФК определяется равновесием натяжения актомиозина и устойчивостью ECM. Роль миофибробластов в продукции изометрического натяжения была показана как внутри грануляционной ткани in vivo, так и в условиях культивирования (Serini and Gabbiani, 1999). Это натяжение создает необходимое напряжение в месте ФК связующего звена между клеткой и ECM. При стимуляции TGF ФК приобретают морфологические и биохимические свойства, которые позволяют им лучше передавать натяжение от клетки к ECM и обратно.

немышечных клетках Изучение внутриклеточной локализации - и -CYA в фибробластах и эпителиальных клетках при распластывании и в стабильном состоянии. В первую очередь мы изучили организацию CYAs в процессе реорганизации актиновых систем клетки (Рис.5А-В; 7). При распластывании HSCF -CYA был распределен в виде кортикальной и ламеллярной сети; -CYA был локализован в кольцевых пучках и радиальных стресс-фибриллах в вентральной части клетки (Рис.5А). Эпителиальные клетки при распластывании имеют циркулярную морфологию с кольцевыми протрузиями, образованными -CYA сетями (Рис. 5В). CYA организован в филоподиальные (Рис.5Б) и кольцевые пучки (Рис.5В) в базальной части, тогда как -CYA-окрашивание выявлено в апикальной части клетки (Рис.5Вz). В культурах HSCF (3 сут) -CYA локализован в стресс-фибриллах близко к субстрату (Рис. 5Г), тогда как пучки в дорзальной части клетки состоят из -CYA (Рис. 5Гz). Подобным образом локализован -CYA в стресс-фибриллах фибробластов, трансфицированных -CYA-EGFP. -CYA-EGFP локализуется равномерно с повышением концентрации на ведущем крае. В стационарных фибробластах -CYA перераспределялся в стресс-фибриллы.

Эпителиальные клетки в культуре образуют островки с выраженными межклеточными контактами и генерируют базо-апикальную полярность;

протрузионная активность при этом сохраняется на краях, свободных от контактов с другими клетками. В этих условиях -CYA организован (Рис.5Д) в: 1) стрессфибриллы в базальной части клетки (с); 2) протяженные кольцевые пучки на периферии эпителиальных островков (с); и 3) тонкие короткие пучки в местах латеральных межклеточных контактов (b и Z-срез). -CYA локализован под апикальной мембраной (a и Z-срез) и в протрузиях вокруг островков (c). - и -CYA распределяются в специфических клеточных компартментах, базо-латеральном и апикальном, соответственно. Похожие результаты были получены на нескольких типах нормальных фибробластов, эпителиальных и эндотелиальных клеток, т.е.

обнаруженная сегрегация CYAs в разные компартменты и организация различных структур не являются уникальными для одного типа клеток.

Организация цитоплазматических актинов при миграции клеток.

Направленная миграция была индуцирована в культурах фибробластов и эпителиальных клеток в экспериментальной ране удалением части монослоя клеток.

Проанализированы пространственная организация CYAs и их участие в образовании тонких поляризованных протрузий на ведущем крае клетки. В обоих типах клеток протрузии были обогащены -CYA (Рис.6А, Б), а -CYA был организован в пучки в теле клетки ближе к субстрату (Рис. 6А, Б). Локализация -CYA в стресс-фибриллах наблюдалась и в фибробластах, трансфицированных -CYA-EGFP. -CYA-EGFP был равномерно распределен с концентрацией на ведущем крае поляризованной клетки.

ламеллиподиальный -CYA колокализован с кортикальным маркером спектрином и некоторыми изоформами тропомиозина. -CYA в ламеллиподиях колокализован с белками p34Arc и Arp3 комплекса Arp2/3. -CYA колокализован с миозином IIA в стресс-фибриллах и с VASP в ламеллиподиях и ФК.

Соотношение между сегрегацией актиновых изоформ и актомиозиновой сократимостью. Для изучения связи организации актинов и актомиозиновой сократимости мы, в первую очередь, проанализировали распределение изоформ в митотических клетках, т.к. ранее было известно, что малая ГТФаза RhoA контролирует определенные фазы митоза и концентрируется в местах повышенной сократимости: кортексе в метафазе, экваториальном районе анафазы и телофазном сократимом кольце (Piekny, Glotzer, 2008). В интерфазе и профазе митоза - и -CYA были распределены в базо-латеральный и апикальный домены клетки, соответственно. В метафазе -CYA перераспределяется в кортекс (Рис.7А), где колокализуется с -CYA. Далее, -CYA был сконцентрирован в экваториальном районе в анафазе (Рис. 7Б), сократимом кольце в телофазе (Рис. 7В) и при цитокинезе.

Повышенная концентрация -CYA в районе межклеточных контактов сохраняется в интерфазе. При распластывании HSCF в присутствии блеббистатина, ингибитора немышечного миозина II, наблюдалось исчезновение -CYA-содержащих стрессфибрилл и арок, а -CYA сеть была плотнее, чем в контроле.

Рис. 5. - и -CYA в различных клеточных структурах и компартментах. HSCF (А, Г), HaCaT (Б) и MDCK (В, Д) 3 час (А - В) или 3 сут (Г, Д) в культуре;-CYA (зеленый),-CYA (красный). Z-срезы – верхние изображения каждой панели.

Штриховые линии – уровень одиночных X/Y срезов (нижние изображения). -CYA в базальных стресс-фибриллах (А, Г, Дв), филоподиях (Б), межклеточных контактах (Дб) и кольцевых пучках микрофиламентов (A, В, Дв). -CYA в ламеллярных и дорзальных компартментах. Желтый - колокализация - и -CYA. LSM. Масштаб мкм.

Рис. 6. Различия в распределении - и -CYA на ведущем крае клеток при движении в рану. (A) HSCF и (Б) PtK2. Распределение -CYA (зеленый) и -CYA (красный) на ведущем крае при движении в рану. -CYA-сеть в протрузиях. -CYA стресс-фибриллы (звездочка). Желтая окраска раффлов – колокализация CYAs в ламеллиподии (стрелка). Изображение б показывает большее увеличение ограниченного белой рамкой участка клетки (а). LSM. Масштаб 10 мкм.

