WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Жеребцова Вера Анатольевна

«Детекция и мониторинг клональных перестроек

генов тяжелых цепей иммуноглобулинов

у больных множественной миеломой».

14.00.29 – Гематология и переливание крови

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата медицинских наук

Москва, 2008

Работа выполнена в Государственном учреждении Гематологический Научный центр Российской Академии Медицинских Наук

Научный руководитель: член-корреспондент РАМН Доктор медицинских наук, профессор В.Г. Савченко

Официальные оппоненты:

Доктор медицинских наук, профессор А.К. Голенков Доктор биологических наук, профессор Б.С. Народицкий Ведущее научное учреждение:

Российский онкологический научный центр РАМН

Защита состоится « _ » 2008 г. в час.

на заседании диссертационного Совета Д 001.042.01 при Государственном учреждении Гематологический Научный центр Российской Академии Медицинских Наук по адресу: 125167 Москва, Новозыковский проезд, д.4а

С диссертацией можно ознакомиться в библиотеке Государственного учреждения Гематологический Научный центр Российской Академии Медицинских Наук Автореферет разослан « _ » 2008 года

Ученый секретарь диссертационного Совета Кандидат медицинских наук Е.Е. Зыбунова Актуальность проблемы.

В лечении множественной миеломы (ММ) выделяют два основных химиотерапевтических подхода. Принципом так называемой стандартной терапии миеломной болезни является длительное, практически непрерывное применение химиопрепаратов в небольших дозах (схемы «МП», «М2»). Программы высокодозной химиотерапии (ВХТ) основаны на принципе интенсификации дозы химиотерапевтического воздействия. Интенсивное лечение ММ рассчитано на максимальное уменьшение опухолевой массы на первых этапах ВХТ с последующей трансплантацией аутологичных или аллогенных стволовых клеток крови (СКК) или костного мозга (КМ) в качестве консолидации достигнутого эффекта и длительным поддерживающим лечением интерфероном- (ИНФ-).

Применение интенсивных программ химиотерапии и трансплантации аутологичных или аллогенных стволовых клеток у больных ММ позволило существенно увеличить частоту достижения полных ремиссий (ПР) и продолжительность жизни больных. Чувствительность стандартных методов оценки эффективности лечения ММ (морфологическое исследование костного мозга и иммунохимическое исследование сыворотки крови и мочи) оказалась недостаточной в связи с существенной редукцией опухолевой массы. Появилась необходимость в дополнительном применении более чувствительных методов детекции минимальной резидуальной болезни (МРБ).

Одним из методов, обладающих достаточно высокой чувствительностью для обнаружения опухолевого клона и отслеживания в динамике остаточных миеломных клеток, является полимеразная цепная реакция (ПЦР). В основе оценки клональности и мониторинга МРБ при ММ лежит биологическая особенность лимфоидной ткани, отличающая ее от любой другой наличием в геноме каждого лимфоцита уникально перестроенного гена тяжелых цепей иммуноглобулинов (IgН). ПЦР-анализ в подавляющем большинстве случаев дает возможность маркировать опухолевый клон по таким уникальным перестройкам.

Метод ПЦР позволяет определить остаточные опухолевые клетки с высокой чувствительностью. Большим преимуществом данного подхода является также количественной оценки опухолевого клона.

Использование метода ПЦР для определения минимальной резидуальной болезни способствует более полной оценке результативности режимов химиотерапии. Клиническая значимость мониторинга МРБ в настоящее время достоверно показана для острых и хронических лейкозов. Так в частности, результаты молекулярных исследований при данных заболеваниях широко используют для прогнозирования клинико-гематологических рецидивов и определения показаний к возобновлению или смене специальной терапии. Роль мониторинга МРБ у больных ММ пока остается неопределенной. Кроме того, недостаточно изучены биологические особенности опухоли. Именно эти нерешенные вопросы послужили поводом для проведения нашего исследования.

Цель исследования:

Разработка методов оценки эффективности лечения множественной миеломы с использованием высокочувствительных индивидуальных ПЦР-систем для тестирования опухолевого клона.

Задачи исследования:

1. Разработать метод детекции клональных перестроек генов тяжелых цепей иммуноглобулинов у больных парапротеинемическими гемобластозами, основанный на обратно-транскриптазной полимеразной цепной реакции.

