WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Суворова Ирина Игоревна

Активация ATM/ATR-сигнального пути в эмбриональных

стволовых клетках после повреждения ДНК

03.03.04

Клеточная биология, цитология, гистология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Санкт-Петербург 2014

Работа выполнена в лаборатории молекулярных основ дифференцировки клеток Федерального государственного бюджетного учреждения науки Института цитологии РАН, Санкт-Петербург

Научный руководитель: доктор биологических наук, профессор Поспелов Валерий Анатольевич Институт цитологии РАН

Официальные оппоненты: Дыбан Павел Андреевич доктор медицинских наук, профессор Институт экспериментальной медицины РАН Гордеева Ольга Федоровна кандидат биологических наук Институт биологии развития им. Н.К. Кольцова РАН

Ведущая организация: Федеральное государственное бюджетное учреждение науки Институт молекулярной генетики РАН

Защита состоится «30» мая 2014 года в 14 часов на заседании диссертационного совета Д.002.230.01 на базе Института цитологии РАН по адресу: 194064, Санкт-Петербург, Тихорецкий пр., д. Сайт института: www.cytspb.rssi.ru Адрес электронной почты института: cellbio@mail.cytspb.rssi.ru Факс института: (812) 297-35-

С диссертацией можно ознакомиться в библиотеке Института цитологии РАН

Автореферат разослан «29» апреля 2014 г.

Ученый секретарь диссертационного совета, кандидат биологических наук Е.В. Каминская

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Эмбриональные стволовые клетки (ЭСК) представляют большой научнопрактический интерес, так как они могут быть использованы для получения дифференцированных производных – клеток и тканей, необходимых для целей регенеративной медицины и клеточной терапии. Дополнительной мощной поддержкой для исследования ЭСК явилась разработка принципиально новых методов, направленных на получение индуцированных плюрипотентных клеток (iPSCs) из обычных соматических клеток, которые имеют много общих свойств с ЭСК.





Использование ЭСК в развитии биомедицинских технологиях возможно благодаря их уникальным свойствам – плюрипотентности и самообновлению. Однако главной проблемой терапевтического применения ЭСК остается проблема генетической стабильности популяции этих клеток. На фоне неограниченной пролиферативной активности ЭСК, когда большая часть (60-70%) популяции находится в фазе синтеза, возникающие, в том числе и при репликации ДНК, повреждения ДНК могут накапливаться в виде мутаций. Поскольку возникающие мутации несут серьезную угрозу для всех дифференцированных клеточных потомков, в ЭСК должны функционировать механизмы, которые минимизировали бы последствия различных генотоксических воздействий.

В соматических клетках поддержание стабильности и целостности генома происходит через активацию ATM/ATR-сигнального каскада, который координирует общий клеточный ответ на повреждение ДНК, вовлекая сигнальные пути, ответственные за остановку клеточного цикла (чекпойнт-контроль), репарацию, индукцию апоптоза и старения. Клеточный ответ на повреждение ДНК начинается с активации сенсорных киназ АТМ и ATR, которые распознают повреждения ДНК и в свою очередь активируют нижележащие сигнальные пути. Киназы АТМ и ATR участвуют в фосфорилировании гистона H2AX по Ser139 в области разрывов ДНК с образованием фокусов H2AX – обязательный этап для формирования репаративных фокусов. К местам фокусов H2AX привлекается множество белков, среди которых комплекс Mre11/Nbs1/Rad50, MDC1, BRCA-1, адапторный белок 53ВР1, репаративные белки Rad51, киназы DNA-PK и Ku70/80 и другие (Paull et al., 2000; Fernandez-Capetillo et al., 2003). Параллельно ATM и ATR фосфорилируют нижележащие киназы Chk2 и Chk1 и совместно с ними участвуют в активации (фосфорилироваии) и стабилизации опухолевого супрессора р53. Белок р53 является транскрипционным фактором и трансактивирует множество генов-мишеней, в частности ген р21/Waf1, белковый продукт которого ингибирует циклин-зависимые киназные комплексы и опосредует остановку клеточного цикла на границе фаз G1/S при действии генотоксического стресса.

ЭСК не останавливаются в контрольной точке G1/S клеточного цикла, в которой клетки с поврежденной ДНК не допускаются до процесса репликации и подвергаются только временному блоку G2/M (Малашичева и др., 2002; Becker et al., 2006; Chuykin et al., 2008). Поэтому можно предположить, что в ЭСК реализуются особые механизмы клеточного ответа на повреждение ДНК, которые строго скоординированы с их главными свойствами – плюрипотентностью и самообновлением – и (в значительной степени) могут отличаться от ответа соматических клеток. Исследование активации ATM/ATR-сигнального пути в ЭСК при действии генотоксических факторов расширит наше понимание фундаментальных механизмов, лежащих в основе поддержания стабильности и целостности генома этих клеток.

Целью данной работы является исследование особенностей активации ATM/ATRсигнального пути в ЭСК мыши и человека (мЭСК, чЭСК) после повреждения ДНК.

Были сформулированы следующие задачи:

Исследовать способность ЭСК к активации сенсорных киназ ATM, ATR и последующему формированию репаративных фокусов в местах повреждений ДНК после облучения.





Выявить вклад киназ ATM, ATR, Chk1 и Chk2 в распределение ЭСК по клеточному циклу, в частности в реализацию временного блока G2/M, и выживаемость после облучения.

Проанализировать функциональный статус сигнального пути р53-р21/Waf1 в ЭСК после повреждения ДНК.

Провести сравнительное изучение последствий активации сигнального пути р53-р21/Waf1 в клетках при действии облучения и при действии нутлина – специфического блокатора протеасомной деградации белка р53 на структуру клеточного цикла и плюрипотентные свойства мЭСК.

Ингибирование сигнального каскада ATR-Chk1 в большей степени, чем ATM-Chk2, оказывает влияние на параметры клеточного цикла мЭСК и выживаемость в норме и после облучения. Киназы АТМ, Chk2 и Chk1 вовлечены в реализацию блока G2/M после облучения ЭСК человека.

В ответ на генотоксическое воздействие ЭСК способны распознавать повреждения ДНК, активируя ключевые киназы ATM и ATR, с последующим формированием репаративных фокусов в местах разрывов ДНК.

Несмотря на активацию р53 в ЭСК на ранних сроках после облучения, накопления белка-мишени р21/Waf1 не происходит по причине его протеасомной деградации. При этом часть клеток погибает апоптозом, а оставшиеся в живых клетки способны экспрессировать белок р21/Waf1, благодаря чему восстанавливается контрольная точка G1/S и запускается дифференцировка.

Запуск экспрессии р21/Waf1, вызванный действием ингибитора гистондеацетилаз бутиратом натрия (NaBut) по р53-независимому механизму, также сопровождается восстановлением контрольной точки G1/S.

Активация транскрипционного фактора р53, индуцированная как облучением, так и нутлином, сопровождается апоптотической гибелью клеток, а также приводит к изменению параметров клеточного цикла, снижению экспрессии плюрипотентных маркеров и индукции дифференцировки в выживших клетках.

Нутлин-зависимая активация р53 в мЭСК сопровождается накоплением белка р21/Waf1, восстановлением контрольной точки G1/S и индукцией дифференцировки. Таким образом, независимо от механизма действия использованных агентов, снижение уровня пролиферативной активности мЭСК, сопровождаемое накоплением белка р21/Waf1, предшествует дифференцировке.

Впервые был продемонстрирован различный вклад киназ ATM, ATR, Chk1, Chk киназ в распределение по клеточному циклу и выживаемость ЭСК. Были найдены основные отличия в участии этих киназ в клеточной прогрессии ЭСК человека и мыши.

Так, сигнальный каскад ATR-Chk1, но не ATM-Chk2, вносит значительный вклад в распределение мЭСК по клеточному циклу и выживаемость. В отличие от мЭСК, профиль клеточного цикла чЭСК в значительной степени зависит от активности киназы ATM, ее мишени Chk2, а также киназы Chk1, которые участвуют в реализации временного блока G2/M после облучения.

Полученные результаты также открывают новые функции р53 в регуляции плюрипотентности и самообновления ЭСК. Мы выявили функциональную значимость исследованной дисфункции сигнального пути р53-р21/Waf1 в мЭСК. Так, впервые было показано, что клеточный ответ мЭСК на повреждение ДНК сопровождается не только апоптотичекой гибелью, но и сопутствует индукции программы дифференцировки. Так, активация р53 приводит к подавлению экспрессии плюрипотентных маркеров Oct3/4 и Nanog и последующему запуску дифференцировки после облучения. Кроме того, впервые были исследованы последствия активации белка р53 с помощью агента нутлина на пролиферацию, плюрипотентность и индукцию дифференцировки в мЭСК. Были получены новые данные, что, несмотря на некоторые отличия в р53-зависимом действии облучения и нутлина на экспрессию факторов плюрипотентности Oct3/4 и Nanog, общий механизм подавления плюрипотентного состояния мЭСК обусловлен повышением уровня белка р21/Waf1. Таким образом, частичная дисфункция сигнального пути р53p21/Waf1, ограничивающая продолжительность фазы G1, способствует подержанию недифференцированного состояния и плюрипотентности ЭСК.