Рис. 7. - и -CYA специфически локализованы в митозе. Клетки HaCaT в митозе: метафаза (А), анафаза (Б), телофаза (В). LSM. Масштаб 5 мкм.

Разная чувствительность цитоплазматических актинов к ингибиторам малых ГТФаз и агентам, меняющим полимеризацию актина. Образование стрессфибрилл и ламеллиподий регулируется ГТФ-связывающими белками RhoA и Rac1, соответственно (Ridley, Hall, 1992; Ridley et al., 1992). Инкубация клеток с селективным ингибитором Rho киназы, приводила к дезорганизации -CYA пучков, а сеть -CYA оставалась без изменений. Ингибитор Rac1 блокировал протрузионную активность, что видно по отсутствию ламелл/ламеллиподий, исчезновению -CYA сети и повышенному образованию - и -CYA стресс-фибрилл. Для исследования роли Rac1-зависимых сигнальных путей в сегрегации актиновых изоформ был использован вискостатин, селективный ингибитор N-WASP, который предотвращает активацию Arp2/3 комплекса. Инкубация с вискостатином предотвращала образование ламеллярных протрузий, обогащенных -CYA. Вместо этого, клетки формировали многочисленные -CYA филоподии и раффлы.

В работе были также использованы цитохалазин Д, который с высокой аффинностью связывается с оперенными концами актиновых филаментов, и латрункулин А, который взаимодействует с актиновыми мономерами и блокирует включение мономеров в филаменты (Spector et al., 1989). Низкие дозы цитохалазина ингибировали образование -CYA стресс-фибрилл и вызывали появление агрегатов -CYA. Локализация -CYA в ламеллиподиальных протрузиях и распределение p34Arc и Arp3 не менялось от добавления цитохалазина. Латрункулин разрушал CYA сеть на ведущем крае, но не ингибировал образование -CYA стресс-фибрилл.

Действие siRNA -CYA и -CYA на морфологию и подвижность фибробластов.

HSCF были трансфицированы siRNA для -CYA, -CYA или scramble в качестве контроля. Иммуноблоттинг с mAbs к CYAs проводили через 72 часа после трансфекции. Cнижение экспрессии -CYA специфическими siRNA было 31 ± 4 % (p0,001), при этом уменьшения экспрессии -CYA не выявлено (Рис.8А), что подтверждает специфичность воздействия siRNA на изоформы актина. Cнижение экспрессии -CYA специфическими siRNA было 41 ± 7 % (p0,001), при этом количество -CYA оставалось неизменным, но возрастала экспрессия -SMA (Рис.

8А). Уменьшение экспрессии каждой CYA от siRNA даже такого уровня вызывало изменение морфологии, полярности и подвижности. Неполный нокдаун можно объяснить относительно долгим (2-3 дня) временем полужизни молекулы актина (Antecol et al., 1986) при оптимальном времени воздействия siRNA 3 сут. В клетках со сниженной экспрессией - или -CYA, изменения морфологии выявлены через 3 сут воздействия siRNA:

-CYA-дефицитные клетки имели широкие протрузии на ведущем крае, уменьшенное количество и размеры стресс-фибрилл, -CYA исчезал из ламеллиподий, но сохранялась -CYA сеть (Рис. 8Б). При уменьшении экспрессии CYA клетки не продуцировали ламеллиподии и формировали хорошо выраженные пучки, позитивные как на - и -CYA (Рис. 8Б), так и на -SMA (в 80% -CYA дефицитных клеток по сравнению с 30% в контроле; Рис.8Б, нижний ряд, вставка), что предполагает «сократимый» фенотип. После уменьшения экспрессии -CYA площадь клетки увеличивалась по сравнению с контролем (от 2962 ± 431 мкм2 до 5631 ± 937 мкм2, p0,01), при уменьшения экспрессии -CYA эта величина не менялась. Циркулярность (характеристика, обратная полярности) увеличивалась после снижения экспрессии -CYA (от 0,360 ± 0,005 до 0,545 ± 0,020, p0,001) и уменьшалась после снижения экспрессии -CYA (0,203 ± 0,047, p0,01).

Рис. 8. Изменение морфологии и подвижности фибробластов после siRNA -CYA или -CYA. HSCF: (A) Иммуноблоттинг после -, -CYA или контрольной (scramble) siRNA; (Б) фазовый контраст и иммунофлуоресценция после siRNA трансфекции; (В) Репрезентативные миграционные треки; (Г) количественная оценка скорости и направленности клеточной миграции.

Миграцию одиночных клеток через 3 сут после трансфекции - и -CYA siRNA изучали в течение 13 час (Рис.8В). Были выявлены различия в миграционных характеристиках при снижении экспрессии каждого из CYAs (Рис.8В). Средняя скорость статистически значимо снижалась у -CYA-дефицитных клеток (~33%) (Рис.8Г). Скорость, рассчитанная только в периоды движения, была снижена (15как у -CYA, так и у -CYA-дефицитных клеток (Рис.8Г). Снижение экспрессии -CYA уменьшало направленность миграции (Рис.8Г), а снижение экспрессии -CYA увеличивало этот параметр. Т.о., -CYA отвечает за поддержание направления миграции, а -CYA, возможно, за кратковременные быстрые движения. Свойства ведущего края также менялись: ламеллиподиальные протрузии и ретракции, а также раффлы в контроле; продолжительные ламеллиподиальные протрузии в -CYAдефицитных клетках; филоподии и поджатия края клетки при -CYA -дефиците.

siRNA -CYA и -CYA в эпителиальных клетках. HaCaT были трансфицированы -, -CYA или контрольными siRNA. Иммуноблоттинг показал специфическое уменьшение -CYA на 28 ± 4 % (p0,01), а -CYA на 35,5 ± 6 % (p0,01). -CYA дефицитные клетки продуцировали широкие протрузии; -CYA дефицитные клетки имели вытянутый или полигональный фенотип без протрузий. В -CYA дефицитных клетках уменьшалось количество -CYA пучков в базальной части и межклеточных контактах, а -CYA сеть не менялась. Морфология -CYA дефицитных клеток была изменена в сторону сократимого фенотипа с -CYA-стрессфибриллами. При уменьшении экспрессии -CYA выявлялось некоторое количество клеток с блебами, что подтверждает роль кортикального -CYA в поддержании формы клетки. Снижение экспрессии -CYA увеличивало долю многоядерных клеток (29 ± 2 %, p0,001, по сравнению с 2 % в контроле и -CYA-дефицитных клетках).

