WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Элижбаева Медина Абубакаровна

ПАРВОВИРУС В19 У ДОНОРОВ КРОВИ И БОЛЬНЫХ

ГЕМАТОЛОГИЧЕСКОГО СТАЦИОНАРА

14.01.21 - гематология и переливание крови

Автореферат диссертации на соискание ученой степени

кандидата биологических наук

Москва-2011

Работа выполнена в Федеральном Государственном бюджетном учреждении «Гематологический научный центр» Министерства здравоохранения и социального развития Российской Федерации Научные руководители:

чл-корр. РАМН, д.м.н., проф. Савченко Валерий Григорьевич к.б.н. Судариков Андрей Борисович

Официальные оппоненты:

доктор биологических наук, профессор Карпова Ольга Вячеславовна доктор медицинских наук, профессор Лукина Елена Алексеевна

Ведущая организация:

Федеральное государственное учреждение «Федеральный Научно-клинический центр детской гематологии, онкологии и иммунологии» Министерства здравоохранения и социального развития Российской Федерации.

Защита состоится « » 2011г., в часов на заседании диссертационного совета Д 208.135.02 в ФГБУ «Гематологический научный центр»

Минздравсоцразвития РФ по адресу: 125167, Москва, Новый Зыковский проезд, д. 4.

С диссертацией можно ознакомиться в библиотеке ФГБУ ГНЦ МЗСР России Автореферат разослан « » 2011г.

Ученый секретарь диссертационного совета кандидат медицинских наук Зыбунова Е.Е.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы Инфицирование парвовирусом В19 встречается достаточно часто. Известно, что к 70 годам 60-70 % людей имеют антитела к этому вирусу и, cледовательно, перенесли инфекцию парвовируса В19 (PV B19). Вирус передается трансфузионным и воздушно-капельным путем. Основными клетками-мишенями для PV B19 являются эритробласты, дифференцировка в эритроциты которых после инфицирования вирусом нарушается, что приводит в конечном итоге к снижению количества эритроцитов в крови. Обычно этот период длится около двух недель - времени, необходимого для антителообразования. Однако, у пациентов с иммунодефицитом или нарушением эритроидного ростка на фоне парвовирусной инфекции может возникнуть транзиторная анемия, тромбоцитопения, парциальная красноклеточная аплазия костного мозга и другие осложнения.




PV B19 термостабилен, поэтому инфицирование возможно также и при переливании препаратов, получаемых в результате переработки донорской крови. В острой фазе заболевания PV B19 может присутствовать в крови в очень высокой концентрации – до 1012 копий/мл. Таким образом, при пулировании плазмы от различных доноров в производстве компонентов для трансфузий может быть достаточно одного положительного образца для заражения всего объема.

Европейская фармакопея (EP) и Управление по контролю за пищевыми продуктами и лекарственными препаратами США (FDA), рекомендуют проверку донорской крови на наличие PV B19 наряду с другими особо опасными инфекциями, передающимися при трансфузиях компонентов крови, такими, как СПИД и гепатиты В и С. Банки крови США, Германии, Австрии, Великобритании осуществляют тестирование донорской крови на наличие PV B19.

Многочисленные работы указывают на необходимость количественного тестирования на PV B19 донорской крови, переливаемой больным, находящимся в состоянии иммуносупрессии. Выбраковка донорской крови, потенциально опасной для инфицирования при трансфузиях, повысит уровень вирусной безопасности гемотрансфузий.

Оценить необходимость тестирования крови на парвовирус В19 в подразделениях службы крови и в гематологическом стационаре и определить группы больных, для которых такое тестирование необходимо в первую очередь.

1.Определить частоту встречаемости PV В19 у доноров Отделения переливания крови (ОПК) ФГБУ Гематологический научный центр и Чеченской республиканской станции переливании крови (СПК).

2.Выявить частоту встречаемости PV В19 у больных с различными диагнозами, проходящих лечение в ФГБУ Гематологический научный центр, в зависимости от пола, возраста, длительности пребывания в стационаре и наличия трансфузий.

3.Установить группы больных, которых необходимо тестировать на наличие PV B19 во время прохождения лечения в клинике.

Впервые проведено исследование по определению встречаемости PV B19 у двух популяций доноров ОПК ФГБУ Гематологический научный центр и Чеченской республиканской СПК. Впервые проведено масштабное исследование по определению встречаемости PV B19 у больных с различными диагнозами, проходящих лечение в ФГБУ Гематологический научный центр, в зависимости от пола, возраста, длительности пребывания в стационаре и наличия трансфузий.

Работа представляет большое значение для российской службы крови, т.к. в ней выявлена частота встречаемости PV В19 у доноров крови в Москве и Московской области на примере доноров ОПК ФГБУ Гематологический научный центр и в Чеченской республике на примере доноров Грозненской станции переливания крови. Кроме того, в работе показана необходимость систематического мониторинга на PV В19 гематологических больных и больных, находящихся в состоянии иммуносупрессии для своевременного выявления инфицирования парвовирусом и назначения лечения во избежание осложнений для больного и дальнейшего распространения вируса в отделении.





1. Частота обнаружения ДНК PV B19 в крови доноров ОПК ГНЦ (1,0%) и в крови доноров Чеченской СПК (1,3%) соответствуют частоте в других Европейских и Азиатских странах.

2. Частота обнаружения PV B19 выше у больных острыми лейкозами. Тестирование препаратов крови, переливаемых этим больным, а также мониторинг PV B19 в процессе лечения необходимы для предотвращения осложнений в период лечения.

Диссертационная работа апробирована 8 июля 2011 года на заседании проблемной комиссии «Гемопоэз, молекулярная биология, биотехнология, иммуногематология; гемобластозы и депрессии кроветворения» в Федеральном Государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации.

Материалы работы представлены на Российской научно-практической конференции «Актуальные вопросы гематологии и трансфузиологии» (Санкт-Петербург, 2009г.) и на VII Всероссийской научно-практической конференции с международным участием «Молекулярная диагностика – 2010» (Москва, 2010г.) По теме диссертационной работы опубликовано 6 печатных работ.

Диссертация изложена на 104 страницах, состоит из введения, обзора литературы, описания материалов и методов, изложения результатов и их обсуждения, заключения, выводов и списка цитируемой литературы. Работа содержит 13 рисунков и таблиц. Список цитированной литературы включает 319 наименований.

МАТЕРИАЛЫ И МЕТОДЫ

Работа выполнена в лаборатории молекулярной гематологии ФГБУ ГНЦ Минздравсоцразвития РФ (зав.лаб. – к.б.н. Судариков А.Б.). Исследования выполнялись в рамках бюджетной темы НИР.