Все экспериментальные части работы были выполнены автором лично. Анализ подготовленных автором проб для проточной цитофлуориметрии осуществлял Аксенов Н.Д. Материалы, вошедшие в представленную работу, обсуждались с соавторами и научным руководителем.

Полученные результаты вносят вклад в понимание механизмов, ответственных за сохранение стабильности и целостности генома ЭСК. Нарушения в регуляции клеточного ответа на повреждение ДНК играют центральную роль в процессах опухолеобразования. Знания о механизмах, участвующих в ответе ЭСК, которые по свойствам во многом сходны с раковыми, на повреждения ДНК могут быть использованы в развитии новых подходов в противоопухолевой терапии.

Кроме того, полученные результаты данного исследования могут быть использованы для повышения эффективности получения аналогов ЭСК – индуцированных плюрипотентных стволовых клеток (induced pluripotent stem cells, iPSCs), так как на пути их репрограммирования барьером выступает сигнальный путь р53-р21/Waf1.

Материалы диссертации могут быть включены в лекционные курсы по клеточной биологии.

По теме диссертации опубликовано 2 статьи и 1 обзор. Материалы диссертации были представлены на российских и международных конференциях: международной конференции Cell Science and Stem Cell Research (Балтимор, США, 20-22 ноября, 2013 г., устный доклад), международной конференции 11th ISSCR (International Society for Stem Cell Research) Annual Meeting 2013 (Бостон, США, 12-15 июня 2013 г., постер), III съезде общества клеточной биологии (Санкт-Петербург, 16-18 октября 2012 г., постер), III конференции молодых ученых Института цитологии РАН (Санкт-Петербург, 15-16 мая 2012 г., устный доклад), II конференции молодых ученых Института цитологии РАН (Санкт-Петербург, 15-16 февраля 2010 г., устный доклад).

Диссертация построена по общепринятому плану и состоит из введения, обзора литературы, описания материалов и методов, результатов исследования, их обсуждения, заключения, выводов и списка цитированной литературы. Материалы диссертации изложены на _110_страницах машинописного текста и содержат _2_ схемы и _19_ рисунков.

МАТЕРИАЛЫ И МЕТОДЫ

Культивирование клеток. м ЭСК линии IOUD2 культивировали при 37 °С и 5 % CO2 в пластиковых чашках Петри (Corning, США), покрытых 0.2%-ным раствором желатина (Sigma, США) в среде DMEM/F12 (Биолот, Россия), содержащей 0.1 мМ 2меркаптоэтанола, 0.1 мМ заменимых аминокислот и 1 мМ пирувата (Gibco, США), 10 % сыворотки (Hyclone, США), 50 ед/мл фактора LIF (Sigma, США) или 1000 ед/мл рекомбинантного LIF. Последний был экспрессирован Е.сoli при использовании конструкции pGEX-2Т-hLIF и очищен на глутатион-сефарозе (конструкция любезно предоставлена Томилиным А.Н., Институт цитологии РАН).

ч ЭСК линии 910 были получены Кожухаровой И.В. в Институте цитологии РАН.

Источником для получения чЭСК линии 910 служили избыточные бластоцисты, не использованные в процессе экстракорпорального оплодотворения. Получали чЭСК из бластоцисты согласно протоколу, описанному Кожухаровой и др. (Кожухарова и др., 2009). Линия чЭСК была адаптирована к бесфидерному культивированию с использованием матригеля (BD Bioscience, США). Культивирование проводили в среде mTeSR (Stemсell Technologies, Канада) при 37 0С в атмосфере 6% СО2. Через каждые 5- сут колонии чЭСК механически разделяли и пересевали в соотношении 1:2. Среду для культивирования меняли ежедневно.

Клетки линии NIH3T3 культивировали в среде DMEM (Биолот, Россия), содержащей 10% эмбриональной бычьей сыворотки (HyClone, США) и 0.1 мг/мл гентамицина (Биолот) в атмосфере 5% СО2 при 37 С.

В работе использовали следующие ингибиторы (Calbiochem, Германия): ингибитор киназ ATM/ATR (CGK733, 4 мкМ и 10 мкм), ингибитор только киназы ATM (KU55933, 10 мкМ), ингибитор киназы Chk2 (2-(4-(4-Chlorophenoxy)phenyl)-1H-benzimidazole-5carboxamide, 8 мкМ), ингибитор киназы Chk1 (4-(2-Phenyl)-9-hydroxypyrrolo[3,4c]carbazole-1,3-(2H,6H)-dione, 2 мкМ).

Культивируемые клетки подвергали рентгеновскому облучению в дозах 1 Гр, 3 Гр и 6 Гр на установках РУМ-17 и РАП-150/300-14.

МТТ-тест. Оценку жизнеспособности клеток производили колориметрическим методом с использованием метилтиазолилдифенил-тетразолиум бромида (МТТ) (Sigma, США). Метод основан на том, что митохондриальные оксидоредуктазы живых клеток восстанавливают желтый МТТ до пурпурного формазана. Количество образующегося формазана коррелирует с численностью жизнеспособных клеток в популяции. Клеткам заменяли среду на раствор PBS, содержащий 0.5 мг/мл МТТ, и инкубировали 1 ч при °С в атмосфере 5 % CO2. Образовавшийся осадок формазана растворяли в ДМСО (Sigma). Оптическую плотность измеряли при длине волны 570 нм против раствора МТТ с ДМСО на спектрофотометре Multiskan EX (Thermo Electron, США). Для каждой экспериментальной точки проводили 6 повторений и подсчитывали стандартную ошибку среднего.

Проточная цитофлуориметрия. Клетки снимали с чашек и промывали PBS.

Пермеабилизацию клеток проводили в 0.01%-ном растворе сапонина в PBS и инкубировали при комнатной температуре 30 мин. Затем пробы дважды промывали PBS и инкубировали в растворе РНКазы А (100 мкг/мл) и йодистого пропидия (40 мкг/мл) мин при 37 0С. Пробы подвергали анализу на содержание ДНК на проточном цитофлуориметре Coulter Epics XL (Beckman Coulter). Полученные данные обрабатывали с помощью программы Modfit LT 3.0 (Verity Software House).

Анализ активности каспаз in vitro. Клетки лизировали в буфере, содержащем 50 мМ HEPES (ICN) pH 7.4, 0.1 % CHAPS (Sigma), 0.5 % IGEPAL-100 (ICN), 5 мМ DTT (Sigma, США), 30 мин при 4 °С. В реакционную смесь (40 мМ HEPES pH 7.4, 0.1 % CHAPS, 1 мМ DTT и 40 мкМ флуорогенного субстрата AcDEVD-AMC, Sigma) добавляли 40 мкг белка из лизатов, инкубировали 1 ч при 37 °С. Флуоресценцию измеряли на флуориметре GloMax®-Multi Jr. Для подтверждения специфической активации каспаз применялся ингибитор каспаз ZVAD (50 мкМ, Biomol). Подсчет среднего и его стандартной ошибки производили по трем независимым повторениям.

Иммунофлуоресценция. К летки промывали раствором PBS, фиксировали 4 %ным параформальдегидом 15 мин и пермеабилизовали 0.2 %-ным тритоном X-100 в PBS 20 мин при комнатной температуре. Затем клетки промывали 3 раза по 5 мин в PBS и инкубировали в блокирующем растворе (PBS, 5 % БСА, 0.01 % Tween-20) 1 ч при комнатной температуре. Первые и вторые антитела разводили в блокирующем растворе.

В качестве первых антител использовали мышиные антитела против фосфорилированной по Ser1981 киназы ATM (Millipore, США), против фосфорилированной по Ser428 киназы ATR (Santa Cruz, США), против фосфорилированного по Ser139 гистона Н2АХ (H2AX) (Cell Signaling, США), кроличьи антитела против 53BP1, Rad51 (Santa Cruz, США), против каталитической субъединицы киназы DNA-PK, фосфорилированной по Ser2056 (Abcam, Англия), против фосфорилированного по Ser15 белка р53 (Cell Signaling). В качестве вторых антител использовали антитела против иммуноглобулинов кролика или иммуноглобулинов мыши, коньюгированные с флуорохромом GAM/GAR-Alexa488 или GAM/GARAlexa568; ядра окрашивали To-pro3 или DAPI (Invitrogen, США). Препараты исследовали на конфокальных микроскопах Leica TCS SL и Leica TCS SP5.