Индивидуальные роли - и -CYA в регуляции эпителиальных апикальных межклеточных контактов. Основными маркерами адгезионных межклеточных контактов (AJ) являются белки Е-кадгерин, - и -катенины. Eкадгерин экспрессируется в клетках большинства нормальных эпителиальных тканей.

В клетках нетрансформированных HaCaT и MDCK Е-кадгерин концентрируется в зоне межклеточных контактов. В поляризованных MDCK LSM выявила Е-кадгерин, колокализованный с -CYA в AJ. -CYA сеть в дистальной части апикальных компартментов не колокализована с AJ. Двойное иммунофлуоресцентное окрашивание Abs к белкам плотных контактов (TJ) - ZO-1 или окклюдину, и -CYA выявляет участки колокализации в TJ, на границе латеральных и апикальных компартментов.

Функциональные роли CYAs в межклеточных контактах были изучены методом siRNA к -CYA и -CYA (Baranwal et al., 2012). Эти эксперименты продемонстрировали уникальные роли -CYA и -CYA в регуляции и поддержании целостности AJ и TJ, соответственно. Было обнаружено, что обе CYAs необходимы для разных аспектов реорганизации адгезионных комплексов. Важным результатом является селективное функциональное соответствие разных изоформ актина различным типам контактных комплексов. При созревании AJ и TJ филаменты CYA и -CYA объединяются, становятся микроскопически не всегда различимыми, но их уникальные биохимические и функциональные свойства сохраняются.

Изучение реорганизации актинового цитоскелета при неопластической трансформации в различных экспериментальных системах. Одним из подходов для исследования путей преобразования мембранных сигналов и влияния активации сигнальных путей на цитоскелет является применение опухолевого промотора ТФА.

ТФА – это активатор протеинкиназы С, одного из важнейших регуляторных ферментов фосфоинозитольного пути передачи сигнала с поверхности клетки. При инкубации фибробластов 152/15 с ТФА изменение морфологии сопровождалось реорганизацией пучков актиновых микрофиламентов (их дезорганизацией) и актинового кортекса (обогащением кортикальной сети). На основании этих результатов и анализа литературных данных возникла гипотеза о существовании двух различных популяций микрофиламентов, играющих разные роли при неопластической трансформации.

Для изучения изменений CYAs, связанных с неопластической трансформацией N-RAS у фибробластов, мы использовали нормальные фибробласты HSCF, трансформированные N-RAS. В нормальных фибробластах -CYA и -CYA были организованы в стресс-фибриллы и сети, соответственно. В трансформированных NRAS клетках не выявлялись -CYA стресс-фибриллы, тогда как -CYA сеть сохранялась. Кроме того, изучение изменений CYAs, связанных с неопластической трансформацией, проводилось на нормальных фибробластах WI38 и MRC5 и их SVтрансформированных производных: WI38-VA13 и MRC5-V1/-V2. В нормальных фибробластах WI38 и MRC5 -CYA и -CYA были организованы в стресс-фибриллы и сети, соответственно; в трансформированных клетках стресс-фибриллы не были выявлены, -CYA концентрировался в раффлах и филоподиях, а -CYA сеть выявлялась равномерно в кортексе. В менее трансформированных MRC5-V1 клетках сохранялось небольшое количество -CYA пучков. При сравнительной оценке соотношения CYAs оказалось, что в трансформированных клетках снижается доля CYA относительно -CYA.

Рассеивающий фактор HGF/SF - это белок, стимулирующий подвижность эпителиальных клеток в культуре (Stoker, Perryman, 1985). Реорганизации морфологии, индуцируемые HGF/SF в культуре, рассматривают как модель процессов in vivo, при которых эпителиальные клетки отделяются друг от друга и мигрируют. После инкубации с HGF/SF клетки приобретали характерную для подвижных фибробластов поляризованную морфологию с образованием ведущего края и хвостового отростка. Краевые кольцевые пучки исчезали, но появлялись прямые пучки актина. Окрашивание mAbs к -CYA и -CYA показало, что пучки образованы -CYA, а подвижные широкие ламеллы обогащены -CYA.

Возможность изменения распределения и соотношения CYAs при неопластической трансформации эпителиальных клеток была проверена на кератиноцитах, трансформированных N-RAS и H-RAS. Контрольные (Рис.9A, Б), NRAS (Рис.9В, Г) и H-RAS (Рис. 9Д, Е) - HaCaT были окрашены mAbs к CYAs. При трансформации исчезали кольцевые пучки -CYA, но выявлялась сеть -CYA. По данным иммуноблоттинга, относительное количественное соотношение CYAs при RAS трансформации менялось в сторону уменьшения -CYA (Рис. 9Ж).

Организация актинового цитоскелета в культивируемых опухолевых кератиноцитах. В отличие от иммортализованных кератиноцитов HaCaT, в которых -CYA организован в пучки, в клетках рака шейки матки был выявлен, в основном, диффузный -CYA, лишь небольшая часть была организована в аберрантные фибриллы и раффлы. Во всех исследуемых культурах опухолевых кератиноцитов интенсивно окрашивалась кортикальная и ламеллиподиальная сеть -CYA. Сравнение соотношения CYAs показало относительное снижение содержания -CYA и увеличение содержания -CYA в более трансформированных кератиноцитах (Шагиева и др, 2012).