2. Определить нуклеотидную последовательность фрагментов, соответствующих клонально перестроенным вариабельным регионам генов иммуноглобулинов и проанализировать их на наличие мутаций.

3. Определить частоту обнаружения клональных перестроек генов тяжелых цепей иммуноглобулинов у больных парапротеинемическими гемобластозами и изучить характер использования семейств VH-генов.

4. Создать индивидуальные пациент-специфичные ПЦР-системы для тестирования опухолевого клона и провести с их использованием динамическое исследование резидуальной болезни в ходе лечения множественной миеломы.

5. Сравнить информативность исследований перестроек генов тяжелых цепей иммуноглобулинов в образцах костного мозга и периферической крови.

6. Оценить прогностическую значимость выявления остаточной популяции опухолевых клеток в образцах лейкоконцентратов.

7. Определить этапы селекции больных множественной миеломой в ходе проведения интенсивной химиотерапии и провести анализ эффективности лечения на различных этапах.

Научная новизна:

1. Установлено соответствие частоты встречаемости различных семейств VHгенов у больных множественной миеломой c частотой их использования в нормальном В-клеточном репертуаре.

2. Детально охарактеризованы и представлены в GenBank NCBI нуклеотидные последовательности клонально перестроенных VH-генов у 38 больных множественной миеломой.

3. Отмечено частое использование вариабельного сегмента VH1-69.

4. Показана высокая стабильность структуры перестроенных генов тяжелых цепей иммуноглобулинов при развитии рецидива множественной миеломы и на разных стадиях заболевания.

5. Установлено, что отсутствие сывороточного парапротеина у больных с миеломой Бенс-Джонса и несекретирующей формой миеломы обусловлено возникновением аномальных стоп-кодонов и frameshift-мутаций.

Практическая ценность:

1. Доказана целесообразность использования в качестве молекулярного маркера опухоли у больных парапротеинемическими гемобластозами клональных перестроек генов тяжелых цепей иммуноглобулинов.

2. Созданы высокочувствительные, индивидуальные пациент-специфичные ПЦРсистемы для мониторинга минимальной резидуальной болезни у пациентов с множественной миеломой.

3. Определены этапы селекции больных в ходе проведения интенсивной химиотерапии и показаны основные причины снятия пациентов с высокодозных программ лечения множественной миеломы.

4. Продемонстрированы различные методические подходы, использованные для повышения чувствительности детекции минимальной резидуальной болезни.

Положения, выносимые на защиту:

1. Клональная реаранжировка генов тяжелых цепей иммуноглобулинов методом обратно-транскриптазной полимеразной цепной реакции выявлена у 90% первичных больных парапротеинемическими гемобластозами.

2. Характер использования генов вариабельного региона в исследуемой группе соответствует частоте использования VH-генов в нормальном репертуаре Вклеток.

3. Степень гомологии с герминальными VH-генами составляет 74,2-96%, что свидетельствует о прохождении соматического гипермутирования.

4. Клонально перестроенный ген IgH в опухолевых клетках у больных ММ отличается высокой стабильностью на разных стадиях болезни и при развитии рецидива.

5. Созданы высокочувствительные, индивидуальные пациент-специфичные ПЦРсистемы для мониторинга минимальной резидуальной болезни у пациентов с множественной миеломой 6. После курсов «VAD» и циклофосфана в высоких дозах у 100% больных в костном мозге обнаруживаются остаточные опухолевые клетки. После курса «EDAP» молекулярный маркер выявляется у 77,8%, после аутотрансплантации СКК у 67% больных.

7. В лейкоконцентратах опухолевые клетки с клональными перестройками генов IgH обнаружены у 64% больных ММ.

Публикации.

По теме диссертации опубликовано 6 печатных работ.

Апробация диссертации.

Основные положения работы доложены на Международной Гематологической школе «Лейкозы и лимфомы. Терапия и фундаментальные исследования»

(Москва, 2004г., 2006г., 2007г.), I-ой Российско-Американской Онкологической конференции (Санкт-Петербург, 2005г.), Всероссийском декаднике по гематологии (Москва, 2007г.), Европейской трансплантационной конференции (Лион, 2007г.).

Объем и структура работы.