Электорофорез и иммуноблоттинг. Для экстракции тотального белка использовали буфер на основе PBS, содержащем 1% NP-40, 0.5% дезоксихолата натрия, 0.1% SDS, ингибиторы протеаз и фосфатаз. Лизис проводили 30 мин на льду и далее центрифугировали 14000 g. Количество белка в пробах измеряли по методу Брэдфорд, на гель наносили равное количество белка в каждой пробе (50 мкг). После дискэлектрофореза в полиакриламидном геле в денатурирующих условиях белки переносили на мембрану PVDF (Amersham, Англия). В качестве первых антител использовали антитела против фосфорилированного по Ser15 белка р53, ацетилированного по Lys белка р53, против тотальной формы р53, GAPDH (Cell Signaling, США), р21/Waf1, tubulin (Sigma, США). В качестве вторых антител использовали антитела кролика против иммуноглобулинов мыши и антитела козы против иммуноглобулинов кролика, коньюгированные с пероксидазой хрена. Белки выявляли методом усиленной хемилюминесценции (ECL, Amersham, Англия).

Выделение РНК и ОТ-ПЦР. Тотальную РНК выделяли с использованием реагента TRIzol® (Invitrogen, США) согласно протоколу производителя. Реакцию обратной транскрипции проводили согласно протоколу производителя (Fermentas), используя ревертазу MMLV (Moloney-murine leukaemia virus), 2 мкг РНК и 1 мкг случайных гексапраймеров (Promega, США).

Количественная ОТ-ПЦР проводилась с использованием набора для ПЦР в реальном времени, содержащего краситель SYBR Green и референсный краситель ROX (Синтол, Россия) на приборе 7500 Real-time PCR System (Applied Biosystems) в лаборатории стабильности хромосом и клеточной инженерии Института цитологии РАН (рук. А.В. Кропотов). Параметры реакции были заданы в соответствии с рекомендациями фирмы Синтол. Были использованы следующие праймеры: oct3/4-F, CAAGTTGGCGTGGAGACT; oct3/4-R, TTCATGTCCTGGGACTCCTC; nanog-F, GATGCAAGAACTCTCCTCCA; nanog-R, CAATGGATGCTGGGATACTC; sox2-F, ACATGAACGGCTGGAGCAACG, sox2-R, CATGTAGGTCTGCGAGCTGGTC; gapdh-F, TGTGTCCGTCGTGGATCTGA; gapdh-R, TTGCTGTTGAAGTCGCAGGAG. Уровень экспрессии генов нормализовали относительно gapdh. Каждая экспериментальная точка включала три повторения, для которых рассчитывалась ошибка среднего. Результаты повторяли в независимых экспериментах.

Для обычной ПЦР использовали полимеразу Taq (Fermentas) и следовали протоколу производителя. Концентрация MgCl2 в реакционной смеси составляла 2. мкМ. Использовали следующие праймеры: p21/Waf1-F, AAAGCCTCCTCATCCCGTGTT GAGAGACCGCCGTACAGAAG; p53-R, CTTCAGGTAGCTGGAGTGAGC. Праймеры для гена gapdh были те же, что и для количественной ПЦР.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Активация киназ ATM и ATR в ЭСК после облучения.

В ответ на облучение в дозе 6 Гр киназы АТМ и ATR фосфорилируются по Ser и Ser428, соответственно, и накапливаются в области одно- и двунитевых разрывов ДНК, где фосфорилируют различные белки. На рис. 1 (А, Б) видно, что облучение индуцирует активацию киназ АТМ и ATR по сайтам фосфорилирования и их накопление в ядрах мЭСК. В чЭСК также выявляются фосфорилированные по Ser и Ser428 формы киназ АТМ и ATR после повреждения ДНК (данные не показаны).

Колокализация фокусов Н2АХ с белками RAD51, DNA-PK и 53BP после облучения в ЭСК.

Через 30 мин после облучения активация киназ АТМ и ATR сопровождается фосфорилированием гистона Н2АХ по Ser139 с образованием фокусов Н2АХ – ключевым этапом в сборке репаративных фокусов (рис. 2А, Б, В). Мы исследовали, привлекаются ли к индуцированным облучением фокусам Н2АХ такие репарационные белки как Rad51, DNA-PK и 53ВР1. Было показано, что ключевой белок процесса репарации по типу гомологичной рекомбинации (Homologous Recombination, HR) Rad локализуется совместно с фокусами Н2АХ через 30 мин после облучения (рис. 2А).

Используя антитела к фосфорилированной по Ser2056 каталитической субъединице комплекса DNA-PK, который участвует в репарации по типу негомологичного воссоединения концов (Non-homologous end joining, NHEJ), мы также обнаружили колокализацию киназы DNA-PK с фокусами Н2АХ в мЭСК через 30 мин после облучения (рис. 2Б). Белок 53BP1, который является адапторным белком для опухолевого супрессора р53 и одним из центральных участников в создании репаративных фокусов, был также обнаружен с фокусами Н2АХ через 30 мин после облучения (рис. 2В). Интересно, что в контрольных мЭСК присутствуют неиндуцированные облучением фокусы H2AX, которые колокализуются с белком Rad51, в то время как белки DNA-PK и 53ВР1 обнаруживаются с фокусами H2AX только в облученных клетках (рис. 2А-В). По всей видимости, высокая пролиферативная активность мЭСК сопровождается различными репликативными коллапсами, устранение которых обеспечивает точная и менее подверженная ошибкам репарация HR.

Мы также исследовали способность чЭСК формировать репаративные фокусы в местах индуцированных повреждений ДНК. Было показано, что в облученных чЭСК также образуются фокусы Н2АХ, которые колокализуются с белками 53ВР1 и с Rad (данные не показаны).

Влияние ингибиторов киназ ATM, ATR, Chk1, Chk2 на распределение мЭСК по фазам клеточного цикла и выживаемость.

Киназы АТМ и ATR играют ключевую роль не только в формировании репаративных фокусов, но и в активации контрольных точек клеточного цикла при повреждении ДНК через фосфорилирование своих субстратов Chk2 и Chk1, соответственно (Helt et al., 2005). Мы проанализировали эффект ингибиторов киназ ATM/ATR и их мишеней киназ Chk2/Chk1 на распределение мЭСК по фазам клеточного цикла до и после облучения. Согласно нашим и литературным данным, облученные мЭСК не останавливаются в контрольной точке G1/S клеточного цикла и реализуют лишь временную задержку на границе фаз G2/M (рис. 3А, Б) (Малашичева и др., 2002;

Hong et al., 2004; Chuykin et al., 2008; Momcilovic et al., 2009). Мы обнаружили существенное снижение доли S-фазных клеток (с 72 до 56 %) через 20 ч культивирования в присутствии ингибитора киназ ATM/ATR, который в сочетании с облучением вызывал еще большее снижение числа S-фазных клеток и накопление клеток на границе фаз G2/M (рис. 3А, Б). Ингибитор только киназы ATM слабо влиял на распределение мЭСК по фазам клеточного цикла как в норме, так и после облучения по сравнению с ингибитором обеих киназ ATM и ATR.

Рис. 2. Облучение индуцирует формирование фокусов Н2АХ, колокализованных с белками Rad51, DNA-PK и 53BP1 в мЭСК. А - иммунофлуоресцентное окрашивание белков Rad51 (зеленый) и Н2АХ (красный), ДНК (To-pro3, синий) в норме и через 30 мин после облучения (6 Гр); Б – окраска мЭСК на фосфорилированную по Ser каталитическую субъединицу киназы DNA-PK (зеленый), Н2АХ (красный) и ДНК (DAPI, синий) в норме и через 30 мин после облучения (6 Гр); В – окраска на Н2АХ (зеленый), 53ВР1 (красный) и ДНК (To-pro3, синий) в норме и через 30 мин после облучения (6 Гр).

Масштабная линейка 3.75 мкм (А), 5 мкм (Б), 6 мкм (В).

Ингибитор киназы Chk1 незначительно влиял на параметры распределения мЭСК по клеточному циклу, но при совместном действии с облучением вызывал значительное накопление мЭСК в фазе G1 и их уменьшение на границе фаз G2/M. Мы не обнаружили эффекта подавления активности киназы Chk2 на распределение мЭСК по клеточному циклу, как в норме, так и после облучения, что согласуется с данными литературы о локализации этой киназы на цетросомах и ее функциональном ограничении (Hong et al., 2004).