Рис.9. Изменения в организации и относительном содержании CYAs в кератиноцитах при трансформации онкогенами RAS. Контрольные (A, Б), N-RAS (В, Г) и H-RAS (Д, Е) трансформированные HaCaT были окрашены mAbs к -CYA (зеленый) и -CYA (красный). DRAQ5 (ДНК, синий). (Ж) Изменение соотношения CYAs при RAS-трансформации. Данные иммуноблоттинга.

Изучение внутриклеточной локализации и функций - и -CYA в фибробластах и эпителиальных клетках в стационарном состоянии и при реорганизациях актинового цитоскелета. Вероятность того, что - и -CYA выполняют различные биологические функции, была под вопросом, несмотря на предположения о функциональной специфичности мышечных изоформ (Chaponnier, Gabbiani, 2004; Lambrechts et al., 2004). Результаты, представленные в данной работе, получены с помощью специфической иммунодетекции - и -CYA в одной и той же клетке. Впервые продемонстрировано, что эти изоформы актина сегрегированы в цитоплазме мезенхимальных и эпителиальных клеток в состоянии покоя, а также при движении и делении. Селективное уменьшение экспрессии - или -CYA с помощью siRNA показало, что каждая изоформа принимает разное участие в организации клеточной морфологии, полярности и подвижности.

Два типа структур, которые образуют актиновые филаменты, т.е. пучки и ветвящиеся сети, были ранее охарактеризованы в немышечных клетках с помощью электронной микроскопии (Abercrombie et al., 1971; Small, 1981; Svitkina et al., 1995) и специальных методик иммунодетекции (Svitkina, Borisy, 1999). Пучки микрофиламентов представлены в виде стресс-фибрилл, филоподий, сократимых колец и структур межклеточных контактов, в то время как ветвящиеся филаменты образуют кортикальные и ламеллиподиальные сети. Каждая из систем микрофиламентов характеризуется преобладанием одной из изоформ актина:

-CYA в пучках и -CYA в ветвящихся филаментах (Dugina et al., 2009; Рис.10). Селективное распределение наблюдалось во всех изученных типах нормальных немышечных клеток, что указывает на универсальность данного феномена.

Полученные данные частично противоречат публикациям, в которых -CYA детектировали, в основном, на ведущем крае клеток (Gimona et al., 1994; Hoock et al., 1991). Доступность эпитопа зависит от условий фиксации-пермеабилизации, что объясняет некоторые противоречия. После тестирования различных способов фиксации, была выбрана последовательная фиксацию 1%PFA и метанолом, что привело к регулярному выявлению -CYA стресс-фибрилл в дополнение к ранее описанной локализации на ведущем крае, а также продемонстрировало лучшие условия детекции N-концевого эпитопа актина. В соответствии с результатами иммунофлуоресцентных изучений находятся и данные по локализации -CYA с помощью экспрессии CYA, в котором флуоресцентный белок сшит с С-концом молекулы для сохранения специфичности изоформы:

-CYA-GFP встраивается в стресс-фибриллы. Для -CYA описанная выше фиксация также оптимальна и совпадает с локализацией экзогенного флуоресцентного белка. В отличие от -CYA, распределение -CYA в эпителиальных и мезенхимальных клетках не было описано.

В работе представлены экспериментальные доказательства различного распределения цитоплазматических актинов в нормальных немышечных клетках:

1) Эксперименты с siRNA показали, что в -CYA-дефицитных клетках сильно редуцировано содержание стресс-фибрилл, тогда как -CYA-дефицитные клетки не образуют ламеллиподиальные протрузии.

2) Формирование стресс-фибрилл и ламеллиподий регулируется малыми ГТФ-азами RhoA и Rac1, соответственно (Ridley, Hall, 1992). Селективные ингибиторы RhoAкиназы и Rac1 специфически воздействуют на распределение - и -CYA.

3) Обнаружено, что системы - и -CYA обладают дифференцированной реакцией на агенты, деполимеризующие актин, при использовании данных веществ в минимальных концентрациях в процессе реорганизации актина.

4) Специфический маркер ламеллиподий (белок p34Arc семейства Arp2/3) колокализован на ведущем крае с -CYA, тогда как -CYA колокализован с белком VASP в сайтах инициации полимеризации актина.

Важным свойством, связанным с организацией актина, является клеточная полярность. В эпителиальных клетках плазматическая мембрана и цитоскелетные белки организованы в апикальные и базо-латеральные домены, обладающие структурными и функциональными отличиями (Nelson, 2003; Yeaman et al., 1999). В эпителиальных клетках - и -CYA сегрегированы в базо-латеральный и апикальный домены, соответственно (Рис. 11). Эксперименты с siRNA предполагают роли - и CYA для формирования правильной эпителиальной полярности:

-CYA-дефицитные клетки теряют организованные AJ и становятся более распластанными; -CYAдефицитные кератиноциты приобретают сократимый фенотип, который выражается в формировании стресс-фибрилл.

В культивируемых фибробластах планарная полярность характеризуется выбрасыванием ламеллиподий в направлении миграции и ретрактирующей «хвостовой» частью клетки (Abercrombie et al., 1970). Метод экспериментальных ран в культуре продемонстрировал градиент изменений от сократимого фенотипа, с преобладанием -CYA-стресс-фибрилл в глубине монослоя до подвижного фенотипа с преобладанием -CYA в протрузиях. - и -CYA колокализованы в ламеллиподии, обе изоформы присутствуют в ламелле, но распределены в разных филаментных структурах. -CYA, локализуется в пучках, концы которых соединены с ФК. В нормальных фибробластах мРНК -CYA концентрируется во фронтальной части ламеллы, но заново синтезированный актин вносит незначительный вклад во фракцию мономерного актина на ведущем крае клетки (Condeelis, Singer, 2005).

Методом трекинга одиночных -CYA мРНК было показано, что транспортировка этих мРНК к ФК приводит к их стабилизации (Katz et al., 2012). Эти результаты согласуются с нашими данными о роли -CYA в клетке.