Доноры. В работе использовали образцы сывороток 1011-ти доноров Гематологического научного центра Минздравсоцразвития РФ (г.Москва) (декабрь 2008г.), а также сыворотки крови 510-ти доноров Чеченской республиканской станции переливания крови (г.Грозный) (ноябрь 2009г.). Среди доноров Чеченской республиканской станции переливания крови проводили анкетирование донора и у каждого из них брали информированное согласие на обезличенную обработку персональных данных.

Больные. В работе использовали сыворотки крови 1101 больного, находящихся на лечении в различных отделениях Гематологического научного центра Минздравсоцразвития РФ (г.Москва) (2005 - 2010гг.).

Выделение вирусных нуклеиновых кислот из сыворотки крови. ДНК PV B19 выделяли с помощью гунидинтиоцианата. Сыворотку крови (100мкл) смешивали с 450 мкл лизирующего буфера (5.5 М гуанидинтиоцианат, 0.3 М натрий ацетат, 50% фенола, насыщенного 0.1 М Трис, рН 6.5, транспортная РНК 25мкг/мл, внутренний контроль 2000 копий/мл). Добавляли 100 мкл хлороформа. Центрифугировали. К водной фазе добавляли равный объем изопропанола. После центрифугирования осадок отмывали 80% этанолом и растворяли в 25мкл деионизованной воды.

Выделение геномной ДНК из лейкоцитов донорской крови. У доноров Чеченской станции переливания крови кроме образцов сыворотки, брали 9 мл крови с 1мл 4%-ого цитрата Na и выделяли ядерные клетки. ДНК выделяли из лейкоцитов по модифицированному «солевому» протоколу.

Праймеры для ПЦР в реальном времени. Мы использовали праймеры для определения фрагмента гена неструктурного белка PV B19. Для определения ДНК HBV и РНК HCV в работе использовали ранее разработанные в лаборатории соответствующие системы праймеров и проб. В качестве внутреннего контроля использовали фрагмент гена Jак2 мыши. Последовательности олигонуклеотидних праймеров и проб приведены в таблице 1.

Внутренний контроль. В качестве внутреннего контроля выделения нуклеиновых кислот и прохождения полимеразной цепной реакции в каждой пробирке использовали фрагмент гена Jак2 мыши.

Таблица №1. Последовательности праймеров и зондов, используемых в работе.

мишень 5'-3' ПОСЛЕДОВАТЕЛЬНОСТИ ПРАЙМЕРОВ И ЗОНДА 5'-actatgaaaactgggcaataaac-3' 5'-caccaccactgctgctgata-3' 5'-cy5-aattaatgcagatgccctcPV B HBV 5'-cttcgcttcacctctgc-3' 5'- caaggtcggtcgttgac-3' 5'-fam-acataagaggactcttggactctcagcaat-bhq1- 5'-ctcatggtgcacggtctac-3' * 5'- cgaaaggccttgtggtact-3' 5'-r&g-cactcgcaagcaccctaHCV 5'-ggaccctacacagtttgaagag-3' Примечание. *Праймер использовали в реакции обратной транскрипции.

Создание внутренного стандарта для количественного определения 1. Клонирование фрагмента ДНК PV B19 в вектор pGEM-TEasy. Выделяли ДНК из сыворотки крови больного PV B19. Проводили классическую ПЦР. Полученный амплификат лигировали в вектор pGEM-TEasy (Promega) и клонировали в клетках Е.coli (штамм TB1). Селекцию клонов проводили на среде LB+2% агар+хGAL+IPTG+ампицилин. Выросшие белые колонии проверяли на наличие вставки п.н. методом ПЦР.

2.Построение калибровочной кривой. Для построения калибровочной кривой использовали ряд последовательных разведений плазмиды pGEM-TEasy/PV B (2,5х109 копий/мл, 2,5х108 копий/мл, 2,5х107 копий/мл, 2,5х106 копий/мл, 2,5х105 копий/мл, 2,5х104 копий/мл, 2,5х103 копий/мл, 2,5х102 копий/мл).

ПЦР в реальном времени для определения PV B19. Реакционная смесь для ПЦР в реальном времени (25 мкл), содержала буфер для Taq ДНК полимеразы (100mM KCL, TrisHCL (pH 8,8)), МgCl2 2,5 мМ, смесь dNTP 25 мкМ, праймеры PV B19 и праймеры Jak2 (по 10 пмоль прямого и обратного праймеров), флюоресцентные зонды Hyb_PV B19 и Hyb_Jак2 (3 пмоль), SynTaq ДНК полимераза (1U), 5мкл раствора ДНК. ПЦР в реальном времени проводили в приборе АНК-32 («Синтол») при следующем температурном режиме: первоначальная денатурация 95 оС, 5 мин и последующие 45 циклов соответственно, 60оС 50 сек. и 95оС 20 сек.

Верификация созданной тест-сисиемы для количественного выявления ДНК PV B19. Для подтверждения чувствительности разработанного набора ДНК PV B19- положительные образцы были протестированы с помощью коммерческой тестсистемы для выявления и количественного определения ДНК PV B АмплиСенс®Parvovirus B19-FL. Экстракцию ДНК выполняли в этом случае с помощью набора Рибо-преп (ЦНИИЭ Роспотребнадзора). Реакцию проводили на амплификаторе Rotor-Gene 6000 (“Corbett Research”, Австралия) с детекцией флюоресцентного сигнала в режиме реального времени.

Мультиплексная ПЦР в реальном времени для выявления HBV и HCV.

Обратная транскрипция РНК HCV. Реакционная смесь для обратной транскрипции РНК HCV (10 мкл) содержала: буфер для M-MLV-ревертазы, смесь dNTP 25мкМ, обратный праймер HCV (10 пмоль), M-MLV-ревертаза (10U), ингибитор РНКаз (1U), 5мкл раствора нуклеиновых кислот.

Обратную транскрипцию проводили при 50°С в течение 30 мин с последующим нагреванием при 95°С в течение 5 мин.