Рис. 3. Сигнальный путь ATR-Chk1 вносит вклад в распределение мЭСК по фазам клеточного цикла. Данные проточной цитофлуориметрии представлены в виде диаграмм (доли клеток, находящихся в разных фазах клеточного цикла, представлены в %). Обработка мЭСК ингибиторами киназ ATM/ATR (4 мкМ), ATM (10 мкМ), Chk1 (2 мкМ), Chk2 (8 мкМ) в норме (А) и после облучения (Б). Ингибиторы добавляли за 1 ч до облучения (6 Гр) и далее оставляли на 20 часов.

Используя МТТ-тест, мы проанализировали выживаемость мЭСК через 20 ч после обработки клеток теми же ингибиторами киназ в норме и после облучения (рис. 4А, Б).

В соответствии с данными проточной цитофлуориметрии, в норме ингибитор ATM/ATR вызывает значительную гибель клеток через 20 ч после обработки, и особенно в сочетании с облучением усиливает этот эффект, снижая жизнеспособность до 20 % (рис. 4А). Ингибитор киназы Chk1 также приводил к существенной гибели клеточной популяции после облучения, хотя сам по себе незначительно влиял на выживаемость мЭСК в норме (рис. 4А). Ингибирование только киназы ATM и ее мишени Chk незначительно влияло на жизнеспособность клеток, как в норме, так и после облучения (рис. 4А, Б). Таким образом, мы выявили преобладающую роль киназы ATR по сравнению с АТМ в регуляции распределения мЭСК по клеточному циклу и в выживаемости после облучения, а также существенную роль ее нижележащей мишени Chk1. Согласно данным иммунофлуоресценции (рис. 1Б), контрольные мЭСК окрашиваются антителами против фосфорилированной формы киназы ATR (Ser428), что может свидетельствовать о пороговом уровне активности этой киназы, который необходим для исправления дефектов, возникающих в процессе репликации ДНК.

Нокаут гена atm у мышей не является летальным, хотя животные характеризуются отсталостью в росте и ослабленной фертильностью, то время как нокаут гена atr ведет к эмбриональной летальности (de Klein et al., 2000). Более того, бластоцисты, полученные от мышей atr-/-, умирали в культуре по механизму митотической катастрофы (Banuelos et al., 2008). Кроме того, полученные результаты согласуются с данными литературы, что Chk1(-/-) вызывает летальность у эмбрионов мышей, в то время как Chk2(-/-) мыши являются жизнеспособными, предполагая важную роль киназы Chk1 в поддержании стабильности генома (Liu et al., 2000; Lam et al., 2004). По всей видимости, менее заметная роль киназы АТМ в наблюдаемом ответе мЭСК на повреждение ДНК может быть связана с функциональными ограничениями ее субстрата киназы Chk2, которая локализована на центросомах.

Рис. 4. Сигнальный путь ATR-Chk1 вносит вклад в выживаемость мЭСК (МТТ-тест).

Влияние ингибиторов киназ ATM/ATR (4 мкМ), Chk2 (8 мкМ), Chk1 (2 мкМ) (А) и ATM (10 мкМ) (Б) на жизнеспособность мЭСК в контроле (белые столбцы) и через 20 ч после облучения (6 Гр) (черные столбцы).

Влияние ингибиторов киназ ATM, ATR, Chk1, Chk2 на распределение чЭСК по фазам клеточного цикла.

Чтобы исследовать вклад киназ ATM, ATR, Chk1 и Chk2 в регуляцию клеточного цикла ЧЭСК, мы проанализировали результат действия соответствующих ингибиторов киназ на распределение ЧЭСК по клеточному циклу с помощью проточной цитофлуориметрии (рис. 5А, Б). В норме ингибиторы киназ ATM, ATM/ATR и (в меньшей степени), Chk1, Chk2 вызывают накопление клеток в фазе G1, но не влияют на долю клеток, находящихся в фазах G2/M (рис. 5А). При действии облучения на фоне ингибиторов киназ доля аккумулированных чЭСК на границе G2/M становится значительно меньше, чем в случае облучения без ингибиторов киназ, и происходит накопление клеток в фазе G1. Интересно, что действия ингибитора только АТМ и ингибитора ATM/ATR не различаются, то есть нет ожидаемого дополнительного ингибирования ATR в ЧЭСК. Таким образом, ингибитор киназы АТМ практически полностью отменял G2/M-блок клеточного цикла в чЭСК после облучения, что соответствует данным литературы о непосредственной вовлеченности АТМ в реализацию этого блока в чЭСК (Momcilovic et al., 2009). А киназа ATR, по-видимому, не участвует в активации чекпойнт-ответа в чЭСК, в частности в осуществлении G2/Mблока клеточного цикла, но может играть ключевую роль в процессах репарации (Adams et al., 2010).

Рис. 5. Киназы АТМ, Chk1 и Chk2 влияют на распределение чЭСК по фазам клеточного цикла. Данные проточной цитофлуориметрии представлены в виде диаграмм (доли клеток, находящихся в разных фазах клеточного цикла, представлены в %). Обработка чЭСК ингибиторами киназ ATM/ATR (10 мкМ), ATM (10 мкМ), Chk1 (2 мкМ), Chk2 (8 мкМ) в норме (А) и после облучения (Б). Ингибиторы добавляли за 1 ч до облучения (6 Гр) и далее оставляли на 20 часов.

Активация сигнального пути р53-р21/Waf1 в ЭСК после повреждения ДНК.

Активация контрольной точки G1/S клеточного цикла лежит через активацию канонического сигнального пути p53-p21/Waf1. Так как ЭСК не останавливаются в своей прогрессии на границе фаз G1/S в ответ на повреждение ДНК, мы проанализировали функциональный статус сигнального пути p53-p21/Waf1 в мЭСК после облучения. В ответ на повреждение ДНК белок р53 фосфорилируется по Ser киназами ATM и ATR, что освобождает его от взаимодействия с негативным регулятором Mdm2. Активированный р53 стабилизируется и аккумулируется в ядре, где функционирует как транскрипционный фактор (Riley et al., 2008). С помощью антител против фосфорилированной по Ser15 формы р53 мы показали, что облучение индуцирует активацию р53, максимум которой наблюдается через 2 ч после облучения (рис. 6А, Б). Согласно данным иммунофлуоресценции фосфорилирование р53 по Ser поддерживается на протяжении 24 ч, и все это время активированный белок локализуется в ядре, что необходимо для осуществления его транскрипционных функций (рис. 6А). Ацетилирование р53 по Lys-379 в мЭСК свидетельствует о его полноценной ДНК-связывающей активности и транс-активационном потенциале (рис.

6Б).

Белок p53 способен транс-активировать множество генов-мишеней, среди которых особую роль играет ген р21/Waf1 (cdkn1a), так как его белковый продукт ингибирует циклин-зависимые киназные комплексы и запрещает клеточную прогрессию при переходе из фазы G1 в фазу S после повреждения ДНК. Методом ОТ-ПЦР мы обнаружили, что при действии ДНК-повреждающих агентов запускается транскрипция гена р21/Waf1, однако накопления его белкового продукта не происходит в отличие от клеток линии NIH3T3 (рис. 7А, Б).

Рис. 7. Ингибиторы протеасомной деградации вызывают накопление белка р21/Waf1 в мЭСК. А – результаты ОТ-ПЦР транскриптов гена р21/Waf1 в мЭСК в норме и через 6 ч после облучения (6 Гр). Б – Вестерн-блот лизатов, полученных из мЭСК и клеток линии NIH3T3, в норме и через 8, 20 ч после облучения (6 Гр). В – Вестерн-блот лизатов мЭСК в норме и после 4 ч обработки протеасомными ингибиторами – лактацистином (Lc, 10 мкМ) и MG132 (10 мкМ).

Окраска на р21/Waf1 и GAPDH.

Чтобы исследовать, связано ли отсутствие белка р21/Waf1 в мЭСК с его негативной регуляцией на посттрансляционном уровне, мы использовали ингибиторы протеасомной деградации лактацистин (Lc) и MG-132. Было показано, что оба ингибитора вызывают накопление белка р21/Waf1 в мЭСК (Рис. 7В), при этом обработанные лактацистином клетки накапливаются в G1, что может свидетельствовать об удлинении фазы G1 (данные проточной цитофлуориметрии не показаны). Таким образом, накопления белка р21/Waf1 в мЭСК после облучения не происходит по причине его протеасомной деградации, что вероятно определяет отсутствие контрольной точки G1/S в этих клетках.