Ведущая роль -CYA в контроле направленности движения следует из результатов siRNA экспериментов. Помимо поляризации, в миграцию фибробластов вовлечены и другие процессы: выбрасывание ведущей ламеллы, прикрепление клетки к субстрату путем формирования ФК с ECM, передвижение тела клетки и высвобождение мест прикрепления (Lauffenburger, Horwitz, 1996; Ridley et al., 2003).

Протрузионная активность блокирована при пониженной экспрессии -CYA, но ненаправленная двигательная активность в этих условиях сохраняется. -CYA также играет роль в клеточной миграции, что было выявлено при оценке скорости движения клеток, которая у -CYA-дефицитных клеток была ниже, чем в контроле, при сравнении этого параметра только в периоды движения.

Сравнение нормальных и трансформированных клеток показало, что при различных типах неопластической трансформации происходит изменение специфической изоформы актина -CYA. Фенотипическая нормализация трансформированных фибробластов и эпителиальных клеток под действием митохондриально-направленных антиоксидантов приводила к восстановлению CYA системы пучков и сопряженных с ними ФК у фибробластов и AJ в эпителии.

Сортинг -CYA в миозин II-зависимые сократимые структуры показывает роль этой изоформы в клеточном сокращении. Специфическое ингибирование сократимости блокировало образование -CYA-содержащих стресс-фибрилл, но не разрушало сеть -CYA. Подобный подвижный фенотип, меньшее количество стрессфибрилл и ведущий край с активными протрузиями наблюдали у миозин IIAдефицитных клеток (Even-Ram et al., 2007; Sandquist et al., 2006). Блеббистатин блокировал клеточное натяжение, приводил к диссоциации стресс-фибрилл и ингибировал соединение миозина II с актином (Goeckeler et al., 2008). В наших экспериментах ингибирование активности миозина мешало формированию -CYA стресс-фибрилл. Вероятно, -CYA специфически взаимодействует с миозином IIA, что также следует из колокализации этих двух белков.

Еще одним аргументом в пользу роли -CYA в клеточной сократимости является локализация этой изоформы в сократимом кольце при цитокинезе, в то время как -CYA всегда концентрируется в кортексе. Образование многоядерных клеток в -CYA-дефицитных кератиноцитах полностью согласуется с данными об участии -CYA в образовании сократимого кольца при клеточном делении.

Продолжением митотических исследований была совместная работа с эмбриологической группой (Brockmann et al, 2011), в которой показано, что CYAs поразному распределены в созревающих ооцитах. -CYA локализован в кортикальном слое ооцитов и отсутствует в зоне межклеточных контактов от поздней метафазы II до бластоцистной стадии. -CYA концентрировался в сократимых структурах при цитокинезе, в межклеточных контактах и вокруг бластоцистной полости.

Сократимый фенотип -CYA-дефицитных фибробластов характеризуется редукцией протрузионных структур и появлением -SMA в стресс-фибриллах. Такое повышение экспрессии -SMA может быть одним из последовательных этапов дифференцировки в направлении миофибробластного фенотипа (Hinz et al., 2002).


Однако, нельзя исключить, что наблюдаемое повышение количества -SMA является результатом компенсаторного синтеза в ответ на уменьшение экспрессии -CYA.

ЧАСТЬ 4. Исследование реорганизации изоформ актина в нормальных и опухолевых тканях человека Распределение изоформ актина в клетках нормальной, диспластической и иммуноморфологическое исследование локализации CYAs в структурах нормальной и опухолевой ткани молочной железы человека. Исследование распределения изоформ актина сопровождалось определением кератина 8 (К8), типичного для выстилающего эпителия, базального кератина 17 (К17) и -SMA, выявляющих миоэпителий, а также маркера базальных мембран – ламинина. Ранее было показано, что сочетание этих маркеров позволяет отличать диспластические структуры от злокачественных (Guelstein et al., 1988; 1993): сочетание базальных и люминальных кератинов встречается обычно при доброкачественной пролиферации, а присутствие исключительно люминальных или простых кератинов, таких как К8, указывает на злокачественные структуры. Данные характеристики не относятся к особым формам рака молочной железы (РМЖ).

Специфические mAbs к -CYA и -CYA полярно окрашивали клетки однослойного выстилающего эпителия нормальных структур молочной железы человека:

-CYA выявлен в апикальной части клеток выстилающего эпителия, а CYA выявлен в виде базо-латеральных точечных и филаментозных структур.

Базальный слой нормальных структур образован миоэпителиальными клетками. mAb к -CYA выявляли ярко окрашенные пучки микрофиламентов в этом слое.

Миоэпителиальная природа этих клеток была подтверждена выявлением -SMA в стресс-фибриллах, а также окраской К17 в протоках и больших альвеолах. Окраска на ламинин выявляла базальную мембрану, окружающую миоэпителиальный слой.

Исследование распределения изоформ актина в доброкачественных опухолях и диспластических структурах молочной железы человека.

Интенсивное окрашивание mAbs к - и -CYA было выявлено практически во всех рассмотренных случаях доброкачественных пролифератов молочной железы. В тех случаях, когда не была нарушена двуслойная структура железы, пролиферирующие клетки сохраняли полярное распределение CYAs подобно нормальному выстилающему эпителию: апикальное для -CYA и базо-латеральное для -CYA.

Сохранение двуслойной папиллярной структуры подтверждалось окрашиванием К8 в выстилающем эпителии и К17 в миоэпителии. В клетках доброкачественных пролифератов многослойного типа исчезало полярное распределение -CYA и CYA, окрашивание mAbs к -CYA было гомогенным, а -CYA окрашивание подчеркивало полигональные контуры клеток. Доброкачественная природа пролифератов подтверждалась одновременной окраской на К8 и К17. Базальный слой всех доброкачественных пролифератов состоял из миоэпителия, позитивного на К и -SMA, окруженных базальной мембраной, выявляемой Abs к ламинину (Рис.12).