Параметры проведения мультиплексной ПЦР. Реакционная смесь для мультиплексной ПЦР в реальном времени (25 мкл) содержала: буфер для Taq ДНК полимеразы (100mM KCL, TrisHCL (pH 8,8)), МgCl2 2,5 мМ, смесь dNTP 25мкМ, праймеры HBV, HCV и Jak2 (по 10 пмоль прямого и обратного праймеров), флюоресцентные зонды Hyb_HBV, Hyb_HCV и Hyb_Jак2 (3 пмоль) и SynTaq ДНК полимераза (1U) «Синтол». 5мкл раствора кДНК добавляли после обратной транскрипции. ПЦР в реальном времени проводили приборе АНК-32 «Синтол» при следующем температурном режиме: первоначальная денатурация 95оС, 5 мин. и последующие 45 циклов 60оС 50 сек. и 95оС 20 сек, соответственно.

Выявление антител к вирусам. Для выявления: IgM (IgG)- антител к парвовирусу В19 использовали коммерческий иммуноферментной набор «Биотрин» (Ирландия); HbsAg - использовали коммерческий иммуноферментной набор реагентов «ГепаСтрип» (Россия); IgM (IgG)-антител к вирусу гепатита С использовали коммерческий иммуноферментной набор реагентов «Бест анти-HCV» (комплект 3) (Россия).

Статистическая обработка результатов. Для статистической обработки результатов использовали методы описательной статистики и однофакторный частотный анализ; для расчета значимости применяли X2 критерий.

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Разработка тест-системы для определения ДНК PV B Для качественного и количественного определения ДНК PV B19 методом полимеразной цепной реакции в реальном времени были выбраны праймеры и флюоресцентно меченный зонд, специфически выявляющие фрагмент ДНК PV B19.

Мы использовали праймеры для определения фрагмента гена неструктурного белка PV B19, предложенные в работе [Compston L.I. et al., 2008]. Для получаемого амплификата мы разработали флюоресцентный зонд, который использовали с этими http://frodo.wi.mit.edu/primer3/).

5'CCTGACATGGGGTTACTAACAGAGGCTGATGTACAACAGTGGCTTACATGGTGTAATGCACA

AAGCTGGGACCACTATGAAAACTGGGCAATAAACTACACTTTTGATTTCCCTGGAATTAATGCA

GATGCCCTCCACCCAGACCTCCAAACCACCCCAATTGTCACAGACACCAGTATCAGCAGCAGT

GGTGGTGAAAGCTCTGAAGAACTCAGTGAAAGCAGCTTTTTTAACCTCATCACCCCAGGCGCCT

GGAACACTGAAACCCC3'

Рисунок № 1. Нуклеотидная последовательность фрагмента гена неструктурного белка PV B19. Жирным подчеркнутым курсивом выделены прямой и обратный праймеры, жирным шрифтом выделен флюоресцентный зонд. Размер амплификата 123 п.н.

Кроме того, был разработан внутренний контроль, вводимый на самой ранней стадии работы с образцом и выявляемый на последней стадии, для подтверждения успешного прохождениея всего процесса и исключения ложно-негативных результатов.

В качестве внутреннего контроля за прохождением всех этапов процесса мы использовали фрагмент кДНК гена Jак2 мыши, не имеющий гомологий с последовательностью ДНК PV B19 и ДНК человека (рис. 2).

5'TTGAAGACAGGGACCCTACACAGTTTGAAGAGAGACACTTGAAGTTTCTACAGCAGCTTGGCA

AAGGTAACTTCGGGAGTGTGGAGATGTGCCGCTATGACCCGCTGCAGGACAACACTGGCGAG

GTGGTCGCTGTGAAGAAACTCCAGCACAGCACTGAAGAGCACCTCCGAGACTTTGAGAGGGAG

ATCGAGATCCTGAAATCCTTGCAGCATGACAACATCGTCAAGTACAAGGGAGTGTGCTACAGT

GCGGGTCGGCGCAACCTAAGATTAATTATGGAATATTTACCATATGG3'

Рисунок № 2. Нуклеотидная последовательность фрагмента кДНК гена Jак2 мыши. Жирным подчеркнутым курсивом выделены прямой и обратный праймеры, жирным шрифтом выделен флюоресцентный зонд. Размер амплификата 117 п.н.

Амплификат (117 п.н., мол. вес 7,7х104 Да) выделяли из геля после электрофореза ПЦР-продуктов. Количество копий амплификата в миллилитре водного раствора определяли как указано выше (Материалы и методы). Выделенный амплификат добавляли в лизирующий буфер для выделения вирусной ДНК из образцов сыворотки крови в концентрации 103 копий/мл.

В систему был также введен внутренний стандарт для количественных измерений ДНК PV B19. Для создания внутреннего стандарта амплификат, получаемый с используемыми для выявления ДНК PV B19 праймерами, был клонирован в коммерческую плазмиду pGEM-TEasy. Концентрация выделенной ДНК вновь полученной плазмиды была измерена и построена калибровочная кривая. Для построения калибровочной кривой использовали ряд последовательных разведений плазмиды pGEMTEasy/PV B19 (2,5х109 копий/мл, 2,5х108 копий/мл, 2,5х107 копий/мл, 2,5х копий/мл, 2,5х105 копий/мл, 2,5х104 копий/мл, 2,5х103 копий/мл, 2,5х102 копий/мл).

Программное обеспечение, комплектуемое с прибором для проведения полимеразной цепной реакции в реальном времени АНК-32 («Синтол»), позволяло строить калибровочную кривую и проводить с ее помощью количественные расчеты (рис.3).

В результате была получена тест-система для количественного определения ДНК PV B19 (тест-система ГНЦ). Чувствительность тест-системы - 100 копий/мл сыворотки крови. Специфичность тест-системы обеспечивается специфичностью праймеров и зонда.

Рисунок № 3. Калибровочная кривая, построенная с помощью программного обеспечения АНК-32 («Синтол»).

По калибровочной кривой рассчитывали концентрации ДНК PV B19 в исследуемых образцах, учитывая объемы образца сыворотки и образца выделенной вирусной ДНК.

Результаты по изменению ДНК PV B19 нашей тест-системой мы сравнили со значениями, получаемыми с помощью коммерческого набора для выявления и количественного определения ДНК PV B19 АмплиСенс®Parvovirus B19-FL.

Создание коллекции образцов сывороток и ДНК доноров. В процессе работы нами была собрана коллекция образцов сывороток крови и лейкоцитов доноров, из которых впоследствии выделялись нуклеиновые кислоты.

Создание базы данных доноров, а также стационарных и амбулаторных больных, исследованных на наличие ДНК PV B19. База данных состоит из электронной таблицы с идентификационными номерами доноров (г. Москва и г.Грозный) и больных, находившихся на лечении в стационаре или на амбулаторном наблюдении в ГНЦ и проходивших тестирование на наличие ДНК PV B19 и других вирусов. В базе данных содержатся сведения об образце взятого биологического материала (вид материала, ФИО больного, отделение, дата проведения анализов, результат). Созданная база данных связана с институтскими базами данных о больных и донорах, содержащими расширенную информацию.