Итак, р53-зависимая экспрессия р21/Waf1 в соматических клетках является одним из ключевых событий в клеточном ответе на повреждение ДНК, так как индуцируется арест клеточного цикла в фазах G1/S или G2/M (Bartek et al., 2001; Taylor and Stark, 2001). Как уже было сказано выше, дисфункция сигнального пути р53-р21/Waf1 в ЭСК, вероятно, связана с поддержанием их недифференцированного состояния, а отсутствие р21/Waf1 в этих клетках способствует их быстрой пролиферации. Ранее было обнаружено, что транс-активация гена р21/Waf1 и последующее накопление его белкового продукта в клетках может происходить независимо от белка р53 (Macleod et al., 1995; Gartel et al., 2000). Мы решили разобщить путь р53-21/Waf1 в ЭСК и индуцировать р53-независимую транскрипцию гена р21/Waf1, используя ингибитор гистоновых деацетилаз (HDACI, histone-deacetylase inhibitor) бутират натрия (NaBut).

Мы обнаружили, что через 24 ч после обработки NaBut наблюдается транс-активация гена р21/Waf1 и накопление его белкового продукта, что сопровождается накоплением клеток в фазе G1 и свидетельствует о понижении пролиферативной активности мЭСК (Рис. 8A, Б). Интересно, что белок р21/Waf1, аккумулированный в клетках, обработанных NaBut, не подвергается протеасомной деградации, что свидетельствует о снятии его негативной пост-трансляционной регуляции. Таким образом, экспрессия р21/Waf1 в ЭСК может происходить независимо от белка р53, задействуя совершенно другие механизмы, отличные от клеточного ответа на повреждение ДНК. Можно предположить, что эти механизмы, приводящие к аккумуляции р21/Waf1, в ЭСК могут использоваться для запуска дифференцировки.

Рис. 8. Ингибитор HDAC NaBut вызывает накопление белка р21/Waf1 и индуцирует блок G1/S в мЭСК. А – Проточная цитофлуориметрия мЭСК в норме и через 24 ч после обработки NaBut (4 мМ). Б – ОТ-ПЦР транскриптов гена р21/Waf1 в мЭСК в контроле и через 6 ч после облучения (6 Гр). В – Вестерн-блот лизатов, полученных из мЭСК, в контрольной пробе и после обработки NaBut (24 ч, 4 мМ).

Функциональные последствия активации р53, вызванной облучением, на плюрипотентные свойства мЭСК.

Ранее уже было показано участие белка р53 в индуцируемой ретиноевой кислотой дифференцировке ЭСК (Jain et al., 2012). Кроме того, р53 способен прямо супрессировать транскрипцию гена nanog в мЭСК после повреждения ДНК, тем самым способствуя дифференцировке (Lin et al., 2005). Можно предположить, что для ограничения функций белка р53 и его влияния на плюрипотентные свойства в мЭСК реализуются механизмы негативной регуляции его белка-мишени р21/Waf1.

Соответственно, активность белка р53 в ЭСК может быть преимущественно связана с инициацией апоптотической гибели (Sabapathy et al., 1997; Corbet et al., 1999). Так, в соответствии с данными МТТ-теста, через одни сутки после облучения в дозе 6 Гр наблюдается гибель около 50% популяции мЭСК, что корелирует с высоким уровнем активности каспазы-3 в этих клетках (рис. 3А; рис. 9). С другой стороны, опираясь на полученые данные и данные литературы, можно предположить, что в ходе ответа мЭСК на повреждение ДНК активация белка р53 может вовлекать не только запуск апоптоза, а также индукцию программы дифференцировки. Чтобы проверить это предположение, мы снизили дозу облучения до 3 Гр, уменьшив цитотоксический эффект радиации (рис.

9), и проанализировали последствия детектированной нами активности белка р53 на плюрипотентное состояние выживших мЭСК после облучения.

Мы исследовали динамику активации р53 на 1 и 3 дни после облучения, а также динамику транскрипции гена р21/Waf1 и накопление его белкового продукта в мЭСК. В соответствии с данными иммунофлуоресценции (рис. 6А и рис. 10А, верхняя панель), активность р53 наблюдается в течение суток после облучения, а на 3-й день падает, что может быть связано с осцилляционными особенностями этого белка в клетках (Zhang et al., 2011). Интересно, что на 3-й день после облучения мы детектировали усиление транскрипции гена р21/Waf1 и накопление его белкового продукта (рис. 10А, средняя и нижняя панели). Используя метод проточной цитофлуориметрии, мы обнаружили, что накопление белка р21/Waf1 на 3-й день после облучения коррелирует с аккумуляцией мЭСК в фазе G1 клеточного цикла и уменьшением числа пролиферирующих клеток (рис. 10Б). Таким образом, на 3-й день после облучения происходит отмена деградации белка р21/Waf1 и восстановливается функционально-активный р53-р21/Waf1 путь.

Используя метод количественной ОТ-ПЦР, мы проанализировали уровень РНКтранскриптов генов плюрипотентности nanog, oct3/4 и sox2 на 1-й, 3-й и 5-й дни после облучения в мЭСК (рис. 11А). Согласно полученным данным, активация р53 в облуче нных мЭСК приводит к постепенному снижению транскрипции генов nanog и oct3/4 и коррелирует с уменьшением их экспрессии на уровне белка (рис. 11А, Б). Интересно, что уровень экспресии Sox2 остается практически постоянным как на уровне РНК, так и на уровне белка в облученных мЭСК.

Мы обнаружили, что снижение экспресии плюрипотентных факторов Oct3/4 и сопровождается запуском транскрипции генов дифференцировки Nanog эндодермального направления sox17 и afp на 5-й день после облучения в мЭСК (рис.

12А). Кроме того, мы обратили внимание на морфологические изменения мЭСК на 5-й день культивирования после облучения, которые сопровождались появлением обособленных от колоний клеток (рис. 12Б). Окрашивание щелочной фосфатазы в этих клетках вывило пониженную активность фермента по сравнению с колониями мЭСК, что может свидетельствовать о более дифференцированном фенотипе (данные не показаны).

Рис. 12. Индуцированная облучением активация р53 сопровождается запуском дифференцировки после облучения мЭСК. А - ОТ-ПЦР транскриптов генов sox17 и afp; Б – общий вид колоний мЭСК в норме и через 5 дней после облучения (3 Гр), проходящий свет.

плюрипотентные свойства мЭСК.

Чтобы подтвердить зависимость наблюдаемых последствий облучения на плюрипотентные свойства мЭСК от активации белка р53, мы использовали специфичный фармакологический агент нутлин. Нутлин специфично ингибирует взаимодействие р53 с его негативным регулятором убиквитин-лигазой Mdm2, что способствует стабилизации р53. Согласно полученным данным, в нутлин-обработанных мЭСК диссоциация комплекса р53-Mdm2 приводит к фосфорилированию р53 по Ser15, который функционирует как транскрипционный фактор, запуская транскрипцию гена р21/Waf1 (рис. 13А, верхняя и средняя панели). Интересно, что накопление р21/Waf1 в мЭСК происходит уже через сутки после обработки нутлином, в то время как после облучения аккумуляция этого белка детектируется только на 3-й день (рис. 10А).

Согласно результатам проточной цитофлуориметрии, нутлин-зависимая активация сигнального пути р53-р21/Waf1 сопровождается постепенным увеличением доли клеток в G1 фазе и снижением их числа в фазе S как результат индукции блока G1/S (рис. 13Б).

Стоит отметить, что мы также зафиксировали около 30% гибель популяции мЭСК через 1 сутки обработки нутлином, что связано с запуском апоптоза (данные каспазного анализа in vitro и МТТ не показаны). Иначе говоря, другим ответом мЭСК на нутлинзависимую активацию р53 является индуцированная клеточная гибель. Стоит также отметить, что нутлин-зависимая активация р53, в отличие от облучения, по-видимому, не сопровождается активацией клеточного ответа на повреждение ДНК, так как мы не зафиксировали активной формы АТМ (Ser1981) (данные не показаны).

Неожиданно для нас результаты количественной ОТ-ПЦР показали, что нутлинопосредованная активация р53 приводит к значительному снижению экспрессии только гена oct3/4, в то время как уровни транскрипции генов nanog и sox2 практически не меняются (рис. 14А). На уровне белка мы также детектировали снижение только Oct3/ на 5-й день обработки нутлином в отличие от остальных маркеров плюрипотентности, уровень которых не менялся. Интересно, что в облученных мЭСК активация р приводит к снижению транскрипции как гена oct3/4, так и nanog. Можно предположить, что в нутлин-обработанных мЭСК р53 не претерпевает всех пост-трансляционных модификаций, необходимых для подавления экспрессии nanog, как, например, в облученных мЭСК.

Снижение экспрессии Oct3/4 в нутлин-обработанных клетках было достаточно для активации генов дифференцировки эндодермального и мезодермального направлений (рис. 15А). С помощью ОТ-ПЦР были обнаружены РНК-транскрипты генов sox17, gata6, afp (рис. 15А). По сравнению с облучеными мЭСК, экспрессия генов дифференцировки наблюдается уже через 1 день обработки клеток нутлином, что свидетельствует о более быстром запуске программы дифференцировки. Мы также обнаружили морфологические изменения в нутлин-обработанных мЭСК, сходные с облученными клетками: появление одиночных теряющих контакты с колонией клеток (рис. 15Б).

