WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

1

На правах рукописи

Гапонова Татьяна Владимировна

Экспрессия опухолеассоциированных генов PRAME, WT1

и XIAP у больных множественной миеломой в процессе

интенсивной терапии и аутотрансплантации.

14.01.21 – Гематология и переливание крови

Автореферат

диссертации на соискание ученой степени

кандидата медицинских наук

Москва 2011 2

Работа выполнена в Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации.

Научные руководители:

Доктор медицинских наук Менделеева Лариса Павловна Кандидат биологических наук Мисюрин Андрей Витальевич

Официальные оппоненты:

Доктор медицинских наук, профессор А.А.Масчан Доктор медицинских наук, профессор А.К. Голенков Ведущее научное учреждение:

ФГУ Московский Научно-Исследовательский Онкологический институт им.

П.А.Герцена Министерства здравоохранения и социального развития Российской Федерации.

Защита состоится«28» сентября 2011г в 14 часов.

на заседании Диссертационного Совета Д 208.135.01 при Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации по адресу: 125167, Москва, Ново-Зыковский проезд, д.4.

С диссертацией можно ознакомиться в библиотеке при Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации.

Автореферат разослан «» августа 2011г.

Ученый секретарь диссертационного совета, кандидат медицинских наук Е.Е.Зыбунова

Общая характеристика работы

.

Актуальность темы.

Внедрение в клиническую практику программ высокодозной химиотерапии множественной миеломы (ММ) в конце 80-х гг XX века позволило значительно оптимизировать результаты лечения. Так, интенсивная индукция на ранних этапах лечения с последующей высокодозной консолидацией, включающей трансплантацию аутологичных гемопоэтических стволовых клеток (ауто ТГСК), обеспечивает достижение не только клиникогематологической, но и иммунохимической ремиссии у значительного числа пациентов.





Полные ремиссии (ПР) достигаются у 24-75% больных ММ, получающих соответствующую терапию, достаточный опухолевый ответ, включающий полные и частичные ремиссии - у 75- 95%. При этом медиана сохранения стойкого противоопухолевого эффекта после аутотрансплантации составляет 24-35 мес., а 5-летний период без признаков прогрессии заболевания переживают от 10 до 30% больных.[Barlogie B., Jagannath S., Desican K.R. Total Therapy with Tandem Transplants for Newly Diagnsed Multiple Myeloma. Blood 1999; 93: 55-65] Следующий, качественно новый этап в лечении ММ обусловлен внедрением в клиническую практику таких лекарственных препаратов, как ингибиторы протеасом (бортезомиб) и иммуномодуляторы (талидомид, леналидомид).

Сочетание препаратов, воздействующих на молекулярные механизмы миеломной клетки, дальнейшая высокодозная консолидация позволяют достичь существенного улучшения результатов лечения. Так, применение комплексного леченя по программе «Тотальная терапия – III» с включением в схему индукции бортезомиба и талидомида/леналидамида позволило группе исследователей из Университетского госпиталя Арканзаса добиться 56% безрецидивной выживаемости в течение 2-х лет после завершения лечения. Тем не менее, ММ является пока еще биологически неизлечимым заболеванием. Резистентность опухолевого процесса к адекватному терапевтическому воздействию, некурабельный рецидив болезни, выход опухоли из-под химиотерапевтического контроля - все это лежит в основе так называемых неудач в лечении.

В основе опухолевого роста и формирования механизмов лекарственной резистентности, как правило, лежит нестабильность генома опухоли. [Burington B., Barlogie B., Zhan F., et al. Tumor cell Gene expression changes following Short-term in vivo exposure to single agent chemotherapeutics are related to survival in Multipal Myeloma. Clin Cancer Res 2008; 14(15). 4821 – 4829] Последовательность случайных генетических событий в опухолевых клетках, в совокупности приводящая к нарушению процессов дифференцировки клеток и бесконтрольному делению вследствие блокирования апоптоза, обусловливает прогрессирующее течение опухолевого заболевания. В регуляции механизма программированной гибели клеток принимает участие большое число как апоптотических, так и антиапоптотических белков и, в конечном счете, их соотношение предопределяет:

будет клетка жить или погибнет.[Leilst M., Jttel M. Four deaths and funeral: from caspases to alternative mechanisms. Nature Reviews Molecular Cell Biology 2001; 2:

589-598] гемопоэтических клетках была обнаружена аномальная экспрессия ряда генов, получивших общее название С/Т (cancer/testis), так как в норме их транскрипция присуща главным образом клеткам семенников. [Valeria C. С. Andrade, Vettore A.

L., et al. Prognostic impact of cancer/testis antigen expression in advanced stage multiple myeloma patients. Cancer Immunity 2008; 8: 2-10] Одним из представителей данного семейства, часто экспрессирующимся при онкогематологических заболеваниях, является ген PRAME, обладающий антиапоптотическим действием и являющийся устойчивым коингибитором ядерных рецепторов семейства RAR. [Matsushita M., Yamazaki R., Ikeda H. et al. Preferentally expressed antigen of Melanoma (PRAME) in the development of diagnostic and therapeutic metods for hematological malignacies.





Leukemia&Lymphoma 2003; 44(3): 439-444] Кроме того, известен целый ряд так называемых опухолеассоциированных генов, принимающих участие в механизмах регулирования клеточного цикла и клеточной дифференцировки. Среди них отмечен ген WT1, вследствие мутации приобретающий свойства доминантного онкогена. [Hatta Y, Takeuchi T, Saitoh T et al. WT1 expression level and clinical factors in multiple myeloma. J Exp Clin Cancer Res 2005, 24: 595-599] ингибиторов апоптоза IAP. Экспрессия XIAP определяется во всех клетках здоровых людей, гиперэкспрессия гена часто обнаруживается в опухолевых клетках. [Silke J., Ekert P.G., Day C.L. et al. Direct inhibitor of caspase 3 is dispensable for the anti-apoptotic activity of XIAP. The EMBO Jornal. 2001; 20(12): 3114-3123] В течение последнего времени был опубликован ряд работ, показавших возможность использования указанных генов в качестве маркеров опухолевого клона при острых лейкозах. В некоторых исследованиях было также обнаружено, резистентностью опухоли к проводимой химиотерапии. Учитывая достаточно частую экспрессию указанных генов при ММ (от 30% до 60% по литературным данным), несомненный интерес представляет изучение роли указанных генов в формировании опухолевого фенотипа и их возможное прогностическое значение в определении особенностей течения заболевания и чувствительности ММ к проводимому лечению.