Исследование распределения изоформ актина в злокачественных опухолях люминального типа. При исследовании инфильтративных карцином различного строения большинство опухолевых клеток были гомогенно окрашены mAbs к -CYA с примембранным усилением интенсивности окраски. Такой тип окрашивания CYAs был выявлен как в структурах in situ, так и в инфильтративном компоненте и метастазах. Клетки карцином, заполняющие просвет железистой структуры, экспрессировали только К8, что подтверждало их злокачественную природу.

Интенсивность окраски на -CYA существенно снижалась (Рис.12). Исключение Рис. 12. Распределение изоформ актина, кератинов и ламинина при гиперпластическом процессе (А-Г) и в сходных структурах протокового РМЖ in situ (Д-З). (А, Д) – гематоксилин-эозин; Б-Г, Е-З – двойное окрашивание mAbs к: (Б, Е) К8 (зеленый) и ламинину (красный); (В, Ж) -SMA (зеленый – миоэпителий) и К (В, красный, окраска клеток внутри пролиферата) в отличие от внутрипротокового РМЖ (Ж, положительная окраска в миоэпителии, желтый- совместно с -SMA); (Г, З) - (зеленый) и -CYA (красный): клетки внутри пролиферата окрашены на - и CYA (Г, желтый, коэкспрессия), в отличие от внутрипротокового РМЖ (З, положительная окраска -CYA выявляется только в миоэпителии, клетки внутрипротокового РМЖ окрашены mAbs к -CYA. Серийные криостатные срезы.

Иммунофлуоресцентная микроскопия. Увеличение х120.

составляли низкодифференцированные формы инфильтративных РМЖ высокой степени злокачественности, у которых в клетках опухоли часто встречались маркеры базального эпителия, поэтому их называют базальноподобными РМЖ (Perou et al., 2000; Sorlie et al., 2001). Окраска на -CYA в солидных участках этих форм РМЖ была сохранена, но снижена в скиррозном компоненте.

Распределение изоформ актина в клетках нормальной, диспластической и опухолевой ткани молочной железы человека. Результаты иммуногистологических исследований показали, что в клетках нормального железистого эпителия молочной железы существует полярное распределение CYAs, а именно, селективное распределение - и -CYA в разных клеточных компартментах (базолатеральном и апикальном, соответственно). Феномен сегрегации CYAs, обнаруженный при изучении клеток в культуре, получил подтверждение при изучении экспрессии и распределения CYAs в нормальной ткани молочной железы in vivo. При окраске на CYAs клетки дисплазий имели смешанный фенотип: - и -CYA выявлялись в одних и тех же клетках без видимых различий в распределении, в то время как в карциномах экспрессия -CYA значительно уменьшалась. Таким образом, -CYA возможно использовать в качестве дополнительного маркера в дифференциальной диагностике доброкачественных гиперплазий и люминального РМЖ.

Реорганизация изоформ актина и адгезионных контактов в клетках цервикальных карцином. Иммуногистологическое исследование выявило снижение окрашивания -CYA в структурах рака in situ и инвазивного рака по сравнению с нормальной тканью экзоцервикса и интраэпителиальными неоплазиями. При ЭМП в культурах клеток цервикальных карцином, помимо изменений в распределении и экспрессии известных маркеров Snail, Е- и N-кадгеринов и виментина, происходит реорганизация -CYA структур и относительное снижение экспрессии этой изоформы актина (Шагиева и др., 2012). Иммуноморфологическое исследование клинического материала подтверждает данные, полученные на клеточных культурах.

ЗАКЛЮЧЕНИЕ

Итогом экспериментальных исследований было, в первую очередь, получение достоверных данных о роли гладкомышечной изоформы актина (-SMA) в немышечных клетках – фибробластах. Проведено сравнение -SMA негативных и SMA позитивных фибробластов разного органного и тканевого происхождения, их морфологии, актинового цитоскелета и контактных структур. Показано, что морфологические и цитоскелетные характеристики фибробластов различны в зависимости от присутствия -SMA. Роль -SMA при индукции миофибробластной дифференцировки изучена с помощью TGF. Для выполнения данной задачи была использована LSM с 3D реконструкцией изображения, а также биохимические методы. Обнаружено, что индукция миофибробластного фенотипа сопровождается значительным увеличением размеров ФК с образованием 3D структур, названных «суперзрелыми» ФК, которые были связаны с -SMA позитивными пучками;

экспрессия винкулина, паксиллина, тензина, FAK и интегрина 51 в таких ФК повышена. Особую роль в индукции экспрессии -SMA играл ED-A FN. Комплексная структура контактов с ECM и растущая устойчивость ED-A FN сети к натяжению, продуцируемому клетками с -SMA, были необходимы для суперсозревания ФК.

Окончательное состояние ФК определяется балансом двух сил – центробежным актомиозиновым натяжением и устойчивостью ECM.

Для сравнительного исследования цитоплазматических изоформ актина - и CYA протестированы разные линии и первичные культуры клеток животных и человека. Особое внимание было уделено линиям клеток нормального эпителия, а также линиям опухолевых клеток эпителиального происхождения, т.к. в клетках этого типа экспрессируются только две изоформы актина, - и -CYA. Получены новые данные о сравнительной структуре и белковой композиции кортикальных и ламеллиподиальных -CYA сетей, а также -CYA пучков и контактных структур в нормальных и неопластически трансформированных клетках. Анализ 3D взаимной организации - и -CYA проведен с использованием LSM. Показано, что -CYA преимущественно локализован в филоподиях, стресс-фибриллах, кольцевых пучках и адгезионных межклеточных контактах, что означает роль этой изоформы в клеточной адгезии и сокращении. -CYA организован по-разному в зависимости от клеточной активности: в виде кортикальных и ламеллиподиальных сетей в движущихся клетках, что предполагает его роль в клеточной подвижности; в стационарных клетках -CYA также может быть локализован в дорзальных пучках. Исследованы изменения в организации актиновых структур в условиях обработки клеток ингибиторами сигнальных путей, в различной степени воздействующими на разные актиновые системы.