Выявление ДНК PV B19 у доноров с помощью количественной тест-системы. Образцы сывороток от доноров 2-х вышеназванных популяций были протестированы на наличие ДНК PV B19 с помощью разработанной нами системы для количественного выявления ДНК PV B19 методом полимеразной цепной реакции в режиме реального времени.

Доноры ОПК ГНЦ. Из 1011 доноров ОПК ГНЦ образцов было выявлено 20 положительных на ДНК PV B19. Для анализа количественных результатов все области значения концентрации ДНК PV B19 мы разбили на три диапазона: диапазон А включал концентрацию вируса менее 104 копий/мл; диапазон Б - концентрации от 10 4 до 105 копий/мл; диапазон В - более 105 копий/мл. В диапазон А попали 12 из вирусположительных образцов (1,2 % от общего числа исследованных доноров), в диапазон Б - 5 образцов (0,5% от общего числа исследованных доноров) и в диапазон В – 3 образца (0,3%) (рис. 4).

Рисунок № 4. Частота встречаемости здоровых доноров и доноров, у которых обнаружена ДНК PV B19 в различных концентрациях на ОПК ГНЦ. А - диапазон концентраций ДНК PV B19 менее 104 копий/мл; Б - диапазон концентраций ДНК PV B19 от 10 4 до 105 копий/мл; В диапазон концентраций ДНК PV B19 более 105 копий/мл.

Доноры Чеченской республиканской СПК. Из 510 доноров Чеченской республиканской СПК было выявлено 7 положительных на ДНК PV B19. В диапазон А попали все 7 (1,3 % от общего числа исследованных доноров), в диапазоны Б и В не попало ни одного образца (рис. 5).

Рисунок № 5. Частота встречаемости ДНК PV B19 у доноров Чеченской республиканской СПК. Во всех положительных образцах (1,3%) концентрация ДНК PV B19 менее копий/мл.

Выявление антител классов IgM и IgG у доноров положительных Доноры ОПК ГНЦ. У доноров ОПК ГНЦ, в 12-ти образцах сыворотки вирусположительных на ДНК PV B19, с концентрацией вирусной ДНК менее 10 4 копий/мл выявлялись только антитела класса IgG к PV B19. У доноров с концентрацией вирусной ДНК от 104 до 105 копий/мл выявлялись одновременно антитела классов IgM и IgG (5 доноров из 20 вирусположительных доноров). Более 10 5 копий/мл ДНК PV B было выявлено у трех доноров, причем у одного из этих доноров выявлены только IgM, у одного донора – одновременно IgM и IgG, и у одного донора – никаких антител к PV B19 выявлено не было. Концентрация ДНК PV B19 в последнем образце была самой высокой и составила 2х109 копий/мл.

Доноры Чеченской республиканской СПК. У чеченской популяции доноров, все 7 образцов сыворотки положительных на ДНК PV B19 оказались с концентрацией вирусной ДНК менее 104 копий/мл и с антителами класса IgG к PV B19. C концентрацией вирусной ДНК от 104 до 105 копий/мл и более 105 копий/мл ДНК PV B19 образцов выявлено не было.

Связь вирусной нагрузки с антителами, вырабатываемыми на PV B19 Результаты нашей работы показывают, что у доноров как на ОПК ГНЦ, так и на Чеченской СПК встречается PV B19, причем у доноров ОПК ГНЦ существенно чаще, соответственно, 2,0% (ОПК ГНЦ) против 1,3% (СПК Грозный). Распределение вирусной нагрузки и типа антител в этих группах также неодинаково. Процент доноров, имеющих концентрацию вируса более 104 копий/мл, среди московских доноров в нашей работе равен 0,8%, а среди чеченских доноров равен 0. Многочисленными работами показано, что компоненты донорской крови, имеющие концентрацию ДНК PV B19 не более 104 копий/мл пригодны для переливания реципиентам и заготовки препаратов из крови, а антитела класса IgG в большом количестве содержащиеся в этой крови обладают протективными свойствами относительно PV B19. Таких доноров на ОПК ГНЦ было обнаружено 99,2%, а на Чеченской СПК – 100%.

Доноры, у которых выявляются только IgM-антитела к PV B19 или одновременно антитела двух классов IgM и IgG, имеют более высокую вирусную нагрузку, и их кровь непригодна для переливания. Работы зарубежных исследователей показывают, что компоненты, содержащие ДНК PV B19 в концентрации более 10 5 копий/мл ДНК PV B19 и антитела класса IgM указывают на острую инфекцию, и стоит отказаться от их использования. Отсутствие антител к парвовирусу В19 не говорит об отсутствии самого вируса в крови донора. Напротив, в период сероконверсии вирусная нагрузка может быть очень высокой (до 10 12 и выше), а антител может не быть вообще. В нашем исследовании был выявлен 1 донор, у которого не было обнаружено ни IgM-антител ни IgG-антител к PV В19, однако, концентрация ДНК PV B19 была 2 х 10 9 копий/мл. Этот факт показывает, что выявить доноров, инфицированных PV B19, в период сероконверсии можно только с помощью методов для выявления ДНК вируса, а серологические методы для выявления антител в этот период неинформативны, поскольку антитела еще не выработались. Результаты наших исследований полностью совпадают с литературными данными о том, что в крови доноров с высокой вирусной нагрузкой или может не содержаться никаких антител к PV B19 или содержатся только IgM - антитела к PV B19, а также IgM/IgG-антитела одновременно, а в крови доноров с вирусной нагрузкой не более не более 104 копий/мл содержатся только IgG - антитела.

По результатам нашей работы 0,8% крови, полученной от 1011 доноров ОПК ГНЦ следовало бы выбраковать вследствие наличия в ней высокой концентрации ДНК PV B19.

Тестирование доноров Чеченской республиканской СПК с помощью мультиплексной системы для комплексного тестирования гепатитов В и С и парвовируса В19. В процессе работы мы протестировали образцы сывороток всех доноров чеченской СПК с помощью разработанной ранее мультиплексной системы для комплексного выявления гепатитов В, С и парвовируса В19. Образцы совороток доноров, положительные на любой из названных вирусов, проходили тестирование на соответствующие антитела. Результаты приведены в табл. Таблица 2. Тестирование доноров Чеченской СПК на гепатиты В, С и PV B19.