Цель исследования - определить экспрессию генов PRAME, WT1 и XIAP у больных множественной миеломой в дебюте заболевания и в процессе интенсивной терапии как факторов прогноза течения заболевания.

Задачи исследования:

Изучить экспрессию PRAME, WT1 и XIAP у первичных больных множественной миеломой.

Проанализировать изменение экспрессии генов на фоне индукционной химиотерапии по схеме VAD и терапии биологическими препаратами направленного действия (бортезомиб).

консолидации с последующей аутотрансплантацией.

Выявить закономерности экспрессии генов PRAME, WT1 и XIAP, определяющие результаты лечения цитостатическими и биологическими препаратами направленного действия (ингибитор протеасом).

Определить параметры экспрессии опухолеассоциированных генов, влияющие на безрецидивную выживаемость после аутотрансплантации.

Научная новизна.

Установлена частота экспрессии и гиперэкспрессии опухолеассоциированных генов PRAME, WT1 и XIAP у первичных больных множественной миеломой.

Выявлена корреляция между выраженностью экспрессии опухолеассоциированных генов и достижением ответа на индукционную терапию.

Выявлено снижение уровней экспрессии генов PRAME и WT1 по мере уменьшения опухолевой массы в результате индукционной полихимиотерапии.

Обнаружено повышение уровня экспрессии гена–ингибитора апоптоза XIAP у больных множественной миеломой во время проведения индукционной химиотерапии по схеме VAD, в большей степени у пациентов с резистентной формой заболевания.

Отмечено, что исходная гиперэкспрессия XIAP не является фактором неблагоприятного прогноза в отношении проведения индукционной терапии бортезомибом, в то время как при стандартной химиотерапии гиперэкспрессия этого гена коррелирует со снижением частоты общего ответа на лечение.

Установлена возможность использования показателя экспрессии генов PRAME множественной миеломой.

Научно-практическая ценность работы.

Разработаны методы детекции экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP с помощью полимеразной цепной реакции в реальном времени.

Показана целесообразность использования показателей экспрессии генов PRAME и WT в качестве молекулярных маркеров опухоли у больных множественной миеломой.

Определено, что исходная гиперэкспрессия генов PRAME, WT и XIAP, является фактором, свидетельствующим о целесообразности проведения индукционной терапии препаратом бортезомиб.

Положения, выносимые на защиту.

У больных множественной миеломой в дебюте заболевания экспрессия опухолеассоциированных генов PRAME, WT1 выявляется более, чем в 60% и 20% случаев, соответственно.

Ген-ингибитор апоптоза XIAP гиперэкспрессируется более чем у 70% первичных больных множественной миеломой.

Выраженный противоопухолевый ответ, достигнутый в результате индукционной терапии, сопровождается снижением уровня экспрессии опухолеассоциированных генов.

Опухолеассоциированные гены PRAME, WT1 могут быть использованы в качестве маркеров минимальной остаточной болезни у больных множественной миеломой.

Публикации.

По материалам диссертации опубликовано 8 научных трудов, в том числе в изданиях, рекомендованных ВАК - 4.

Апробация диссертации.

Основные положения работы доложены на Московской международной конференции “Лейкозы. Терапия и фундоментальные исследования” (Москва, 2008г), Международной конференции “Трансплантация гемопоэтических стволовых клеток у взрослых и детей” (Санкт- Петербург, 2008г).

Объем и структура работы.

Диссертация изложена на 143 страницах, состоит из введения, обзора литературы, методической главы, двух глав собственных результатаов, заключения, выводов, указателя литературы. Работа иллюстрирована 18 таблицами и 9 рисунками. Список использованной литературы включает 169 источников, из них 12 отечественных и 157 зарубежных.

Диссертация носила клинико-лабораторный характер и была выполнена в отделении высокодозной химиотерапии и трансплантации костного мозга (руководитель д.м.н. Е.Н.Паровичникова), и лаборатории генной инженерии (Генеральный директор член-корр РАМН, д.м.н., профессор В.Г.Савченко).

проспективного исследования экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP в клетках костного мозга у 45 больных множественной миеломой. Все больные наблюдались в отделении высокодозной химиотерапии и трансплантации костного мозга (руководитель д.м.н. Е.Н.Паровичникова) в период с 2006 по 2009гг. Диагностика и оценка противоопухолевого эффекта основывались на современных критериях, разработанных Международной рабочей группой по миеломе. Среди включенных в исследование больных было 26 мужчин и женщин в возрасте от 28 до 68 лет; со II (55,5%) или III (44,5%) стадией заболевания. У 36 больных была диагностирована миелома G, у 2 - А, у 5 - BJ, а так же по одному случаю миелома D и М.

В исследованной группе пациентов индукционная терапия проводилась по трем схемам: у 28 больных индукция включала 3-4 курса полихимиотерапии VAD химиочувствительностью опухоли к курсам VAD, в индукционную программу дополнительно включали 4-8 курсов бортезомиб+ дексаметазон +/- адриабластин.

Терапия бортезомибом, в качестве препарата второй линии, проведена пациентам. У других 15 больных в качестве индукционной терапии уже на начальных этапах, применялась схема бортезомиб + дексаметазон +/- адриабластин в количестве 4-8 курсов. Далее проводилась мобилизация и сбор гемопоэтических стволовых клеток крови (СКК) по схеме циклофосфан 4-6г/м2+ гранулоцитарный колониестимулирующий фактор. Затем выполненяли однократную или двойную трансплантацию аутологичных гемопоэтических стволовых клеток (аутоТГСК), в качестве предтрансплантационного кондиционирования были использованы высокие дозы мелфалана (200мг/м2).

Методы исследования. Молекулярное исследование клеток костного мозга методом полимеразной цепной реакции (ПЦР) в реальном времени выполнялось в лаборатории генной инженерии (заведующий к.б.н. А.В.Мисюрин). Экспрессия опухолеассоциированных генов была изучена в 255 образцах костного мозга больных ММ. В каждой пробе была проанализирована экспрессия трех опухолеассоциированных генов PRAME, WT1, XIAP и контрольного гена ABL.