Изучение функций изоформ было продолжено в экспериментах с помощью специфического уменьшения экспрессии - и -CYA РНК-интерференционным методом с последующим анализом функциональных изменений. Мы обнаружили, что снижение экспрессии - и -CYA с помощью siРНК вызывает морфологические и функциональные изменения нормальных фибробластов и эпителиальных клеток.

Уменьшение количества -CYA приводит к усилению распластывания и направленной подвижности, тогда как снижение экспрессии -CYA усиливает сократимый фенотип у нормальных клеток и тормозит направленную подвижность.

Проведены исследования организации - и -CYA в митотическом процессе, а также в мейотических делениях клетки и ранних эмбриональных делениях. Эти модели являются важными аналогами процессов, происходящих при опухолевой трансформации с предполагаемым вовлечением клеток-предшественников так называемого стволового происхождения.



Pages:   || 2 |
 


Похожие работы:

«ПЕТРОВ Николай Сергеевич Взаимодействие р130 – белка семейства pRb, и -катенина – передатчика сигналов Wnt, в ходе дифференцировки и трансформации мезенхимных стволовых клеток мыши 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2012 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук (Санкт-Петербург) Научный...»

«ТАШИРЕВА Любовь Александровна РОЛЬ ВНУТРИКЛЕТОЧНЫХ ГАЗОВЫХ ТРАНСМИТТЕРОВ В МОЛЕКУЛЯРНЫХ МЕХАНИЗМАХ РЕАЛИЗАЦИИ АПОПТОЗА ОПУХОЛЕВЫХ КЛЕТОК КРОВИ 14.03.03 – патологическая физиология 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Томск – 2014 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Сибирский государственный медицинский...»

«ТУЛУПОВ Андрей Александрович ВОЗМОЖНОСТИ МАГНИТНО-РЕЗОНАНСНОЙ ТОМОГРАФИИ В МОРФО-ФУНКЦИОНАЛЬНОЙ ОЦЕНКЕ ЦЕРЕБРАЛЬНОГО ВЕНОЗНОГО КРОВОТОКА И ЛИКВОРОЦИРКУЛЯЦИИ 14.01.13 - лучевая диагностика, лучевая терапия 03.03.01 - физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук Томск – 2011 Работа выполнена в Учреждении Российской академии наук Институте Международный томографический центр Сибирского отделения РАН (г. Новосибирск, Россия). Научные...»

«Зубарев Илья Владимирович РОЛЬ ХРОНИЧЕСКИХ ПОРАЖЕНИЙ ПЕЧЕНИ МАТЕРИ В НАРУШЕНИИ СТАНОВЛЕНИЯ ЭНДОКРИННОЙ И РЕПРОДУКТИВНОЙ ФУНКЦИИ ЯИЧНИКОВ ПОТОМСТВА В УСЛОВИЯХ ЭКСПЕРИМЕНТА 03.03.04 Клеточная биология, цитология, гистология Автореферат диссертации на соискание ученой степени кандидата биологических наук Оренбург, 2012 Работа выполнена в Федеральном государственном бюджетном 1 образовательном учреждении высшего профессионального образования Челябинский государственный...»

«Михеева Эльза Равилевна МОРФОФУНКЦИОНАЛЬНАЯ И БИОХИМИЧЕСКАЯ АЛЬТЕРАЦИЯ КЛЕТОК КРОВИ КВАНТОВЫМИ ТОЧКАМИ 03.03.01 – физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Нижний Новгород 2011 Работа выполнена в Нижегородском государственном техническом университете им. Р.Е. Алексеева доктор биологических наук, профессор Научный руководитель : Плескова Светлана Николаевна доктор биологических наук, профессор Официальные оппоненты : Корягин...»

«ГОРЕЛОВА МАРИНА ВЯЧЕСЛАВОВНА ИЗМЕНЕНИЯ ПРОЛИФЕРАЦИИ И ДИФФЕРЕНЦИРОВКИ КЕРАТИНОЦИТОВ ИНТЕРФОЛЛИКУЛЯРНОГО ЭПИДЕРМИСА ВИСОЧНОЙ ОБЛАСТИ У ЛИЦ МУЖСКОГО ПОЛА В ОНТОГЕНЕЗЕ 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертация на соискание учной степени кандидата медицинских наук Москва – 2011 Работа выполнена на кафедре гистологии, цитологии и эмбриологии медицинского института ФГБОУ ВПО Орловский государственный университет и в Научном отделе ЗАО...»

«Шемонаев Виктор Иванович ИНДИВИДУАЛЬНО-ТИПОЛОГИЧЕСКИЕ И ХРОНОФИЗИОЛОГИЧЕСКИЕ АСПЕКТЫ СТОМАТОЛОГИЧЕСКОГО ОРТОПЕДИЧЕСКОГО ЛЕЧЕНИЯ И ДИАГНОСТИКИ 14.01.14 - стоматология 03.03.01 - физиология Автореферат диссертации на соискание ученой степени доктора медицинских наук Волгоград - 2012 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный медицинский университет Министерства здравоохранения...»

«Назирова Анна Анатольевна Иммунофизиологические особенности здоровья женщин и роль экопатогенных факторов среды обитания в развитии антифосфолипидного синдрома 03.03.01 – физиология Автореферат диссертации на соискание учёной степени кандидата биологических наук Москва – 2010 Работа выполнена на кафедре медико-биологических дисциплин Государственного образовательного учреждения высшего профессионального образования Липецкий государственный педагогический университет доктор...»

«АБРАМОВА Марина Алексеевна ФЛОУМЕТРИЧЕСКАЯ ХАРАКТЕРИСТИКА ВНЕШНЕГО ДЫХАНИЯ У ДЕТЕЙ ШКОЛЬНОГО ВОЗРАСТА СО СКОЛИОЗОМ В УСЛОВИЯХ ЕВРОПЕЙСКОГО СЕВЕРА 03.03.01 – Физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Архангельск - 2013 Работа выполнена в Институте медико-биологических исследований федерального государственного автономного образовательного учреждения высшего профессионального образования Северный (Арктический) федеральный...»