Окрашивание щелочной фосфатазой также показало дифференцированный фенотип этих клеток (данные не показаны).

Рис. 15. Нутлин-зависимая активация р53 индуцирует дифференцировку в мЭСК. А – ОТ-ПЦР транскриптов маркеров дифференцировки sox17, gata6, afp. Б – общий вид колоний мЭСК в норме и спустя 5 дней обработки нутлином (10 мкМ), проходящий свет.

Итак, согласно нашим данным, несмотря на высокую скорость пролиферации и отсутствие G1/S контрольной точки ЭСК мыши способны распознавать повреждение ДНК и активировать сенсорные киназы ATM, ATR с последующим фосфорилированием гистона Н2АХ по Ser139 (H2AX) и формированием репаративных фокусов. Мы выявили, что в местах индуцированных ДНК-повреждений с фокусами H2AX колокализуются белки 53BP1, Rad51 и DNA-PK. Белок 53ВР1 является адапторным белком для р53, а также может координировать процессы репарации, и его наличие в местах повреждений свидетельствует об активации чекпойнт-ответа в ЭСК после облучения. Колокализация фокусов H2AX с белком Rad51 отражает процесс репарации по типу гомологичной рекомбинации, который исключает появление ошибок, используя в качестве матрицы сестринскую хроматиду. А колокализация H2AX с белком Rad как в норме, так и после облучения, свидетельствует о предпочтении этими клетками HRR-пути независимо от источника повреждений. Кроме того, после облучения с фокусами H2AX в мЭСК мыши колокализуется киназа DNA-PK, которая, в свою очередь, активирует процессы репарации по механизму негомологичного воссоединения концов. По всей видимости, мЭСК демонстрируют уникальную репарационную стратегию с использованием обоих типов репараций поврежденной ДНК, а также их возможного переключения.

При анализе вклада ATM, ATR и их мишеней Chk2 и Chk1 в распределение мЭСК по клеточному циклу и выживаемость после облучения было установлено, что ингибирование киназы ATR в значительной степени усиливает цитотоксическое действие облучения, снижая долю клеток в S-фазе, а ее мишень киназа Chk1 участвует в осуществлении временного блока G2/M. По-видимому, ATR играет важную роль в репарации дефектов, возникающих в процессе репликации. Интересно, что в чЭСК получены другие результаты: мы не выявили большой роли киназы ATR в регуляции клеточной прогрессии в отличие от киназ ATM, Chk1 и Chk2, которые участвуют в реализации блока G2/M.

Мы исследовали функциональный статус сигнального пути p53-p21/Waf1, который необходим для реализации контрольной точки G1/S. Мы показали, что после облучения р53 активируется и аккумулируется в ядре, где выполняет свои транскрипционные функции, в частности транс-активирует один из своих главных генов мишеней – р21/Waf1. Однако, несмотря на запуск экспрессии гена р21/Waf1, накопления самого белка не происходит по причине его деградации. Также показано, что экспрессия р21/Waf1 в мЭСК может регулироваться через р53-независимые механизмы и сопровождается удлинением фазы G1. Таким образом, каноническая роль р53 в соматических клетках как активатора блока G1/S в ЭСК не реализуется вследствие низкого уровня белка р21/Waf1. Соответственно, накопление белка р21/Waf наблюдается в дифференцирующихся ЭСК и предшествует восстановлению контрольной точки G1/S. Об этом свидетельствуют полученные данные о том, что индуцированная облучением активация р53, а также его стабилизация при действии нутлина, снижают плюрипотентные свойства мЭСК и индуцируют программу дифференцировки. Таким образом, один из механизмов поддержания плюрипотентного состояния ЭСК заключается в ослаблении функции р53-зависимого чекпойнта G1/S. По этой причине активация ATM/ATR-сигнального пути в ЭСК, что необходимо для инициации репарации ДНК, не приводит к остановке клеток в контрольной точке G1/S из-за дисфункции сигнального пути р53-р21/Waf1.

Ингибирование ATR-Chk1 сигнального пути, но не ATM-Chk2, влияет на распределение мЭСК по фазам клеточного цикла и выживаемость, в то время как в ЭСК человека сигнальный путь ATM-Chk2 при участии Chk1 играет важную роль в реализации блока G2/M после облучения.

Облучение ЭСК индуцирует активацию киназ ATM, ATR с последующим формированием фокусов Н2АХ, колокализованных с белками репарации ДНК 53BP1, Rad51 и DNA-PK.

Облучение активирует транскрипционный фактор р53 в мЭСК, который запускает транскрипцию гена-мишени р21/Waf1. Однако накопления белка р21/Waf1 не наблюдается вплоть до 24 ч после облучения вследствие его протеасомной деградации.

Большая часть облученных мЭСК погибают по механизму апоптотической гибели, тогда как оставшиеся клетки после некоторого лаг-периода претерпевают изменения в структуре клеточного цикла: запускается экспрессия р21/Waf1, увеличивается доля клеток в фазе G1, восстановается функционирование контрольной точки G1/S, а также снижается содержание факторов плюрипотентности Oct3/4 и Nanog и инициируется программа дифференцировки.

Нутлин-зависимая активация р53 в мЭСК также сопровождается аккумуляцией белка р21/Waf1, восстановлением контрольной точки G1/S и индукцией дифференцировки. Таким образом, независимо от механизма действия использованных агентов, вызывающих накопление белка р21/Waf1, это снижает темпы пролиферации и направляет мЭСК в дифференцировку.

Список работ, опубликованных по теме диссертации Суворова И.И., Поспелов В.А. Исследование репаративных фокусов в эмбриональных стволовых клетках мыши после повреждения ДНК // Цитология, 2014.

Т.56(5), С.340–345.

Суворова И.И., Кожухарова И.В., Никольский Н.Н., Поспелов В.А.

Активация ATM/ATR – киназного сигнального пути в эмбриональных стволовых клетках человека после повреждения ДНК // Цитология, 2013. Т.55(12), С.841–851.

3. Suvorova I.I., Katolikova N.V., Pospelov V.A. New insights into cell-cycle regulation and DNA damage response in embryonic stem cells// Int Rev Cell Mol Biol. 2012.

V.299. P.161–198.

4. Suvorova I.I., Grigorash B.B., Pospelov V.A. DNA damaged-induced activation of ATM/ATR is not accompanied by G1/S cell cycle arrest in mouse embryonic stem cells// J Cell Sci Ther. 2013. V.4. P. 86.

5. Suvorova I.I., Pospelov V.A. Analysis DNA damage response in mouse embryonic stem cells // Материалы 11th ISSCR (International Society for Stem Cell Research) Annual Meeting 2013, Бостон, США, 12-15 июня 2013 г. Poster abstracts. W- Григораш Б.Б., Суворова И.И., Поспелов В.А. Последствия реактивации р53 в эмбриональных стволовых клетках мыши // Материалы 17 Международной Пущинской школы-конференции молодых ученых «Биология – наука XXI века», Пущино, 21-26 апреля 2013 г. Сборник тезисов. С.190.

Суворова И.И., Магнес О.Г., Поспелов В.А. Активация р53 в эмбриональных стволовых клетках ведет к уменьшению их плюрипотентных свойств и апоптозу // Материалы III съезда общества клеточной биологии, Санкт-Петербург, 16- октября 2012 г., Цитология. 2012. Т.54. №9. С. Суворова И.И. Активация ATM/ATR сигнального пути при действии ДНКповреждающих агентов не сопровождается блоком G1/S клеточного цикла в ЭСК человека и мыши // Материалы III конференции молодых ученых Института цитологии РАН, Санкт-Петербург, 15-16 мая 2012 г, Цитология. 2012. Т.52. №6. С.720.

Суворова И.И., В.А. Поспелов. Анализ сигнальных путей, участвующих в ответе ЭСК на повреждение ДНК // Материалы II конференции молодых ученых Института цитологии РАН, Санкт-Петербург, 15-16 февраля 2010 г., Цитология. 2010.

Т.52. №6. С.508.

Кожухарова И.В., Фридлянская И.И., Ковалева З.В., Пуговкина Н.А., Алексеенко Л.Л., Зенин В.В., Иванцов К.М., Леонтьева О.К., Гринчук Т.М., Никольский Н.Н. Новые линии эмбриональных стволовых клеток человека С612 и С910// Цитология. 2009. Т. 51.

№7. С. 551-557.