Таким образом, реакция ПЦР в реальном времени была выполнена на 1020 пробах.

Исследования проводились в следующие сроки: у 45 больных в момент диагностики, до начала терапии; после индукционных курсов химиотерапии по программе VAD у 28 пациентов, после назначения бортезомиба в качестве препарата первой линии у 15 больных. На этапе консолидации ремиссии, а именно до и после выполнения аутоТГСК, экспрессия опухолеассоциированных генов изучена у 9 больных. У 8 пациентов ПЦР выполнялась в посттрансплантационном периоде неоднократно, в течение от 1 до 12 месяцев, и у 2 больных анализ экспрессии генов проводился в момент рецидива заболевания. Число проведенных исследований у каждого больного составило от 1 до 8, медиана 2. В качестве контроля экспрессия опухолеассоциированных генов изучена в клетках костного мозга 8 здоровых доноров.

Выделение тотальной мРНК из клеток костного мозга пациентов с ММ и доноров проводилось по методу Chomczynski. Для постановки реакции обратной транскрипции к раствору РНК (1мкг) добавляли 2мкл гексамеров (концентрация 110пМ) и проводили отжиг 30сек при 95°С. Далее осуществляли реакцию в растворе, содержащем 75мМ KCl, 50мМ Трис, 10мМ DTT, 3мМ MgCl2, 1мМ каждого из четырех дезоксирибонуклеотидов, 20ед. ингибитора РНКаз (Promega), 100ед. обратной транскриптазы M-MLV (Promega) в течение 1-1,5 часов при 37°С.

Объем реакционной смеси составлял 20мкл.

проводилось методом ПЦР в реальном времени по технологии TaqMan. Для проведения реакции использовался прибор ICycler IQ (BioRad).

Экспрессия генов PRAME, WT1, XIAP и ABL определялась в числе копий мРНК соответствующего гена. В качестве положительного контроля использовались плазмиды pGEM-T, содержащие клонированные фрагменты этих генов. На основании серии разведений плазмиды в каждом эксперименте строилась калибровочная кривая, по которой определялось число копий гена в исследуемых образцах. Серия разведений плазмиды представляла собой последовательность 10кратных разведений, использовались разведения от 107 до 103 копий в 1 мкл.

Нуклеотидные последовательности праймеров и зондов.

PRAME-F GAC TCT TTA TTT TTT CCT TAG A PRAME

PRAME-R CGA AAG CCG GCA GTT AGT TAT T

PRAME-probe FAM- CTG GAT CAG (T-RTQ1)TG CTC AGG CAC GTG A

WT1-F CAGGCTGCAATAAGAGATATTTTAAGCT WT

WT1-R GAA GTC ACA CTG GTA TGG TTT CTC A

WT1-probe FAM-CTT ACA GAT GCA CAG CAG GAA GCA CAC TG BHQ

XIAP-F ACT TGA GGA GTG TCT GGT AA XIAP

XIAP-R GGA TTT TGG AAG ATG GTA TCA TC

XIAP-probe FAM AAC TAC (T-BHQ)GA GAA AAC ACC ATC ACT AAC TAG AAG AA p

ABL-F AGC TCC GGG TCT TAG GCT AT ABL

ABL-R TAG TTG CTT GGG ACC CAG CC

ABL-probe Fam CCA TT(T-RTQ1) TTG GTT TGG GCT TCA CAC CAT Tp Для каждого образца, в том числе и для разведений плазмид, ПЦР-реакция проводилась в трех повторах. В качестве гена сравнения использовался ген ABL.

Для каждой тройки образцов рассчитывалась средняя экспрессия гена. Система праймеров и зондов была разработана в лаборатории генной инженерии ГНЦ РАМН в 2002году. Нуклеотидные последовательности праймеров и зондов представлены в таблице 1.

Окончательный результат относительной экспрессии генов выражался в виде нормированных процентов по формуле:

Число копий гена (PRAME,WT1, XIAP) Число копий ABL Статистическая обработка данных проводилась методами описательной статистики, анализом таблиц сопряженности (Критерий хи-квадрат Пирсона) и корреляционного анализа (коэффициент корреляции Спирмена). Обработка данных

BIOSTAT

Copyright©1998 McGraw Hill.

опухолеассоциированных генов оценивалась посредством построения кривых безрецидивной выживаемости с использованием метода Каплан-Майер (программа Stat View).

Экспрессия опухолеассоциированных генов PRAME, WT1 и XIAP у первичных больных множественной миеломой.

Изучение экcпрессии генов PRAME, WT1 и XIAP в клетках костного мозга у 45 первичных больных множественной миеломой в момент диагностики показало, что экспрессия гена PRAME выявлялась у 31 больного (68,9%). Экспрессия гена WT1 была обнаружена у 11 пациентов (24,4%), причем оказалось, что WT определялся только у PRAME-позитивных больных. Экспрессия гена XIAP была выявлена у всех первичных больных ММ (достоверно чаще, чем у доноров р=0,00239, точный критерий Фишера).

Экспресcия генов PRAME, WT1 и XIAP у первичных больных ММ и доноров

PRAME WT1 XIAP

(нормированные %) (нормированные %) экспрессия опухолеассоциированных генов выявляется и у здоровых лиц, однако наблюдается несколько реже, чем у больных ММ. Так экспрессия PRAME была обнаружена у 4 из 8 человек (50%), WT1 экспрессировался лишь у 1 донора (12,5%), а экспрессия гена XIAP выявлялась в 5 случаях (62,5%). (Таблица 2) При анализе диапазона значений экспрессии опухолеассоциированных генов было отмечено, что минимальные показатели экспрессии у больных и доноров были одинаковы, в то время как максимальные значения экспрессии в группе пациентов и значительно превышали таковые в контрольной группе. Так, для гена PRAME разброс значений колебался от 0% до 132%, для WT1 - от 0% до 2,54%, для XIAP – от 4% до 606%. В связи с этим, для дальнейшего анализа больные были разделены на группы с низкой экспрессией опухолеассоциированных генов (или полным ее отсутствием) и высокой экспрессией, превышавшей условную норму, вычисленную по результатам обследования здоровых доноров.