Диссертация изложена на 161 странице, состоит из введения, обзора литературы, методической главы, главы собственных результатов, заключения, выводов и указателя литературы. Работа иллюстрирована 13 таблицами, 27 рисунками, схемой, 3 диаграммами. Диссертация выполнена в отделении высокодозной химиотерапии гемобластозов и трансплантации костного мозга ГНЦ РАМН (руководитель член-корреспондент РАМН, проф. В.Г. Савченко), совместно с лабораторией генной инженерии ГНЦ РАМН (заведующий к.б.н. А.В. Мисюрин, научный консультант с.н.с. В.Л. Сурин), а также при участии сотрудников других подразделений ГНЦ РАМН (директор академик РАН и РАМН А.И. Воробьев).

Соавторами работ, опубликованных по теме диссертации являются: член-корр.

РАМН В.Г. Савченко, д.м.н. Л.П. Менделеева, В.Л. Сурин, к.б.н. А.В. Мисюрин, к.м.н. Н.Г. Тюрина, О.С. Покровская, к.м.н. Е.Ю. Варламова, к.м.н. К.С. Момотюк, к.м.н. Е.Н. Устинова, д.м.н. Л.С. Любимова, к.м.н. Е.О. Грибанова, Н.Е. Митиш, к.м.н. И.Б. Капланская, д.б.н. И.А. Воробьев, Е.М. Грецов, д.м.н. Н.Н. Калинин.

Содержание работы.

Характеристика больных.

В настоящей работе представлены результаты обследования 46 больных парапротеинемическими гемобластозами: у 41 установлен диагноз множественной миеломы; у двух пациентов - макроглобулинемия Вальденстрема; в одном случае – острый плазмобластный лейкоз; у 1 больного – моноклональная гаммапатия; в одном случае установлен диагноз солитарной плазмоцитомы. Пациенты наблюдались в отделении высокодозной химиотерапии гемобластозов и трансплантации костного мозга Гематологического Научного центра РАМН в период с февраля 2002 по декабрь 2005 года (директор – академик РАН и РАМН А.И. Воробьев, руководитель отделения - член-корр. РАМН В.Г. Савченко).

Среди включенных в исследование больных было 26 мужчин и 20 женщин в возрасте от 35 до 72 лет, медиана возраста составила 53 года.

При поступлении в ГНЦ РАМН с диагностической целью больным проводили необходимый объем лабораторно-инструментальных исследований. У 22 из (53,66%) больных ММ определена IIА стадия заболевания, у 18 (43,9%) – III стадия (IIIA – 7, IIIB – 11 больных). У одного пациента диагноз ММ установлен на IА стадии. Исходного разделения больных на различные группы не проводили. На момент обращения в клинику всем пациентам планировалось интенсивное лечение по протоколу «Тотальная Терапия», предложенному B. Barlogie и соавторами. Программа состоит из нескольких последовательных индукционных курсов полихимиотерапии и высокодозной консолидации с помощью двойной аутотрансплантации. Индукция включает в себя 3 курса «VAD», мобилизацию гемопоэтических клеток крови циклофосфаном в высоких дозах («HDCph») и колониестимулирующим фактором, сбор стволовых клеток крови, курс химиотерапии «EDAP». Консолидация состоит из двух последовательно выполняемых трансплантаций аутологичных стволовых клеток крови. В качестве поддерживающей терапии используют интерферон- 3 млн. ЕД. подкожно 3 раза в неделю, длительно.

Необходимо отметить, что еще до начала терапии 6 больных были исключены из клинического исследования (причины: отказ пациентов от терапии в условиях ГНЦ и отсутствие показаний для проведения ПХТ на момент установления диагноза).

Первичное молекулярное исследование костного мозга, направленное на выявление клональных перестроек генов тяжелых цепей иммуноглобулинов выполняли всем больным парапротеинемическими гемобластозами (n=46). ПЦР мониторинг опухолевого клона осуществляли у больных, у которых удалось обнаружить молекулярный маркер опухоли.

Методы исследования.

Молекулярно-генетическое исследование костного мозга, периферической крови, лейкоконцентратов выполняли в лаборатории генной инженерии ГНЦ РАМН (зав. к.б.н. А.В. Мисюрин).

Выполнение цитогенетических исследований и определение прогностической значимости аномалий кариотипа не входили в задачи исследования.