Малашичева А.Б., Кислякова Т.В., Саватьер П., Поспелов В.А. Эмбриональные стволовые клетки не останавливаются в клеточном цикле при действии повреждающих факторов// Цитология. 2002. Т. 44. №7. С. 643-648.

Adams B.R., Golding S.E., Rao R.R., Valerie K. Dynamic dependence on ATR and ATM for double-strand break repair in human embryonic stem cells and neural descendants// PLoS One. 2010. V.5. №4. P.e10001.

Bauelos C.A., Banth J.P., MacPhail S.H., Zhao J., Eaves C.A., O'Connor M.D., Lansdorp P.M., Olive P.L. Mouse but not human embryonic stem cells are deficient in rejoining of ionizing radiation-induced DNA double-strand breaks// DNA Repair. 2008. V.7.

№9. Р.1471-1483.

Bartek J., Lukas J. Pathways governing G1/S transition and their response to DNA damage// FEBS Lett. 2001. V.490. №3. Р.117-22.

Becker K.A., Ghule P.N., Therrien J.A., Lian J.B., Stein J.L., van Wijnen A.J., Stein G.S.

Self-renewal of human embryonic stem cells is supported by a shortened G1 cell cycle phase// J Cell Physiol. 2006. V.209. №3. P.883--893.

Chuykin I.A., Lianguzova M.S., Pospelova T.V., Pospelov V.A.. Activation of DNA damage response signaling in mouse embryonic stem cells// Cell Cycle. 2008. V.7. №18.

Р.2922-2928.

Corbet S.W., Clarke AR, Gledhill S., Wyllie A.H. P53-dependent and -independent links between DNA-damage, apoptosis and mutation frequency in ES cells// Oncogene. 1999. V.18.

№8. Р.1537-1544.

De Klein A., Muijtjens M., van Os R., Verhoeven Y., Smit B., Carr A.M., Lehmann A.R., Hoeijmakers J.H. Targeted disruption of the cell-cycle checkpoint gene ATR leads to early embryonic lethality in mice// Curr. Biol. 2000. V.10. №8. P.479–482.

Fernandez-Capetillo O., Celeste A., Nussenzweig A. Focusing on foci: H2AX and the recruitment of DNA-damage response factors// Cell Cycle. 2003. V.2. №5. Р.426-427.

Helt C.E., Cliby W.A., Keng P.C., Bambara R.A., O'Reilly M.A. Ataxia telangiectasia mutated (ATM) and ATM and Rad3-related protein exhibit selective target specificities in response to different forms of DNA damage// J. Biol. Chem. 2005. V.280. №2. P.1186--1192.

Hong Y., Stambrook P.J. Restoration of an absent G1 arrest and protection from apoptosis in embryonic stem cells after ionizing radiation// Proc Natl Acad Sci U S A. 2004.

V.101. №40. Р.14443-14448.

activate p21 (WAF1/CIP1) gene transcription in the Caco-2 colon adenocarcinoma cell line// Oncogene. 2000.V.19. №45. Р.5182-5188.

Jain A.K., Allton K., Iacovino M., Mahen E., Milczarek R.J., Zwaka T.P., Kyba M., Barton M.C. p53 regulates cell cycle and microRNAs to promote differentiation of human embryonic stem cells// PLoS Biol. 2012. V.10. №2. Р.e1001268.

Macleod K.F., Sherry N., Hannon G., Beach D., Tokino T., Kinzler K., Vogelstein B., Jacks T. p53-dependent and independent expression of p21 during cell growth, differentiation, and DNA damage// Genes Dev. 1995. V.9. №8. Р.935-944.

Lam M.H., Liu Q., Elledge S.J., Rosen J.M. Chk1 is haploinsufficient for multiple functions critical to tumor suppression// Cancer Cell. 2004. V.6. №1. Р.45-59.

Lin T., Chao C., Saito S., Mazur S.J., Murphy M.E., Appella E., Xu Y. p53 induces differentiation of mouse embryonic stem cells by suppressing Nanog expression// Nat Cell Biol. 2005. V.7. №2. P.165-171.

Liu Q., Guntuku S., Cui X.S., Matsuoka S., Cortex D., Tamai K., Luo G., CarattiniRivera S., DeMayo F., Bradley A., Donehower L.A., Elledge S. Chk1 is essential kinase that is regulated by ATR and required for the G2/M DNA damage checkpoint// Genes and Dev. 2000.

V.14. №12. Р.1448-1459.

Momcilovic O., Choi S., Varum S., Bakkenist C., Schatten G., Navara C. Ionizing radiation induces ataxia telangiectasia mutated-dependent checkpoint signaling and G(2) but not G(1) cell cycle arrest in pluripotent human embryonic stem cells// Stem Cells. 2009. V.27.

№8. Р.1822-1835.

Paull T.T., Rogakou E.P., Yamazaki V., Kirchgessner C.U., Gellert M., Bonner W.M. A critical role for histone H2AX in recruitment of repair factors to nuclear foci after DNA damage// Curr Biol. 2000. V.10. №15. Р.886-895.

Riley T., Sontag E., Chen P., Levine A. Transcriptional control of human p53-regulated genes// Nat Rev Mol Cell Biol. 2008. V.9. №5. Р.402-412.

Sabapathy K., Klemm M., Jaenisch R., Wagner E.F. Regulation of ES cell differentiation by functional and conformational modulation of p53// EMBO J. 1997. V.16. №20. Р.6217Taylor W.R, Stark GR. Regulation of the G2/M transition by p53// Oncogene. 2001.

V.20. №15. Р.1803-1815.

Zhang X.P., Liu F., Wang W. Two-phase dynamics of p53 in the DNA damage response// Proc Natl Acad Sci U S A. 2011.V.108. №22. Р.8990-8995.



 
Похожие работы:

«ШАРОВ Аркадий Валерьевич ВЛИЯНИЕ ЗАНЯТИЙ ЭКСТРЕМАЛЬНЫМИ ВИДАМИ СПОРТА НА АДАПТАЦИОННЫЕ ВОЗМОЖНОСТИ ОРГАНИЗМА СТУДЕНТОВ 03.03.01 физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Набережные Челны – 2012 2 Диссертация выполнена на кафедре адаптивной и лечебной физической культуры Федерального государственного бюджетного образовательного учреждения высшего профессионального образования Пермский государственный гуманитарнопедагогический...»

«Попов Сергей Геннадьевич УСТОЙЧИВОСТЬ ЦЕНТРАЛЬНОЙ И ПЕРИФЕРИЧЕСКОЙ ГЕМОДИНАМИКИ К ОРТОСТАТИЧЕСКОМУ ВОЗДЕЙСТВИЮ У СПОРТСМЕНОВ ПОСЛЕ АЭРОБНОЙ ФИЗИЧЕСКОЙ НАГРУЗКИ 03.03.01 – физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Архангельск – 2014 2 Работа выполнена на кафедре физического воспитания ФГБОУ ВПО Ярославский государственный педагогический университет им. К.Д. Ушинского доктор биологических наук, профессор, Научный заведующий...»

«ИЛАТОВСКАЯ Дарья Викторовна РОЛЬ АКТИН-СВЯЗЫВАЮЩЕГО БЕЛКА КОРТАКТИНА В РЕГУЛЯЦИИ ЭПИТЕЛИАЛЬНЫХ НАТРИЕВЫХ КАНАЛОВ (ENaC) 03.03.04 — Клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук САНКТ-ПЕТЕРБУРГ 2012 2 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук и Медицинском колледже Висконсина, Милуоки, США Научные руководители: доктор...»

«АЛЕКСЕЕНКО Лариса Леонидовна РЕАКЦИЯ СТВОЛОВЫХ КЛЕТОК ЧЕЛОВЕКА НА ТЕПЛОВОЙ СТРЕСС 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2014 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук (ИНЦ РАН), Санкт-Петербург Научный руководитель : доктор биологических наук, академик РАН Никольский Николай Николаевич...»

«СТОЛЯРОВА Марина Владимировна СРАВНИТЕЛЬНАЯ МОРФОЛОГО-ФИЗИОЛОГИЧЕСКАЯ ХАРАКТЕРИСТИКА И РЕАКТИВНЫЕ ОСОБЕННОСТИ ЭПИТЕЛИАЛЬНЫХ СИСТЕМ У ЖИВОТНЫХ РАЗНЫХ УРОВНЕЙ ОРГАНИЗАЦИИ И ЧЕЛОВЕКА: ФИЛОГЕНЕТИЧЕСКИЙ АСПЕКТ 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург 2012 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования...»