Таким образом, по результатам нашего исследования было выявлено, что опухолеассоциированный ген PRAME экспрессируется почти у 70% больных с впервые выявленной ММ. При этом у каждого второго из этих пациентов количественные показатели свидетельствуют о гиперэкспрессии гена. Экспрессия гена-ингибитора апоптоза XIAP определялась у всех больных ММ, и у 75,5% из них в виде гиперэкспрессии. Экспрессия гена WT1 была обнаружена у каждого четвертого пациента с ММ, уровень экспрессии данного маркера был выше контрольных значений у всех WT1-положительных пациентов.

Принимая во внимание широкий диапазон количественных показателей экспрессии гена PRAME и особенно гена XIAP у больных ММ в момент диагностики заболевания нами был проведен сравнительный анализ, направленный на определение зависимости результатов противоопухолевой терапии от наличия исходной гиперэкспрессии опухолеассоциированных генов. Пациенты были разделены на группы в соответствии с тем, превышали или нет указанные показатели значения, выявленные у доноров костного мозга и условно принятые за норму. Таким образом, были выделены две группы больных: с гиперэкспрессией исследуемых генов, а также с экспрессией, не превышающей значения, обнаруженные у доноров или с полным отсутствием экспрессии.

Противоопухолевый ответ на химиотерапию по схеме VAD в зависимости от экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP.

Индукционная терапия по схеме VAD была выполнена 28 больным ММ.

Число курсов составляло от 1 до 4. В результате проведенного лечения у 4 больных была констатирована полная ремиссия (ПР), еще у 4 пациентов – очень хорошая частичная ремиссия (охЧР), у 10 больных удалось достичь частичной ремиссии (ЧР). У других 10 пациентов отмечался лишь минимальный ответ (МО) или наблюдалась резистентность опухоли к проводимой терапии.

Для оценки взаимосвязи химиочувствительности опухоли с экспрессией опухолеассоциированных генов нами были предприняты сопоставления результатов терапии по схеме VAD в зависимости от качественных характеристик экспрессии генов PRAME, WT1 и XIAP.

Частота противоопухолевого ответа после терапии VAD в зависимости от Из результатов, представленных в таблице 3, видно, что в группе больных с нормальной исходной экспрессией генов PRAME и WT1 почти вдвое чаще удавалось достичь ПР и охЧР, чем у больных с исходной гиперэкспрессией этих генов (35,3% против 18% для PRAME и 30,4% против 20% для WT1). При этом частота достижения значимого противоопухолевого ответа (ПР+ охЧР +ЧР) в группе больных с нормальной экспрессией генов PRAME и WT1 составляет 70,6% и 69,5%, соответственно, в то время как в группе больных с гиперэкспрессией этих маркеров общий ответ не превышает 54,4% и 40%, соответственно.

При исследовании уровней экспрессии гена XIAP мы исходили из предположения, что повышение показателей экспрессии этого гена-ингибитора апоптоза может ассоциироваться с развитием резистентности опухоли к химиотерапии. При сопоставлении результатов терапии в зависимости от выраженности исходной экспрессии XIAP оказалось, что частота достижения ПР + охЧР у больных с нормальной и гиперэкспрессией этого гена была практически одинаковой и составляла 28,6%. Однако, при анализе частоты достижения общего ответа (ПР+ охЧР +ЧР) выявлено, что в группе больных с нормальной экспрессией XIAP этот показатель (85,8%) превышает почти на треть таковой в группе больных с гиперэкспрессией (57%).

Противоопухолевый ответ после индукционной терапии ингибитором протеасом (бортезомибом) в качестве препарата I линии в зависимости от экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP.

Индукционная терапия с использованием биологического препарата направленного действия – бортезомиба в качестве препарата первой линии проводилась 15 пациентам ММ. Число курсов бортезомиб+дексаметазон+/доксорубицин составляло от 4 до 8. В результате лечения у 1 больной была достигнута ПР, у 5 пациентов - охЧР, у 7 больных удалось достичь ЧР и у пациентов эффект был выражен лишь в пределах МО.

Результаты представленные в таблице 4 свидетельствуют о том, что в группе больных с нормальной исходной экспрессией генов PRAME и WT1 в результате терапии бортезомибом удавалось чаще достичь ПР+охЧР, чем у больных с гиперэкспрессией этих генов (66,7% против 16,6% для PRAME и 54,5% против 25% для WT1). Однако при анализе общего противоопухолевого ответа (ПР+охЧР+ЧР) оказалось, что частота достижения значимого лечебного эффекта не зависит от величины исходной экспрессии генов PRAME и WT1 (88,9% при нормальной экспрессии PRAME против 83,4% при гиперэкспрессии и 81,7% при нормальной экспрессии WT1 против 100% при гиперэкспрессии).

Частота противоопухолевого ответа после терапии бортезомибом в качестве препарата I линии в зависимости от исходной экспрессии генов.

Уровень исходной экспрессии, Частота ПР+охЧР Частота ПР+охЧР+ЧР Gen/ABL*100% Сопоставление результатов терапии в зависимости от исходной экспрессии гена XIAP затруднено из-за крайней малочисленности группы с низкой экспрессией этого гена. Нормальный уровень экспрессии XIAP был зафиксирован лишь у одного больного, в результате индукционной терапии бортезомибом у него была достигнута охЧР. В группе пациентов с гиперэкспрессией XIAP частота полных и очень хороших частичных ремиссий составила 42,8%, а общий ответ был достигнут у 85,6% больных.

Отметив снижение частоты достижения противоопухолевого ответа на индукционную терапию в группах пациентов с исходной гиперэкспрессией опухолеассоциированных генов PRAME, WT1 и XIAP, был проведен сравнительный химиотерапии по схеме VAD и терапии с использованием биологического препарата направленного действия (бортезомиба). (таблица 5) Частота противоопухолевого ответа у больных с гиперэкспрессией PRAME, WT1 и XIAP в дебюте ММ зависимости от программы индукции.

Из представленных в таблице 5 данных следует, что у пациентов ММ с исходной гиперэкспресией опухолеассоциированных генов PRAME, WT1 и XIAP, назначение индукционной терапии бортезомибом, позволяет увеличить число общих ответов на лечение (ПР+охЧР+ЧР) по сравнению со стандартной химиотерапией по схеме VAD. Полученные данные позволяют сделать вывод о том, что пациентам с исходной гиперэкспрессией опухолеассоциированных генов предпочтительнее назначать бортезомибсодержащие курсы уже на первых этапах индукционного лечения.