обнаружена обнаружена обнаружены Из таблицы следует, что положительной корелляции между инфицированностью PV B19 и гепатитами у доноров Чеченской СПК нет.

Доноры Чеченской республиканской СПК. Результаты обработки донорских анкет не позволили проанализировать связь заболеваемости PV B19 с социальным статусом доноров (образование, профессия, семейное положение и т.д.) ввиду малой выборки (510 анкет чеченских доноров всего и 7 из них положительных на наличие PV B19). Все доноры были безвозмездными, причем часть из них были кадровыми.

Среди кадровых доноров не было найдено гепатитов В и С. Не было выявлено различия в частоте встречаемости PV B19 среди кадровых доноров и остальных безвозмездных доноров. Мы не нашли разницы в инфицировании ДНК PV B19 доноров в зависимости от пола.

Доноры ОПК ГНЦ. Подробного анкетирования московских доноров не проводилось. Из информации, имеющейся в нашей базе данных по донорам, можно было сделать лишь следующие выводы:

1.Частота встречаемости PV B19 у доноров ГНЦ составляет 2%.

2.Различий по заболеваемости PV B19 между мужчинами и женщинами нет.

3.Инфицированность доноров, возраст которых более 40 лет в 2 раза меньше, чем инфицированность доноров, возраст которых менее 40 лет.

Частота по встречаемости PV B19 среди доноров СПК почти в 2 раза больше, чем максимально высокая зарегистрированная частота встречаемости PV B19 в мире. Что касается России, то, например, в Нижнем Новгороде встречаемость PV B19 была зарегистрирована на уровне 1,0%, а на выборке чеченских доноров мы получили 1,3%.

Такой результат заставил нас провести более подробный анализ донорских анкет с помощью институтской базы. Мы выяснили, что из 1011-ти московских доноров доноров было из г.Балашиха, причем все они были первичными и платными. Все эти доноры являлись военными и служили в одном гарнизоне, и кроводача у всех проходила примерно в одно и то же время – во второй половине декабря 2008 г. Из 145-ти доноров из г.Балашиха 12 оказались вируспозитивными, причем IgM-антитела, сопровождающие острую фазу инфекции, оказались у 6-ти, а один донор, имевший самую высокую концентрацию вируса, был серонегативен. Таким образом, частота встречаемости PV B19 среди доноров из г.Балашиха составила 8%. Ясно, что в г.Балашиха в декабре 2008 была вспышка заболеваемости PV B19, что и отразилось на полученной нами частоте встречаемости.

Известно, что симптомы в начале заболевания PV B19 сходны с симптомами развития ОРВИ. Именно в этот период в крови регистрируется высокая концентрация вируса и IgM-антитела. На самой первой стадии антител еще может не быть, а концентрация вируса при этом превышать 10 7- 109 копий/мл (среди московских доноров найден один). Таким образом, некоторые из единовременных платных доноров, находясь на первой стадии заболевания и чувствуя недомогание, сдавали кровь.

Среди кадровых и бесплатных доноров мы таковых не нашли.

Таким образом, кровь, непригодная для переливания по отношению к PV B19, была зарегистрирована среди единовременных платных доноров, что говорит о различной мотивации при сдаче крови у кадровых доноров, доноров, сдающих кровь для родственников и единовременных платных доноров.

Если исключить 145 балашихинских доноров общего числа исследуемых нами доноров ГНЦ при подсчете распространенности PV B19, то вируспозитивных доноров останется 8, причем, только один донор имеет одновременно IgM- и IgG - антитела, а все остальные – только IgG- антитела. Ниже приведены скорректированные рисунки, иллюстрирующие частоту встречаемости PV B19 у московских доноров (рис.6). Мы полагаем, что именно эти результаты правильнее отражают частоту встречаемости PV B19 среди доноров ГНЦ.

Рисунок № 6. Частота встречаемости здоровых доноров и вируспозитивных по ДНК PV B без учета доноров из г. Балашиха в различных концентрациях на ОПК ГНЦ. А - диапазон концентраций ДНК PV B19 менее 104 копий/мл; Б - диапазон концентраций ДНК PV B19 от 104 до 105 копий/мл.

Результаты проведенных нами исследований позволяют придти к заключению о том, что частота встречаемости PV B19 у российских доноров находится в том же диапазоне, что и частота, измеренная в различных регионах мира. Данные совпадают с данными, полученными на другой российской СПК - Нижнегородской станции переливания крови.

гематологического центра В настоящей работе мы проводили оценку обнаружения инфицирования парвовирусом В19 больных Гематологического научного центра в зависимости от основных демографических характеристик, таких как: пол, возраст, а также диагноза, длительности пребывания в стационаре и количества полученных трансфузий.

Были две причины направления образцов в лабораторию: обязательное при поступлении в ГНЦ тестирование на гепатиты В и С, и целевое исследование на наличие ДНК PV B19. В таблице 3 приведены данные о числе положительных результатов в образцах крови в двух группах больных в зависимости от причины направления.

Таблица 3. Результаты тестирования на наличие ДНК PV B19 в зависимости от причины направления.

Причина направления образца Число и процент положительных Естественно, в образцах второй группы частота обнаружения ДНК вируса существенно повышена (14.9%) и не может служить оценкой истинной распространенности инфицирования, так как образцы направлялись для подтверждения косвенных клинических признаков инфицирования. Причина же направлений в первой группе не связана непосредственно с подозрением на наличие паровирусной инфекции, поэтому оценкa распространенности, полученная на пациентах этой группы (3.2%), более объективна. Поэтому дальнейший анализ проводился только по первой группе.

Частота обнаружения PV B19 не зависит от пола и несколько снижается с возрастом с 4.4% в группе моложе 40 лет до 2.1% в группе старше 40 (табл. 4).

Таблица 4. Частота обнаружения ДНК PV B19 в зависимости от демографических характеристик.

Эти данные находятся в хорошем соответствии с результатами других исследователей.

Частота обнаружения PV B19 у больных во всех отделениях ГНЦ, кроме отделения трансплантации костного мозга, составляет примерно 3%, что в 3 раза выше, чем частота встречаемости PV B19 у доноров. В отделении трансплантации костного мозга она существенно выше - 8%, что естественно связано с профилем отделения и определяется диагнозом больных, госпитализируемых в отделение. Если сравнивать распространенность в группах по диагнозу, то самый высокий процент инфицированности PV B19 - 7% -был в подгруппе больных с острым лейкозом (табл. 5). Нам не удалось встретить в литературе работ, посвященных исследованию частоты инфицирования парвовирусом B19 взрослых больных острым лейкозом, однако, опубликованы исследования инфицированности PV B19 при острых лейкозах у детей, где оценки распространенности несильно отличаются от полученных нами.