С целью детекции и мониторинга минимальной остаточной болезни в работе использовался метод амплификации клонально перестроенных генов вариабельного региона тяжелых цепей иммуноглобулинов. Материалом для молекулярного исследования служили образцы костного мозга и периферической крови больных, взятые до начала лечения и на различных этапах терапии. Кроме того, у пациентов, которым выполняли трансплантацию аутологичных стволовых клеток крови, исследовали лейкоконцентраты.

Первое исследование выполняли до начала лечения с целью определения молекулярного маркера - клонально перестроенного вариабельного региона генов тяжелых цепей иммуноглобулинов. Материалом для первичного анализа, проводимого методом обратно-транскриптазной полимеразной цепной реакции, служила тотальная РНК, выделенная из образцов КМ. В реакции использовали праймеры, специфичные для одного из 7 семейств генов вариабельного региона тяжелых цепей иммуноглобулинов (VH.L1-6; VH.D1-6) и праймеры, гомологичные либо консервативным участкам JH-сегментов, либо области константного региона (СH). Нуклеотидные последовательности праймеров представлены в таблице 1.

Таблица 1. Нуклеотидные последовательности праймеров.

GGAAGTAGTCCTTGACCAG

С AGAAGCCCTGGACCAGGCA

С GGAATTCTCACAGGAGACGAGG

JHD ACCTGAGGAGACGGTGACCAGGGT

VH.L1/7 CTCACCATGGACTGGACCTGGAG

VH.L3 CCATGGAGTTTGGGCTGAGC

VH.L4 ACATGAAACACCTGTGGTTCTT

VH.L5 ATGGGGTCAACCGCCATCCT

VH.L6 ATGTCTGTCTCCTTCCTCAT

VH.D1 CCTCAGTGAAGGTCTCCTGCAAGG

VH.D2 TCCTGCGCTGGTGAAAGCCACACA

VH.D3 GGTCCCTGAGACTCTCCTGTGCA

VH.D4a TCGGAGACCCTGTCCCTCACCTGCA

VH.D4b CGCTGTCTCTGGTTACTCCATCAG

VH.D5 GAAAAAGCCCGGGGAGTCTCTGAA

VH.D6 CCTGTGCCATCTCCGGGGACAGTG

Праймеры системы VH.L1-6 гомологичны консервативным участкам лидерной области (L) вариабельного региона, VH.D1-6 – 1-му структурному региону (FWR1).

Нумерация праймеров от 1 до 6 установлена в соответствии с их специфичностью для того или иного семейства VН-генов. Одноименные VH.L и VH.D праймеры специфичны для одних и тех же семейств генов вариабельного региона, и при поиске молекулярного маркера опухоли часто используют одну из 2-х праймерных систем. В случае ММ, из-за наличия в амплифицируемой структуре большого числа соматических мутаций место посадки того или иного праймера может быть нарушено, поэтому в нашей работе для повышения надежности идентификации гена IgH, ассоциированного с опухолевым клоном, использовали одновременно обе системы праймеров. Схематичное изображение структуры IgH гена с указанием расположения праймеров приведены на рисунке 1.

Рисунок 1. Структура IgH гена, расположение праймеров.

L – лидерный регион; FWR – структурный регион; D – регион, определяющий разнообразие; JH – соединительный регион; СН – константная область; CDR1-3 – регионы, определяющие комплементарность.

Анализ полученных после проведения ПЦР фрагментов осуществляли при помощи электрофореза в 6% полиакриламидном геле с последующей визуализацией в ультрафиолетовом свете после прокрашивания геля бромистым этидием.

Фрагмент, соответствующий по длине клонально перестроенному VH-гену, секвенировали. Секвенирование проводили в ЦКП «Геном» ИМБ РАН с помощью набора реактивов ABI PRISM®BigDyeTM Terminator v.3.1 с последующим анализом продуктов реакции на автоматическом секвенаторе ДНК ABI PRISM 3100-Avant или вручную по модифицированному методу Сенгера с использованием системы «Macrophore» (Sweden). После определения нуклеотидной последовательности ПЦР-фрагмента проводили его сравнение с герминальными VН-генами с помощью программы IgV BLAST и базы данных IMGT. Степень гомологии определяли по отношению к наиболее близкому герминальному VH-гену. В тех случаях, когда полученная нуклеотидная последовательность была гомологична герминальному VH-гену менее чем на 98%, констатировали прошедшую соматическую гипермутацию. Пограничный показатель гомологии, равный 98%, используется авторами аналогичных исследований с учетом поправки на аллельный полиморфизм. С целью оценки реального вклада аллельных вариаций в изменение структуры VH-генов мы исследовали фрагменты неперестроенных герминальных аллелей гена VH1-69 у 5 больных, миеломные клоны которых имели данный вариант IgH. Для осуществления этой задачи использовали следующие праймеры: 1) VH1-69D – CCCTGAGAGCATCACATAAC, 2) VH1-69R –