Противоопухолевый ответ после индукционной терапии ингибитором протеасом (бортезомибом) в качестве препарата II линии в зависимости от экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP.

Терапия с использованием биологического препарата направленного действия – бортезомиба в качестве препарата второй линии проводилась пациентам ММ. Большей части больных (n=12) данное лечение было назначено в связи с недостаточным ответом на индукционную терапию по схеме VAD в объеме от 1 до 4 курсов. Число курсов бортезомиб+дексаметазон+/-адриабластин составляло от 4 до 8 (медиана 6). При этом бортезомибсодержащие схемы назначали на фоне ЧР – 8 больным, МО – 3 больным и на фоне резистентности к VAD-терапии – одному больному. Еще одному пациенту терапия второй линии бортезомибом выполнялась для лечения рецидива, выявленного после второй аутологичной трансплантации. Таким образом, в данную группу были включены пациенты с наиболее неблагоприятным течением заболевания.

В результате лечения у 2 больных была достигнута ПР, у 5 пациентов - охЧР, у 1 больной удалось достичь ЧР, еще у одной пациентки отмечалась стабилизация заболевания (противоопухолевый ответ сохранялся по-прежнему в пределах ЧР), у 4 пациентов отмечалась прогрессия опухоли на фоне проводимого лечения. Можно сделать вывод, что применение препарата бортезомиб в качестве второй линии терапии позволило привнести дополнительный противоопухолевый эффект у 8 из 13 больных. Для оценки возможного влияния исходного уровня экспрессии опухолеассоциированных генов на результаты терапии бортезомибом в качестве терапии второй линии были предприняты следующие сопоставления. (таблица 6) Из представленных в таблице 6 данных видно, что наименьший противоопухолевый ответ на терапию бортезомибом в качестве препарата второй линии, был достигнут у больных с исходной гиперэкспрессией гена PRAME (частота достижения ПР+охЧР 25% против 66,6%, а общих ответов 50% против 77,7%). На основании полученных данных можно предположить, что совокупность двух факторов: гиперэкспрессия гена PRAME, выявленная в момент диагностики ММ, и отсутствие противоопухолевого ответа на индукционную VAD-терапию, определяет группу пациентов высокого риска в отношении неэффективности терапии бортезомибом, применяемым в качестве препарата второй линии.

Частота противоопухолевого ответа после терапии бортезомибом (II линия) в Уровень исходной экспрессии, Частота ПР+охЧР Частота ПР+охЧР+ЧР Gen/ABL*100% Что касается группы пациентов с исходной гиперэкспрессией гена XIAP, то полученные данные подтверждают предыдущее предположение о том, что гиперэкспрессия этого гена не является неблагоприятным прогностическим фактором в отношении эффективности терапии бортезомибом: в результате лечения более чем у 70% больных этой группы была достигнута ПР+охЧР. Можно бортезомибсодержащих курсов.

Экспрессия опухолеассоциированных генов PRAME, WT1 и XIAP на фоне высокодозной химиотерапии мелфаланом с последующей аутоТГСКК.

Уровень экспрессии опухолеассоциированных генов в течение этапа консолидации, то есть выполнения однократной или двойной трансплантации аутологичных стволовых клеток, был исследован у 9 пациентов. Следует отметить, что все эти пациенты уже на момент проведения мобилизации и сбора стволовых кроветворных клеток находились в состоянии полной или очень хорошей частичной ремиссии, которая сохранялась к моменту выполнения трансплантации.

Несмотря на небольшое количество обследованных больных, нам удалось отметить некоторые тенденции в изменении экспрессии генов в зависимости от продолжительности ремиссии после трансплантации. Пациенты были разделены на две группы. В первую группу включены 7 больных, которые сохраняли ремиссию в течение 25 36 месяцев (медиана наблюдения 26,5 месяцев) после аутотрансплантации. Во вторую группу были отнесены двое пациентов, у которых был зафиксирован рецидив заболевания через 9 и14 месяцев после трансплантации.

Наиболее яркие различия экспрессии опухолеассоциированных генов среди пациентов исследованных двух групп были отмечены в отношении экспрессии гена PRAME.

При анализе экспрессии данного маркера в группе больных с устойчивой продолжительной ремиссией было отмечено, что как перед трансплантацией, так и через месяц после трансплантации экспрессия PRAME не превышала нормальных значений (медиана показателя экспрессии до ауто ТГСКК-0,001%, на +30день- 0%).

Показатели экспрессии опухолеассоциированных генов в зависимости от длительности сохранения ремиссии после трансплантации.

опухолеассоциированных генов мес после аутодень через 9-14мес В малочисленной группе пациентов, утративших противоопухолевый ответ в течение 9 – 14 месяцев после завершения трансплантаионной терапии, как до так и после трансплантации отмечалась гиперэкспрессия гена PRAME. Минимальные показатели экспрессии (0,33%) значительно превышали таковые у доноров, а медиана экспрессии определялась на уровне 3,215%, что в 1000 раз превышало медиану экспрессии у доноров. После трансплантации значения экспрессии гена PRAME еще более возросли, достигая уровня 5,44 -13,2%. Таким образом, у двух больных с гиперэкспессией гена PRAME перед аутоТГСК был зафиксирован рецидив заболевания. Небольшое количество обследованных больных не позволяет сделать статистически значимых выводов, однако можно предполагать, что гиперэкспрессия гена PRAME, выявленная у больных перед трансплантацией, формирование лекарственной резистентности.

Для анализа динамического изменения экспрессии опухолеассоциированных генов PRAME, WT1 и XIAP в процессе интенсивной терапии ММ была подробно изучена наиболее благоприятная группа пациентов с длительной безрецидивной выживаемостью после аутоТГСК.

Изменение экспрессии генов PRAME, WT1 и XIAP на фоне терапии у больных (n=7) с продолжительной безрецидивной выживаемостью после PRAME WT Gene/abl*100 (мед) XIAP Gene/abl*100(мед) Из представленных в таблице 8 данных видно, что исходные характеристики выживаемостью после аутоТГСК существенно не отличались от таковых в общей группе пациентов. Однако отмечено, что уже после окончания индукционной терапии ни у одного больного не выявлялась гиперэкспрессия гена PRAME и данные параметры сохранялись все время наблюдения (р=0,05). Медиана экспрессии PRAME снижалась в процессе эффективного лечения с 0,05% до 0%.