«САВЕЛЬЕВА Анна Владимировна УЛЬТРАСТРУКТУРНЫЕ АСПЕКТЫ ГАМЕТОГЕНЕЗА И ЛИЧИНОЧНОГО РАЗВИТИЯ АППЕНДИКУЛЯРИИ OIKOPLEURA GRACILIS (CHORDATA, TUNICATA) 03.03.05 – биология развития, эмбриология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Владивосток – 2013 Работа выполнена в лаборатории эмбриологии Федерального государственного бюджетного учреждения науки Институт биологии моря им. А.В. Жирмунского Дальневосточного отделения Российской академии...»

«ЖУРАВЛЕВ Александр Владимирович МОЛЕКУЛЯРНЫЕ МЕХАНИЗМЫ ДЕЙСТВИЯ МЕТАБОЛИТОВ КИНУРЕНИНОВОГО ПУТИ ОБМЕНА ТРИПТОФАНА НА ГЛЮТАМАТЕРГИЧЕСКУЮ И ХОЛИНЕРГИЧЕСКУЮ СИСТЕМЫ НЕЙРОТРАНСМИССИИ У МУТАНТОВ ДРОЗОФИЛЫ 03.03.01 — физиология 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург Работа выполнена в лаборатории нейрогенетики Института физиологии им. И. П....»

«ИВАНОВА ГАЛИНА ВИКТОРОВНА Процессы пищеварения и обмена веществ у крупного рогатого скота при скармливании добавок с L - карнитином 03.03.01 – Физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Дубровицы – 2012г 2 Работа выполнена в отделе кормления сельскохозяйственных животных и технологии кормов Государственного научного учреждения Всероссийский научно-исследовательский институт животноводства Российской академии...»

«КОРЯГИНА Наталья Юрьевна ФИЗИОЛОГО - БИОХИМИЧЕСКАЯ ХАРАКТЕРИСТИКА РЕЧНЫХ РАКОВ ПРИ ВЫРАЩИВАНИИ В ИСКУССТВЕННЫХ УСЛОВИЯХ 03.03.01 – физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2010 Работа выполнена на кафедре физиологии и биохимии животных Российского государственного аграрного университета - МСХА имени К.А.Тимирязева и в лаборатории разведения речных раков ГНУ ВНИИР Научный руководитель : доктор биологических наук,...»

«ПРОСЕКОВА Елена Александровна РОСТ И МОРФОФУНКЦИОНАЛЬНОЕ СОСТОЯНИЕ ОРГАНОВ И ТКАНЕЙ БРОЙЛЕРОВ, ВЫРАЩЕННЫХ С ИСПОЛЬЗОВАНИЕМ ПРОБИОТИКОВ 03.03.01 – физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2011 Работа выполнена на кафедре морфологии и физиологии животных ФГОУ ВПО Российский государственный аграрный университет – МСХА имени К.А. Тимирязева Научный руководитель : доктор биологических наук, профессор Панов Валерий...»

«Магомедова Патимат Гаджиевна Структурные изменения в лимфоидной ткани селезёнки крыс при воздействии на организм паров формальдегида 03.03.04 –клеточная биология, цитология, гистология Автореферат диссертации на соискание учёной степени кандидата биологических наук Москва – 2011 Работа выполнена в Российском университете дружбы народов Научный руководитель : Зав. кафедрой анатомии человека РУДН, Заслуженный деятель науки РФ, доктор медицинских наук, профессор Козлов Валентин...»

«ФИРСАНОВ Денис Владимирович ДИНАМИКА ОБРАЗОВАНИЯ И ЭЛИМИНАЦИИ ФОСФОРИЛИРОВАННОГО ГИСТОНА Н2АХ В КЛЕТКАХ МЛЕКОПИТАЮЩИХ ПОСЛЕ РЕНТГЕНОВСКОГО ОБЛУЧЕНИЯ 03.03.04 — Клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2012 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт цитологии Российской академии наук Научные руководители: кандидат биологических наук Кропотов...»

«Абушик Полина Александровна МЕХАНИЗМЫ НЕЙРОТОКСИЧНОСТИ, ВЫЗВАННОЙ АКТИВАЦИЕЙ РЕЦЕПТОРОВ ГЛУТАМАТА В ЦЕНТРАЛЬНЫХ И ПЕРИФЕРИЧЕСКИХ НЕЙРОНАХ КРЫС Специальность 03.03.01 – физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2014 Работа выполнена в лаборатории сравнительной физиологии мозжечка Федерального государственного бюджетного учреждения науки Института эволюционной физиологии и биохимии им. И.М. Сеченова Российской...»

«КИПРЮШИНА Юлия Олеговна ФАКТОРЫ РОСТА ИЗ СЕМЕЙСТВ ФАКТОРОВ РОСТА ЭНДОТЕЛИЯ СОСУДОВ И ФАКТОРОВ РОСТА ФИБРОБЛАСТОВ, Si-VEGF2 И Si-FGF, И ИХ РЕЦЕПТОРЫ В ОНТОГЕНЕЗЕ МОРСКОГО ЕЖА STRONGYLOCENTROTUS INTERMEDIUS 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук ВЛАДИВОСТОК – 2013 2 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт биологии моря им. А.В. Жирмунского...»

«Хряпенкова Татьяна Геннадьевна Межклеточные взаимодействия мезенхимальных мультипотентных стромальных клеток и дифференцированных клеток сердца и почки 03.03.04 - клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук МОСКВА 2010 3 Работа выполнена в отделе биоэнергетики НИИ физико-химической биологии им. А.Н.Белозерского, на факультете биоинженерии и биоинформатики МГУ им. М.В.Ломоносова. Доктор...»

«ГУМЕРОВА АНИСА АЗАТОВНА ГИСТО- И ЦИТОГЕНЕЗ ПЕЧЕНИ ЧЕЛОВЕКА И КРЫСЫ В ХОДЕ ПРЕНАТАЛЬНОГО РАЗВИТИЯ И РЕПАРАТИВНОЙ РЕГЕНЕРАЦИИ 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора медицинских наук Казань – 2012 2 Работа выполнена в ГБОУ ВПО Казанский государственный медицинский университет Министерства здравоохранения и социального развития России Научный консультант : доктор медицинских наук, профессор Киясов Андрей...»

«АКИМОЧКИНА ТАТЬЯНА ИВАНОВНА ЦИТОЛОГИЧЕСКИЕ ОСОБЕННОСТИ СПЕРМИЕВ ЦЕННЫХ ВИДОВ РЫБ ВОЛГО-КАСПИЙСКОГО БАССЕЙНА И ИХ ИЗМЕНЕНИЕ В ЗАВИСИМОСТИ ОТ УСЛОВИЙ КРИОКОНСЕРВАЦИИ 03.03.04 – клеточная биология, цитология и гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Астрахань – 2010 1 Работа выполнена на кафедре биотехнологии и биоэкологии Государственного образовательного учреждения высшего профессионального образования Астраханский...»

«Ван Вэньчжу РОЛЬ ЦИТОСКЕЛЕТА В УПОРЯДОЧЕННОЙ ЛОКАЛИЗАЦИИ И РАСПРЕДЕЛЕНИИ ОРГАНЕЛЛ КЛЕТОК ВЫСШИХ РАСТЕНИЙ 03.03.04 – клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва 2012 Работа выполнена на кафедре клеточной биологии и гистологии Биологического факультета Московского государственного университета имени М.В. Ломоносова Научный руководитель : Доктор биологических наук Смирнова Елена Александровна...»

«ДОМНИНА Алиса Павловна ЭНДОМЕТРИАЛЬНЫЕ СТВОЛОВЫЕ КЛЕТКИ: ПОЛУЧЕНИЕ, ХАРАКТЕРИСТИКА И ПРИМЕНЕНИЕ ДЛЯ СТИМУЛЯЦИИ РАЗВИТИЯ ЭНДОМЕТРИЯ КРЫС 03.03.04. – Клеточная биология, цитология, гистология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт – Петербург 2014 Работа выполнена в Федеральном государственном бюджетном учреждении наук Институт цитологии РАН, Санкт-Петербург Научный руководитель : Никольский Николай Николаевич д. б. н., академик,...»

«КОЩЕЕВА АННА ВАСИЛЬЕВНА ФИЗИОЛОГИЧЕСКОЕ СОСТОЯНИЕ ЛОШАДЕЙ ТРАКЕНЕНСКОЙ ПОРОДЫ РАЗЛИЧНЫХ ПОЛОВОЗРАСТНЫХ ГРУПП ПРИ ВВЕДЕНИИ В РАЦИОН КОНЪЮГИРОВАННЫХ ФОРМ МИКРОЭЛЕМЕНТОВ 03.03.01 – Физиология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва – 2012 1 Работа выполнена на кафедре физиологии, общей биологии и основ ветеринарии ФГБОУ ВПО Тверская государственная сельскохозяйственная академия Научный руководитель : доктор биологических наук,...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.