ACCCCTGTCATCTCCTCAGC.

На основании анализа полученных нуклеотидных последовательностей клонально перестроенных VH-D-JH-регионов производили подбор и синтез индивидуальных пациент(аллель)-специфичных праймеров. Обратный праймер подбирали к уникальной для выявленного клона области CDR3, прямой праймер – к наиболее мутировавшим участкам VH-области, обычно CDR1 или CDR2. Синтез олигонуклеотидов осуществляли с помощью автоматического синтезатора ДНК на фирме Sintol.

Для мониторинга минимальной резидуальной болезни выполняли ПЦР с пациент-специфичными праймерами. В качестве матрицы использовали геномную ДНК, выделенную из костного мозга, периферической крови и лейкоконцентратов.

Предварительно, спектрофотометрически определяли концентрацию нуклеиновых кислот в каждом исследуемом образце. Для этого измеряли его оптическую плотность (ОД) при 260 нм. Одна единица ОД при 260 нм соответствует концентрации двухцепочечной ДНК 50 мкг/мкл. Для оценки чистоты водного раствора ДНК, его оптическую плотность измеряли при 260 и 280 нм и вычисляли соотношение полученных величин (для «чистых» препаратов оно должно быть равно 1.8-2). Все анализируемые образцы геномной ДНК разводили деионизированной водой до концентрации 0.1 мкг/мкл. Таким образом, все ДНКпробы имели идентичные количественные характеристики, благодаря чему был возможен их сравнительный анализ.

Определение уровня МРБ выполняли с помощью полуколичественной ПЦР (метод предельных разведений). С целью повышения чувствительности ПЦР амплификацию проводили в две стадии с 2 парами праймеров (двухраундовая ПЦР, "nested" PCR):

Матрицей для ПЦР I служила геномная ДНК первичных образцов костного мозга, периферической крови в концентрации 0.1 мкг/мкл и в их последовательных десятикратных разведениях контрольной ДНК 10-1 (1:10), 10-2 (1:100), 10-3 (1:1000), 10-4 (1:10000). Также реакцию проводили с пробами костного мозга, крови, и, при наличии, лейкоконцентрата (в концентрации 0.1 мкг/мкл), полученными на различных этапах лечения.

ПЦР II выполняли с аликвотой реакционной смеси после ПЦР I и парой индивидуальных пациент-специфичных праймеров.

Молекулярный мониторинг МРБ проводили у всех больных вне зависимости от эффективности терапии при условии, что количество образцов костного мозга и периферической крови в динамике составляло два и более.

Статистический анализ полученных данных.

Для статистической обработки данных использовали методы описательной статистики, анализа таблиц сопряженности, однофакторного, многофакторного дисперсионного анализа выживаемости (пошаговые процедуры модели пропорциональных рисков). Для расчетов использовали пакет статистических программ SAS.

Основные понятия.

Определения полной ремиссии, частичной ремиссии, частичного ответа, минимального ответа, отсутствия ответа, рецидива и прогрессии заболевания соответствуют критериям оценки эффективности лечения ММ ЕВМТ.

Минимальная резидуальная болезнь – постоянно определяемая остаточная популяция опухолевых клеток, выявить которую можно лишь с помощью новых высокочувствительных молекулярно-генетических методов. Одновременно при световой микроскопии в костном мозге определяется менее 5% плазматических клеток, по данным иммунохимического исследования не обнаружен парапротеин в сыворотке и белок Бенс-Джонса в моче, а показатели общего и биохимического анализов крови в норме.

Молекулярная ремиссия – это полная ремиссия ММ при отсутствии исходно определявшегося методом ПЦР молекулярного маркера.