Таким образом, нами была выявлена взаимосвязь уровня экспрессии гена PRAME как исходного, так и снижающегося после индукционной терапии с возможностью достижения выраженного противоопухолевого эффекта. Возможным объяснением этой взаимосвязи может рассматриваться значительное снижение массы опухоли в результате индукционной терапии, что и сопровождается снижением уровня экспрессии опухолеассоциированного гена. Безусловно, в данном контексте, ген PRAME может выступать как маркер миеломных клеток, отражая уменьшение опухолевой массы в процессе индукционной терапии.

Кроме того при анализе динамических изменений экспрессии был констатирован феномен достоверного увеличения частоты и выраженности экспрессии гена WT1. Данное наблюдение трактовать с клинических позиций в настоящее время затруднительно.

Так же отмечено, что показатели экспрессии гена XIAP снижались в результате эффективной терапии: медиана экспрессии соответствовала нормальным значениям уже после окончания индукционной терапии. Однако, после выполнения аутоТГСКК у всех больных выявлялась гиперэкспрессия этого гена. Повышение уровня экспрессии XIAP у пациентов после трансплантации можно объяснить возмущающим воздействием проводимого кондиционирования высокими дозами мелфалана и, как следствие, повышение экспрессии генов, ингибиторов апоптоза всеми, в том числе и здоровыми клетками костного мозга.

Заключение.

Полученные нами данные подтвердили необычайную биологическую гетерогенность множественной миеломы, эволюция которой связана с возникновением огромного количества генетических аберраций на фоне герминально обусловленной вариабельности генотипа хозяина. Одной из характерных черт заболевания является пока мало изученный процесс каскадного гипометилирования ДНК, приводящий к экспрессии целого ряда нехарактерных для данного тканевого типа генов. Комплексное изучение особенностей аберрантной экспрессии опухолеассоциированных генов, накопление сведений, полученных в результате исследовательской работы, вне всякого сомнения, дадут необходимую информацию для дальнейшей классификации множественной миеломы и индивидуального подбора эффективной терапии этого заболевания.

1. У первичных больных ММ экспрессия опухолеассоциированных генов PRAME и WT1 выявляется в 68,9% и 24,4% случаев (соответственно), при этом у 51,5% и 100% из них определяется гиперэкспрессия указанных генов.

2. Экспрессия гена-ингибитора апоптоза XIAP выявлялась достоверно чаще у пациентов ММ, чем у здоровых доноров (p0,05). Гиперэкспрессия на момент диагностики обнаружена у 75,5% больных.

3. Показано, что значимый противоопухолевый ответ на индукционную и высокодозную консолидирующую терапию сопровождается достоверным снижением уровня экспрессии гена PRAME (р=0,05).

4. У больных с исходной гиперэкспрессией гена PRAME частота достижения ПР+охЧР+ЧР увеличивается при использовании ингибитора протеасом в соответственно, р=0,08).

5. Исходная гиперэкспрессии гена XIAP коррелирует с резистентностью к VADхимиотерапии, однако, не ассоциирована с резистентностью к терапии ингибитором протеасом. Частота достижения ПР+охЧР+ЧР увеличивается при использовании ингибитора протеасом в сравнении с химиотерапией по схеме VAD (85,6% против 57%, соответственно, р=0,07).

6. У больных с нормальной экспрессией гена PRAME перед аутоТГСК безрецидивная выживаемость составила 100% при сроке наблюдения от до 36 месяцев.

Список опубликованных работ по теме диссертации:

1. Л.П.Менделеева, О.С.Покровская, Е.О.Грибанова, Т.В.Гапонова, Е.И.Желнова, М.В.Анухина, Е.С.Урнова, Е.Ю.Варламова, Н.Н.Калинин, Е.М.Грецов, В.Г.Савченко. Высокодозная химиотерапия с последующей аутотрансплантацией у пожилых больных множественной миеломой// Клиническая геронтология.-2007.- №4.-С. 20-24.

2. Gaponova T., Misurin A., Mendeleeva L., Varlamova E., Parovichnikova E., Savchenkо V. Expression of tumor associated genes in Multiple Myeloma patients during high dose chemotherapy and therapy of proteosome inhibitors. Haematologica, 2009, vol.94, suppl.2 (

Abstract

book of 14-th Congress of the European Hematology Association, Berlin, Germany, June 4-7, 2009) p609, abst 3. Т.В.Гапонова, Л.П.Менделеева, А.В.Мисюрин, Е.Ю.Варламова, В.Г.Савченко. Экспрессия опухолеассоциированных генов PRAME, WT1 и XIAP у больных множественной миеломой//Онкогематология.-2009.- №2.С. 52-57.

4. Т.В.Гапонова. Современные молекулярно-биологические характеристики множественной миеломы//Гематология и трансфузиология.-2009.-№6.С.38-44.

5. T.V.Gaponova, L.P.Mendeleeva, A.V.Misurin, E.Yu.Varlamova, E.N.Parovichnikova, V.G.Savchenko. Expression of tumor associated genes in Multiple Myeloma patients during high- dose chemotherapy and auto-SCT.

Cellular Therapy and Transplantation, 2009, vol.2, number 5, p.95-96.

6. Т.В. Гапонова, Л.П.Менделеева, А.В.Мисюрин, В.Г.Савченко. Экспрессия генов PRAME, WT1 и XIAP у больных множественной миеломой как фактор прогноза эффективности индукционной терапии//Вестник гематологии.Т.7.- №2.-С.14.

7. Покровская О.С., Менделеева Л.П., Урнова Е.С., Гапонова Т.В., Грибанова Е.О., Алексеева И.В., Дроков М.Ю., Калинин Н.Н., Грецов Е.М., Клясова Г.А., Савченко В.Г. Оптимизация режимов мобилизации гемопоэтических миеломой//Терапевтический архив.-2011.-Т.83.-№7.-С. 50- 8. Pokrovskaya O., Mendeleeva L., Alekseeva I., Gaponova T., Urnova E., Gribanova E., Varlamova E., Kalinin N., Gretsov E., Savchenko V. Treatment of multiple myeloma with autologous stem cell transplantation: a long-term observation. Bone Marrow Transplantation, 2011, vol.46, suppl. 1, (37-th Annual meeting of the European Group for Blood and Marrow Transplantation), p.265, abstr.P906.