«Калинин Сергей Алексеевич ОПОЗНАНИЕ СЛОЖНЫХ ИЗОБРАЖЕНИЙ ПРИ ИХ ПРЯМОЙ МАСКИРОВКЕ 03.03.01 - Физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2013 2 Диссертация выполнена в лаборатории физиологии сенсорных систем (зав. лабораторией – доктор биологических наук И.В. Бондарь) Федерального государственного бюджетного...»

«БАЛАКЛЕЙЦЕВ Сергей Александрович АДАПТИВНЫЕ РЕАКЦИИ И РАЗРАБОТКА ОРГАНИЗАЦИОННОМЕТОДИЧЕСКИХ ПРИНЦИПОВ БЕЗОПАСНОСТИ ПРИ ЗАНЯТИЯХ МУЛЬТИСПОРТОМ В УСЛОВИЯХ СРЕДНЕ - И ВЫСОКОГОРЬЯ 03.03.01 – физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2010 Работа выполнена в ГОУ ВПО Сочинский государственный университет туризма и курортного дела Научный руководитель доктор биологических наук Рябцев Сергей Михайлович Официальные оппоненты :...»

«Логинова Анастасия Константиновна СТРУКТУРНО - ФУНКЦИОНАЛЬНЫЕ ИЗМЕНЕНИЯ ГИПОТАЛАМО – ГИПОФИЗАРНО – ГОНАДНОЙ СИСТЕМЫ КРЫС В УСЛОВИЯХ ВОЗДЕЙСТВИЯ ДЕСТАБИЛИЗИРУЮЩИХ ФАКТОРОВ 03.03.04 – Клеточная биология, цитология, гистология 03.02.03 - Микробиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Оренбург – 2013 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Оренбургская...»

«Караман Юлия Константиновна МЕХАНИЗМЫ АДАПТАЦИИ ОРГАНИЗМА К АЛИМЕНТАРНОЙ ВЫСОКОЖИРОВОЙ НАГРУЗКЕ 03.03.01 – физиология 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Владивосток – 2011 2 Работа выполнена в лаборатории биомедицинских исследований во Владивостокском филиале Учреждения Российской академии медицинских наук Дальневосточного научного центра физиологии и патологии дыхания Сибирского Отделения Российской академии...»

«Роик Анастасия Олеговна КОДИРОВАНИЕ ОСОБЕННОСТЕЙ КОГНИТИВНОЙ ДЕЯТЕЛЬНОСТИ В РИТМИЧЕСКОМ РИСУНКЕ ЭЭГ Специальность 03.03.01 - физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук МОСКВА – 2012 1 Работа выполнена в Лаборатории высшей нервной деятельности человека (зав. лаб. – чл.-корр. РАН А.М. Иваницкий) Учреждения Российской академии наук Институте высшей нервной деятельности и нейрофизиологии РАН (директор – доктор биологических наук,...»

«СИНЕВА Галина Сергеевна АДГЕЗИОННАЯ И ТРАНСКРИПЦИОННАЯ ФУНКЦИИ -КАТЕНИНА В САМООБНОВЛЕНИИ ЭМБРИОНАЛЬНЫХ СТВОЛОВЫХ КЛЕТОК МЫШИ 03.03.04 - Клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2012 Работа вь1полнена в лаборатории молекулярньтх основ дифференцировки клеток Федерального государственного бходжетного учреждения науки Анститута цитологии РАн, €анкт-|1етербур| доктор биологических...»

«Моросанова Мария Александровна Механизмы повреждения клеток эпителия почечных канальцев при моделировании пиелонефрита in vitro 03.03.04 - клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук МОСКВА 2013 1 Работа выполнена на факультете биоинженерии и биоинформатики и в НИИ физикохимической биологии имени А.Н. Белозерского Федерального государственного бюджетного образовательного учреждения высшего...»

«КОМАРОВА Елена Юрьевна Роль шаперона Hsp70 в реакции опухолевых клеток с повышенной экспрессией протоонкогена Myc на действие противоопухолевых препаратов 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2010 22 Работа выполнена в Лаборатории защитных механизмов клетки Института цитологии РАН, Санкт-Петербург Научный руководитель : доктор биологических наук Ирина Владимировна...»

«ЛОЦМАНОВА Наталья Сергеевна ГЕНЕТИЧЕСКАЯ ТРАНСФОРМАЦИЯ ПОЛОВЫХ КЛЕТОК КРОЛИКОВ И ХРЯКОВ С ИСПОЛЬЗОВАНИЕМ РЕТРОВИРУСНЫХ ВЕКТОРОВ 03.02.07 – Генетика 03.03.01 – Физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Дубровицы - 2011 Работа выполнена в Центре биотехнологии и молекулярной диагностики животных Государственного научного учреждения Всероссийский научноисследовательский институт животноводства Российской академии...»

«ГУМЕРОВА АНИСА АЗАТОВНА ГИСТО- И ЦИТОГЕНЕЗ ПЕЧЕНИ ЧЕЛОВЕКА И КРЫСЫ В ХОДЕ ПРЕНАТАЛЬНОГО РАЗВИТИЯ И РЕПАРАТИВНОЙ РЕГЕНЕРАЦИИ 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора медицинских наук Казань – 2012 2 Работа выполнена в ГБОУ ВПО Казанский государственный медицинский университет Министерства здравоохранения и социального развития России Научный консультант : доктор медицинских наук, профессор Киясов Андрей...»

«Хващинский Дмитрий Альбертович ФИЗИОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ МЕТОДОВ ОТБОРА ПОДРОСТКОВ К СОВРЕМЕННОМУ ПРОФИЛЬНОМУ ОБУЧЕНИЮ 03.03.01 – Физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2011 Работа выполнена на кафедре нормальной физиологии медицинского факультета Федерального государственного бюджетного образовательного учреждения высшего профессионального образования Российский университет дружбы народов. доктор медицинских...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.