Таблица №5. Частота обнаружения ДНК PV B19 в зависимости от диагноза.

Миелопролиферативные заболевания 1 из 33 (3.0%) Лимфопролиферативные заболевания 2 из 69 (2.9%) p=0. Таблица №6. Частота обнаружения ДНК PV B19 в зависимости от клинических факторов.

Несколько Длительность госпитализаций Наличие В таблице 6 приведены данные по зависимости частоты обнаружения PV B19 в зависимости от клинических факторов, характеризующих длительность пребывания в стационаре и наличия трансфузионной терапии. Хотя есть разница во встречаемости ДНК PV B19 у больных, получавших и не получавших трансфузии в период пребывания в стационаре, формально она статистически не значима. Что касается длительности пребывания больных в стационаре, то ДНК PV B19 была обнаружена у чуть более 2 % у пациентов, находящихся в клинике менее 60 дней, и около 6 % у пациентов, госпитализация которых длилась более, 60 дней. Такое же примерно соотношение выявлено между больными, однократно госпитализированными и прошедшими госпитализацию в ГНЦ многократно. Таким образом, можно считать установленным, что распространенность PV B19 у тяжелых больных в 2-3 раза выше.

Из полученных в работе данных видно, то что частота обнаружения парвовируса B19 очевидно коррелирует с клиническими факторами, характеризующими тяжесть заболевания – это диагноз, длительность и кратность госпитализаций. Хотя данных для уверенных выводов недостаточно, можно предположить что, трансфузионный путь передачи менее вероятен, чем воздушно-капельный путь. Но тот факт, что распространенность PV B19 в донорской популяций при отсутствии тестирования компонентов составляет около 1%, с очевидностью свидетельствует, что этот путь инфицирования существует, и для реципиентов множественных трансфузий он существенен. Очевидно, что больной, получивший в гематологическом стационаре трансфузии компонентов крови, инфицированные PV B19, становится потенциальным источником инфекции для остальных пациентов. Можно предположить, что пациенты с PV B19 имеют тяжелые осложнения, и их пребывание в больнице продолжается существенно дольше, чем у других пациентов. Но однозначно установить причинно-следственную связь между длительность пребывания в стационаре и инфицированностью B19 имеющиеся данные не позволяют, так как нельзя исключить внутрибольничное инфицирование пациентов, долгое время находящихся в клинике.

То, что распространенность PV B19 среди гематологических больных выше, чем среди доноров очевидно и неудивительно. Симптомы, вызванные парвовирусной инфекцией, могут являться причиной поступления больного в гематологическое отделение. Контакт между собой пациентов, находящихся в отделении, множественные трансфузии также являются причиной увеличения распространенности PV B19 в гематологическом стационаре.

ЗАКЛЮЧЕНИЕ

Парвовирус В19 передается в основном воздушно-капельным путем. Однако, существует вероятность передачи вируса с помощью трансфузий. По нашим данным в декабре 2008 г. 0,8 % из 1011 доноров обследованных на наличие PV B19, имели в крови вирус с концентрацией, потенциально опасной для инфицирования при трансфузии. Учитывая повышенную распространенность PV B19 среди гематологических больных и серьезные осложнения, вызываемые у них этим вирусом, мы полагаем, что компоненты крови, предназначенные для трансфузий этим больным, должны проходить тестирование на PV В19. Кроме того, необходимо систематически проводить мониторинг на PV В19 у больных, находящихся в состоянии иммуносупрессии, чтобы своевременно выявлять инфицирование парвовирусом и назначать лечение во избежание осложнений для больного и дальнейшего распространения вируса в отделении.

Отметим, что во многих странах все компоненты, запасаемые банками крови, тестируются на PV В19.

ВЫВОДЫ

1. Разработана и верифицирована тест-система для количественного выявления PV B19 методом ПЦР в режиме реального времени. Протестировано 2500 образцов сывороток на наличие вируса у доноров и больных.

2. Показано, что у доноров, положительных на ДНК PV B19 и имеющих концентрацию вируса менее 104 копий/мл, обнаруживаются только IgG- антитела к PV B19; при концентрации вируса более 104 копий/мл — либо одновременно IgG и IgM, либо IgM. При высокой концентрации вируса антитела могут отсутствовать (серонегативное окно).

3. Установлено, что частота обнаружения ДНК PV B19 в крови доноров ОПК ГНЦ (1,0%) и в крови доноров Чеченской СПК (1,3%) соответствуют частоте в других Европейских и Азиатских странах.

4. Впервые обнаружено локальное повышение уровня инфицированности PV B (8%, декабрь 2008г., г.Балашиха, Россия), что необходимо учитывать при анализе популяционных данных, а также при планировании выездной деятельности службы крови.

5. Доказано, что чаще всего PV B19 обнаруживается у больных острыми лейкозами. Тестирование препаратов крови, переливаемых этим больным, а также мониторинг PV B19 в процессе лечения необходимы для предотвращения тяжелых осложнений, вызываемых этим вирусом.

6. Инфицированность PV B19 возрастает у больных, длительное время находящихся в стационаре, и не зависит от интенсивности трансфузий. Инфицированность PV B19 у доноров и больных не коррелирует с инфицированостью гепатитами В и С.

1. М.А. Элижбаева, И.С. Февралева, О.А. Глинщикова, О.Ю. Сильвейстрова, О.Ю. Шипулина, Э.А. Домонова, А.П. Сафонова, Е.Н. Овчинникова, З.М.

Татаева, А.Б. Судариков.// Выявление парвовируса B19 в крови российских доноров.// Гематология и трансфузиология. 2011, т.56, №2, стр.10-13.

2. М.А. Элижбаева, И.С. Февралева, О.Е. Ягужинская, О.А. Глинщикова, Е.Н.Овчинникова, М.И.Лазаренко, А.Б.Судариков.// Распространенность парвовируса В19 среди доноров московского региона.// Российская научнопрактическая конференция «Актуальные вопросы гематологии и трансфузиологии». Санкт-Петербург. Трансфузиология. Июль 18-19, 2009, т.10, №1-2, стр.73.

3. И.С. Февралева, О.А. Глинщикова, М.А. Элижбаева, Б.В. Зингерман, Ю.Ю.

Гудилина, Т.Ц. Гармаева, С.М. Куликов, А.Б.Судариков, В.Г Савченко.// Распространенность PV B19 среди больных гематологического стационара.// Гематология и трансфузиология. 2011, т.56, №6.