 
Похожие работы:

«1 НА ПРАВАХ РУКОПИСИ СЕРЕБРОВА СВЕТЛАНА ЮРЬЕВНА СРАВНИТЕЛЬНАЯ КЛИНИЧЕСКАЯ ФАРМАКОЛОГИЯ СОВРЕМЕННЫХ ИНГИБИТОРОВ ПРОТОННОЙ ПОМПЫ 14.00.25 – Фармакология, клиническая фармакология 14.00.05 – Внутренние болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук МОСКВА 2009 2 Работа выполнена в Московской медицинской академии им. И.М.Сеченова Научные консультанты: Заслуженный деятель науки РФ, Академик РАМН, доктор медицинских наук, профессор Кукес Владимир Григорьевич...»

«ТАЙНИЦКАЯ Эльвира Викторовна СОВРЕМЕННЫЕ ПОДХОДЫ К УЛУЧШЕНИЮ КАЧЕСТВА МЕДИЦИНСКОЙ ПОМОЩИ ДЕТСКОМУ НАСЕЛЕНИЮ НА УРОВНЕ ПЕРВИЧНОГО ЗВЕНА ЗДРАВООХРАНЕНИЯ 14.02.03-Общественное здоровье и здравоохранение Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва-2014 2 Работа выполнена в ФГБУ Центральный НИИ организации и информатизации здравоохранения Министерства здравоохранения Российской Федерации в отделении научных основ организации муниципального...»

«Константинова Ирина Михайловна ОЦЕНКА ВОЗДЕЙСТВИЯ НИЗКОИНТЕНСИВНОГО ЛАЗЕРНОГО ИЗЛУЧЕНИЯ НА ФОРМЕННЫЕ ЭЛЕМЕНТЫ КРОВИ У БОЛЬНЫХ ОСТРЫМ ПИЕЛОНЕФРИТОМ 14.00.40 урология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук. Москва 2009 2 Работа выполнена на кафедре урологии и оперативной нефрологии медицинского факультета ГОУ ВПО Российский университет дружбы народов Научные руководители: доктор медицинских наук, профессор, заведующий кафедрой урологии и...»

«ЛУГАНСКИЙ ВАДИМ АЛЕКСАНДРОВИЧ ОПТИМИЗАЦИЯ КЛИНИКО-ЛАБОРАТОРНЫХ ЭТАПОВ  ПОЛУЧЕНИЯ ОТТИСКОВ ПРИ ПОЛНОМ ОТСУТСТВИИ ЗУБОВ 14.00.21 - стоматология Автореферат  диссертации на соискание ученой степени  кандидата медицинских наук Екатеринбург – 2006 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Уральская государственная медицинская академия Федерального Агентства по здравоохранению и социальному разви-тию...»

«ВОРОНЦОВА НАДЕЖДА АЛЕКСАНДРОВНА СОНОЭЛАСТОГРАФИЯ В ДИАГНОСТИКЕ УРГЕНТНЫХ СОСТОЯНИЙ В ГИНЕКОЛОГИИ 14.01.13 - Лучевая диагностика, лучевая терапия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2014 Работа выполнена в ФГБУ Учебно-научный медицинский центр Управления делами Президента РФ (директор – д.м.н., профессор В.Ф. Казаков). Научный руководитель : доктор медицинских наук, профессор Гажонова Вероника Евгеньевна Официальные оппоненты...»

«Киладзе Иракли Зурабович АОРТОКОРОНАРНОЕ ШУНТИРОВАНИЕ БЕЗ ИСКУССТВЕННОГО КРОВООБРАЩЕНИЯ ПРИ КОМОРБИДНЫХ ЗАБОЛЕВАНИЯХ 14.01.26 сердечно-сосудистая хирургия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Российский научный цент хирургии имени академика Б.В. Петровского РАМН. Научный руководитель : Доктор медицинских наук, профессор Жбанов Игорь Викторович Официальные...»

«Мажаева Татьяна Васильевна ГИГИЕНИЧЕСКАЯ ОЦЕНКА ФАКТИЧЕСКОГО ПИТАНИЯ И ПОКАЗАТЕЛЕЙ ЗДОРОВЬЯ ДЕТЕЙ, ПРОЖИВАЮЩИХ НА ЭКОЛОГИЧЕСКИ НЕБЛАГОПОЛУЧНЫХ ТЕРРИТОРИЯХ СВЕРДЛОВСКОЙ ОБЛАСТИ (НА ПРИМЕРЕ Г. КРАСНОУРАЛЬСКА) 14.02.01 – гигиена АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Кемерово – 2011 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Кемеровская государственная медицинская...»

«Барышникова Ирина Юрьевна КОМПЛЕКСНАЯ ОЦЕНКА КОНТРАКТИЛЬНОЙ И РЕЛАКСАЦИОННОЙ СПОСОБНОСТИ МИОКАРДА У ДЕТЕЙ ПЕРВЫХ ТРЕХ ЛЕТ ЖИЗНИ С ТЕТРАДОЙ ФАЛЛО ДО ОПЕРАЦИИ И В РАННЕМ ПОСЛЕОПЕРАЦИОННОМ ПЕРИОДЕ (14.01.13 – лучевая диагностика, лучевая терапия) Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва – 2011 г. Работа выполнена в Государственном Учреждении Научный Центр сердечно-сосудистой хирургии имени А.Н.Бакулева РАМН. Научные руководители:...»

«Ямилова Гульнара Тимербаевна ФИЗИОТЕРАПЕВТИЧЕСКИЕ ТЕХНОЛОГИИ В МЕДИЦИНСКОЙ РЕАБИЛИТАЦИИ БОЛЬНЫХ С ДИСЦИРКУЛЯТОРНОЙ ЭНЦЕФАЛОПАТИЕЙ 14.03.11. - Восстановительная медицина, спортивная медицина, лечебная физкультура, курортология и физиотерапия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Уфа-2014 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Башкирский государственный медицинский...»

«ЧУМАЧЕК Елена Валерьевна ГИПЕРУРИКЕМИЯ КАК ФАКТОР РИСКА ПОРАЖЕНИЯ ОРГАНОВ-МИШЕНЕЙ И ВОЗМОЖНОСТИ ЕЕ МЕДИКАМЕНТОЗНОЙ КОРРЕКЦИИ У БОЛЬНЫХ С МЕТАБОЛИЧЕСКИМ СИНДРОМОМ 14.01.04 Внутренние болезни Автореферат диссертации на соискание ученой степени кандидата медицинских наук Волгоград - 2013 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный медицинский университет Министерства здравоохранения...»

«ФАТТАХОВ ИЛЬДАР АСЛЯМОВИЧ МЕДИКО-СОЦИАЛЬНЫЕ АСПЕКТЫ СОСТОЯНИЯ ЗДОРОВЬЯ МУЖСКОГО НАСЕЛЕНИЯ В РЕСПУБЛИКЕ БАШКОРТОСТАН 14.02.03 – общественное здоровье и здравоохранение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Оренбург- 2013 Работа выполнена в государственном бюджетном образовательном учреждении высшего профессионального образования Башкирский государственный медицинский университет Министерства здравоохранения Российской Федерации Научный...»

«Саламадина Галина Евгеньевна Органосберегающее лечение миомы матки с использованием метода дистанционной неинвазивной деструкции магнитнорезонансно-контролируемым сфокусированным ультразвуком 14.01.01 – Акушерство и гинекология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2011 Работа выполнена в отделении рентгенорадиологической диагностики, рентгенохирургии и малоинвазивных методов лечения ФГУ Научный центр акушерства, гинекологии и...»

«Бочкарева Наталия Михайловна Особенности течения острых кишечных инфекций у детей с отягощенным преморбидным состоянием. Оптимизация терапевтической тактики 14.01.09 – Инфекционные болезни Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва – 2013 2 Работа выполнена в Государственном бюджетном учреждении здравоохранения Московской области Московский областной научно-исследовательский клинический институт им. М.Ф. Владимирского Научный...»

«Лапина Наталья Валерьевна ТРУБНАЯ БЕРЕМЕННОСТЬ И ЕЁ ПОСЛЕДСТВИЯ 14.00.01 - Акушерство и гинекология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук МОСКВА 2008 2 Работа выполнена на кафедре акушерства и гинекологии с курсом перинатологии ГОУ ВПО Российский университет дружбы народов. Научный руководитель доктор медицинских наук, профессор, заведующий кафедрой акушерства и гинекологии с курсом перинатологии ГОУ ВПО Российский университет дружбы...»

«Саидова Айна Салавдиновна ОПТИМИЗАЦИЯ ЛЕЧЕНИЯ СТРЕССОВОГО И СМЕШАННОГО ТИПОВ НЕДЕРЖАНИЯ МОЧИ У ЖЕНЩИН С ПОМОЩЬЮ ОБЪЕМООБРАЗУЮЩЕГО СРЕДСТВА ДЕКСТРАНОМЕР/ГИАЛУРОНОВОЙ КИСЛОТЫ 14.01.01 акушерство и гинекология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва-2011 Работа выполнена в гинекологическом отделении восстановительного лечения ФГБУ Научный центр акушерства, гинекологии и перинатологии им. академикаВ.И. Кулакова Минздравсоцразвития...»

«АБАКИРОВ МЕДЕТБЕК ДЖУМАБЕКОВИЧ ХИРУРГИЧЕСКОЕ ЛЕЧЕНИЕ ДЕГЕНЕРАТИВНЫХ СТЕНОЗОВ ПОЯСНИЧН0ГО ОТДЕЛА ПОЗВОНОЧНИКА 14.01.15 – травматология и ортопедия Автореферат на соискание ученой степени доктора медицинских наук Москва 2012 Работа выполнена на кафедре травматологии и ортопедии Российского университета дружбы народов. Научный консультант : Заслуженный деятель науки РФ, Лауреат Премии правительства РФ, Загородний Николай Васильевич доктор медицинских наук, профессор Официальные...»

«НОРОВ ФАРИДУН ХАМИДОВИЧ ОСЛОЖНЕНИЯ РЕНТГЕНОЭНДОВАСКУЛЯРНЫХ ЛЕЧЕБНЫХ ВМЕШАТЕЛЬСТВ У БОЛЬНЫХ С ВРОЖДЕННЫМИ ПОРОКАМИ СЕРДЦА, ИХ ПРОФИЛАКТИКА И ЛЕЧЕНИЕ (14.01.26 – сердечно-сосудистая хирургия) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2011г. Работа выполнена в Учреждении Российской Академии медицинских наук Научный Центр сердечно-сосудистой хирургии им. А.Н. Бакулева РАМН Научные руководители: доктор медицинских наук, академик РАМН...»

«КОНОВАЛОВА НИНА ГЕННАДЬЕВНА ВОССТАНОВЛЕНИЕ ВЕРТИКАЛЬНОЙ ПОЗЫ ИНВАЛИДОВ С НИЖНЕЙ ПАРАПЛЕГИЕЙ ФИЗИЧЕСКИМИМ МЕТОДАМИ 14.00.51 - восстановительная медицина, лечебная физкультура и спортивная медицина, курортология и физиотерапия 14.00.13 - нервные болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук Томск - 2004 2 Работа выполнена в Государственном образовательном учреждении дополнительного профессионального образования Новокузнецкий...»

«Путилова Татьяна Александровна ОБОСНОВАНИЕ ПРОГНОЗА ГИПЕРТЕНЗИОННЫХ ОСЛОЖНЕНИЙ У ПАЦИЕНТОК С ГЕСТАЦИОННЫМ САХАРНЫМ ДИАБЕТОМ 14.01.01 – Акушерство и гинекология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Челябинск - 2014 2 Работа выполнена в отделении антенатальной охраны плода Федерального государственного бюджетного учреждения Уральский научно-исследовательский институт охраны материнства и младенчества Министерства здравоохранения...»

«ЗУЙКОВА АННА АЛЕКСАНДРОВНА ОСОБЕННОСТИ ЭТИОПАТОГЕНЕЗА ДЕЗАДАПТИВНЫХ ИЗМЕНЕНИЙ УЧАСТНИКОВ БОЕВЫХ ДЕЙСТВИЙ 14.03.03 – патологическая физиология Автореферат диссертации на соискание ученой степени доктора медицинских наук Нижний Новгород -2014 1 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Нижегородская государственная медицинская академия Министерства здравоохранения Российской Федерации Научный консультант :...»








 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.