4. О.Ю. Сильвейстрова, М.А. Элижбаева, О.Ю. Шипулина, И.С. Февралева, А.П.

Сафонова, О.А. Глинщикова, Г.А. Шипулин, А.Б Судариков.// Исследование плазмы донорской крови на наличие ДНК Parvovirus B19.// VII Всероссийская научно-практическая конференция с международным участием «Молекулярная диагностика – 2010». Москва. Сборник трудов. Ноябрь 24-26, 2010, т.1, стр.347E.G. Khamaganova, M.A. Elizhbaeva, M.V. Suchkova, A.B. Sudarikov.// Non-HLA Polymorphisms.// Tissue antigens.Abstracts for the 25th European immunogenetics and Histocompatibility Conference Prague, Czech Republic. May 4-7, Tissue antigens. 2011, 77, №5, р.425-426.

6. Е.Г. Хамаганова, М.В. Сучкова, М.А. Элижбаева, А.Б. Судариков.// Гены KIR иммуноглобулинподобных рецепторов естественных киллерных клеток в двух популяциях Российской Федерации.// Иммунология. 2011, т.32, №5, стр.245-248.

Анти-HCV – антитела к вирусу гепатита С ДНК – дезоксирибонуклеиновая кислота ОЛ – острый лейкоз ОПК – отделение переливания крови п.н. – пара нуклеотидов ПЦР – полимеразная цепная реакция РНК – рибонуклеиновая кислота СПК – станция переливания крови ЭДТА – этилендиаминтетрауксусная кислота dNTP – дезоксинуклеозидтрифосфат HbsAg – поверхностный антиген вируса гепатита В HBV –вирус гепатита B HCV – вирус гепатита С IgG – иммуноглобулины класса G IgM – иммуноглобулины класса М PV B19 – парвовирус В

 
Похожие работы:

«Черногривов Игорь Евгеньевич ХИРУРГИЧЕСКОЕ ЛЕЧЕНИЕ ЯТРОГЕННОЙ И ПОСТРАВМАТИЧЕСКОЙ НЕДОСТАТОЧНОСТИ ТРЕХСТВОРЧАТОГО КЛАПАНА (Сердечно-сосудистая хирургия - 14.01.26) Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва – 2011 Диссертация выполнена в Научном Центре сердечно – сосудистой хирургии им. А.Н. Бакулева РАМН. Научный консультант : Академик РАМН, лауреат Государственной премии СССР, доктор медицинских наук, профессор Подзолков Владимир...»

«Рашитова Алена Дмитриевна КОМПЛЕКСНОЕ ЛЕЧЕНИЕ ТРОФИЧЕСКИХ ЯЗВ ПРИ ХРОНИЧЕСКОЙ ВЕНОЗНОЙ НЕДОСТАТОЧНОСТИ (ЭКСПЕРИМЕНТАЛЬНО-КЛИНИЧЕСКОЕ ИССЛЕДОВАНИЕ) 14.01.17 – хирургия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Уфа - 2010 2 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Башкирский государственный медицинский университет Федерального агентства по здравоохранению и социальному развитию....»

«Гапонова Татьяна Владимировна Экспрессия опухолеассоциированных генов PRAME, WT1 и XIAP у больных множественной миеломой в процессе интенсивной терапии и аутотрансплантации. 14.01.21 – Гематология и переливание крови Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2011 2 Работа выполнена в Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской...»

«ПОГРЕБНИЧЕНКО Игорь Викторович ЭФФЕКТИВНОЕ ИСПОЛЬЗОВАНИЕ ПЕЧЕНИ МУЛЬТИОРГАННОГО ДОНОРА ДЛЯ ТРАНСПЛАНТАЦИИ 14.01.24 - трансплантология и искусственные органы АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2014 Работа выполнена в ФГБУ Федеральный научный центр трансплантологии и искусственных органов им. академика В.И.Шумакова Минздрава России. Научный руководитель : Доктор медицинских наук, профессор Мойсюк Ян Геннадиевич Официальные...»

«Глечян Ануш Михайловна Клиническая эффективность периндоприла и его влияние на диастолическую функцию и ремоделирование левого желудочка, жесткость магистральных артерий и эндотелий – зависимую вазодилатацию у пациентов с артериальной гипертонией и сердечной недостаточностью c сохраненной систолической функцией левого желудочка. 14.01.05– кардиология 14.01.13 - лучевая диагностика, лучевая терапия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук...»

«Коростышевская Александра Михайловна Возможности магнитно-резонансной томографии в пренатальной диагностике патологии головного мозга и биометрии интракраниальных ликворных структур 14.01.13 - лучевая диагностика, лучевая терапия Автореферат диссертации на соискание ученой степени доктора медицинских наук Томск - 2010 Работа выполнена в Институте Международный томографический центр Сибирского отделения Российской Академии Наук Научный консультант : доктор медицинских наук,...»

«ЗЕЛЕНСКАЯ Анаит Владимировна ДЕРМАТОПРОТЕКТОРНЫЕ СВОЙСТВА СОЧЕТАНИЯ РЕАМБЕРИНА И РЕКСОДА НА ФОНЕ САХАРНОГО ДИАБЕТА, ОСЛОЖНЕННОГО ЭКЗОГЕННОЙ ГИПЕРХОЛЕСТЕРИНЕМИЕЙ (экспериментальное исследование) 14.03.06 – фармакология, клиническая фармакология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Старая Купавна – 2014 2 Работа выполнена на кафедре фармакологии Государственного бюджетного образовательного учреждения высшего профессионального...»

«Коннова Юлия Александровна Патогенетические механизмы интоксикационного синдрома при острых кишечных инфекциях и методы его коррекции. 14.00.10 – инфекционные болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2007г. Работа выполнена в ГОУ ВПО Московском Государственном Медико-Стоматологическом Университете Росздрава Доктор медицинских наук, профессор Научные руководители: Кожевникова Галина Михайловна Доктор медицинских наук...»

«ЕРШОВ ВАДИМ ИВАНОВИЧ ОСТРЕЙШИЙ ПЕРИОД ИШЕМИЧЕСКОГО ИНСУЛЬТА: КЛИНИКО-ПАТОГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА, ПРОГНОЗИРОВАНИЕ, ВОПРОСЫ ОПТИМИЗАЦИИ НЕЙРОПРОТЕКТИВНОЙ ТЕРАПИИ 14.01.11 - нервные болезни Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва - 2011 2 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Оренбургская государственная медицинская академия Федерального агентства по здравоохранению и...»

«ЖАРОВСКИХ Олег Сергеевич ПРОГНОЗ И ПРОФИЛАКТИКА ГНОЙНЫХ ОСЛОЖНЕНИЙ ПРИ ЭНДОПРОТЕЗИРОВАНИИ ТАЗОБЕДРЕННОГО СУСТАВА У БОЛЬНЫХ ПОЖИЛОГО И СТАРЧЕСКОГО ВОЗРАСТА 14.01.17 - хирургия 14.01.15 – травматология и ортопедия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Санкт-Петербург 2013 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Северо-Западный государственный медицинский университет им....»

«Мажаева Татьяна Васильевна ГИГИЕНИЧЕСКАЯ ОЦЕНКА ФАКТИЧЕСКОГО ПИТАНИЯ И ПОКАЗАТЕЛЕЙ ЗДОРОВЬЯ ДЕТЕЙ, ПРОЖИВАЮЩИХ НА ЭКОЛОГИЧЕСКИ НЕБЛАГОПОЛУЧНЫХ ТЕРРИТОРИЯХ СВЕРДЛОВСКОЙ ОБЛАСТИ (НА ПРИМЕРЕ Г. КРАСНОУРАЛЬСКА) 14.02.01 – гигиена АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Кемерово – 2011 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Кемеровская государственная медицинская...»

«Белопасова Анастасия Владимировна ФУНКЦИОНАЛЬНАЯ РЕОРГАНИЗАЦИЯ РЕЧЕВОЙ СИСТЕМЫ У БОЛЬНЫХ С ПОСТИНСУЛЬТНОЙ АФАЗИЕЙ Специальность 14.01.11 – нервные болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва 2012 Работа выполнена в Федеральном государственном бюджетном учреждении Научный центр неврологии Российской академии медицинских наук Научные руководитель: Доктор медицинских наук, профессор Кадыков Альберт Серафимович Научный консультант...»

«Дмитриева Людмила аркадьевна роЛь иммунных и энДокринных механизмов в патогенезе ДиспЛастического коксартроза и закономерности их изменений при энДопротезировании тазобеДренного сустава 14.00.16 – патологическая физиология автореферат диссертации на соискание ученой степени доктора медицинских наук Чита – 2009 Работа выполнена в Научном центре реконструктивной и восстановительной хирургии Сибирского отделения Российской академии медицинских наук. научный консультант:...»

«Букия Илона Ревазиевна Турбулентность ритма сердца и альтернация зубца Т у больных с гипертрофией миокарда различного генеза 14.01.05 – кардиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук МОСКВА – 2014 Работа выполнена в ГБОУ ВПО Первый Московский государственный медицинский университет имени И.М. Сеченова Минздрава России Научный руководитель : доктор медицинских наук, профессор Сулимов Виталий Андреевич Официальные оппоненты : доктор...»

«Кузнецова Юлия Николаевна МЕДИКО-СОЦИАЛЬНЫЕ АСПЕКТЫ ИНФЕКЦИЙ, ПЕРЕДАВАЕМЫХ ПОЛОВЫМ ПУТЕМ, В ПЕРИОД ФОРМИРОВАНИЯ РЕПРОДУКТИВНОГО ЗДОРОВЬЯ: АЛГОРИТМЫ ДИАГНОСТИКИ, ДИФФЕРЕНЦИРОВАННОЙ ТЕРАПИИ И ПРОФИЛАКТИКИ 14.01.10 - кожные и венерические болезни Автореферат диссертации на соискание ученой степени доктора медицинских наук Екатеринбург, 2013 Работа выполнена в научном клиническом отделе сифилидологии и инфекций, передаваемых половым путем, Федерального государственного бюджетного...»

«КОПЫЛОВА НАТАЛЬЯ СЕРГЕЕВНА Эхокардиографическая оценка функционального состояния миокарда и корня аорты у больных с аневризмой восходящей аорты до и в ранние сроки после операции 14.00.19-лучевая диагностика, лучевая терапия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2009 2 Диссертационная работа выполнена в Учреждении Российской академии медицинских наук Научном Центре сердечно-сосудистой хирургии им. А. Н. Бакулева РАМН НАУЧНЫЕ...»

«Киладзе Иракли Зурабович АОРТОКОРОНАРНОЕ ШУНТИРОВАНИЕ БЕЗ ИСКУССТВЕННОГО КРОВООБРАЩЕНИЯ ПРИ КОМОРБИДНЫХ ЗАБОЛЕВАНИЯХ 14.01.26 сердечно-сосудистая хирургия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Российский научный цент хирургии имени академика Б.В. Петровского РАМН. Научный руководитель : Доктор медицинских наук, профессор Жбанов Игорь Викторович Официальные...»

«ТЮРИКОВ Юрий Михайлович РАЗРАБОТКА ПРЕПАРАТА ИММУНОГЛОБУЛИНА ДЛЯ ВНУТРИВЕННОГО ВВЕДЕНИЯ И ИСПОЛЬЗОВАНИЕ ЕГО ДЛЯ ТЕРАПИИ ИММУНОДЕФИЦИТНЫХ СОСТОЯНИЙ 14.00.36. – аллергология и иммунология 14.00.29. – гематология и переливание крови Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2008 Работа выполнена в Федеральном государственном учреждении науки Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н....»

«К О Ж Е К И Н А НАТАЛЬЯ ВЛАДИМИРОВНА МЕДИКО-СОЦИАЛЬНЫЕ ОСОБЕННОСТИ ЗАБОЛЕВАЕМОСТИ И СМЕРТНОСТИ ОТ ТУБЕРКУЛЕЗА У ЖЕНЩИН ФЕРТИЛЬНОГО ВОЗРАСТА 14.02.03 - общественное здоровье и здравоохранение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва, 2011 г. 0 Работа выполнена в Федеральном государственном учреждении Центральный научно-исследовательский институт организации и информатизации здравоохранения Росздрава Научный руководитель : доктор...»

«ЗАКИРОВА Александра Рустамовна АРТРОСКОПИЧЕСКОЕ ЛЕЧЕНИЕ ХРЯЩЕВЫХ ДЕФЕКТОВ КОЛЕННОГО СУСТАВА (КЛИНИЧЕСКОЕ ИССЛЕДОВАНИЕ) 14.01.15 – травматология и ортопедия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2010 2 Работа выполнена на кафедре травматологии и ортопедии Российского Университета дружбы народов на базе Городской клинической больницы №31 Научный руководитель : Доктор медицинских наук, профессор кафедры травматологии и ортопедии...»








 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.