Общая выживаемость – число реально оставшихся больных ММ на фоне проведенной терапии. Для построения кривой общей выживаемости анализируют параметры всех больных, включенных в исследование. Точкой отсчета считается день начала терапии. Событием считается только смерть больного от любой причины и на кривой отображается ступенькой, идущей вниз. Больных, живых во время проведения анализа, расценивают как случай и на кривой отмечают черточкой, т.е. цензурируют. Больных, судьба которых неизвестна, цензурируют в тот момент, когда было известно, что они живы. Больных, отказавшихся от лечения, цензурируют в день отказа от терапии.

Результаты исследования.

Клиническое исследование.

В анализ эффективности лечения ММ включены 40 больных. У 33 больных программу первого этапа индукции применяли в соответствии с протоколом «Тотальная Терапия» (курсы «VAD»). Двое из 40 больных не были приняты на протокол «Тотальная терапия» (причины: возраст старше 70 лет, тяжелая сопутствующая патология). Этим пациентам исходно проводили лечение по стандартным схемам «М-2» и/или «МП». В пяти случаях из 40 в рамках исследования THAL-2MM003 в качестве индукционной терапии использовали талидомид в сочетании с дексаметазоном. Необходимо отметить, что все больные, взятые на программу индукции «талидомид + дексаметазон», по результатам первичного обследования не имели противопоказаний к принятию на протокол «Тотальная Терапия».

После одного курса «VAD» с протокола были сняты двое больных, в одном случае по причине прогрессии заболевания, в другом - в связи с отсутствием эффекта от терапии и развитием тяжелых осложнений. После второго курса «VAD» с протокола были сняты еще 4 пациента также по причине отсутствия или минимального ответа на лечение и в связи с развитием тяжелых осложнений.

Одна больная погибла от инфекционных и геморрагических осложнений в период проведения 2-го курса «VAD», после первого курса противоопухолевый эффект отсутствовал. Ранняя летальность составила 3%. Таким образом, первый этап индукции по протоколу «Тотальная терапия» был выполнен в полном объеме у из 33 больных (78,8%).

После завершения 3-х курсов «VAD» было выполнено полное контрольное обследование больных. Эффект лечения считали недостаточным, когда концентрация парапротеина в сравнении с исходной уменьшалась менее чем на 50% (минимальный или отсутствие ответа, а также прогрессия заболевания).

Полная ремиссия после 3-х курсов «VAD» была констатирована у одного больного (3%), частичная ремиссия – у 13 больных (39,4%), частичный ответ – у пациентов (24,2%). Противоопухолевый эффект терапии оказался недостаточным у 11 из 33 больных (33,4%), одна из них погибла в ходе лечения, остальные пациентов были сняты с протокола «Тотальная Терапия» и переведены на программы химиотерапии стандартной интенсивности («МП», «М-2»). Кроме того, еще 4 больных были сняты с протокола и переведены на схемы «МП», «М-2»

несмотря на хороший (более чем на 50% снижение уровня патологического белка) противоопухолевый эффект курсов «VAD». Причины, по которым пациенты были сняты с протокола на первом этапе индукции, приведены в таблице 2.

Таблица 2. Основания для снятия с протокола высокодозной химиотерапии.

Сроки снятия Причины снятия с протокола «Тотальная Терапия»

с протокола После 1-го курса 1) прогрессирование заболевания «VAD» (n=2) 2) отсутствие ответа + тяжелые осложнения После 2-го курса 1) отсутствие ответа + тяжелые осложнения «VAD» (n=4) 2-4) минимальный ответ + тяжелые осложнения После 3-го курса 1) отсутствие ответа «VAD» (n=8) 2-4) минимальный ответ Как видно из представленных в таблице 2 данных, основными причинами для снятия с протокола высокодозной химиотерапии послужили недостаточная эффективность и плохая переносимость (крайне тяжелые, угрожающие жизни осложнения) VAD-терапии.

Мы проанализировали частоту и тяжесть инфекционных, геморрагических и токсических осложнений, возникших в ходе проведения курсов «VAD» в зависимости от степени редукции опухоли. Оказалось, что частота развития нетяжелых инфекционных осложнений, таких как стоматит, некротическая энтеропатия, псевдомемранозный колит, Herpes simplex и др. не отличалась у больных с разной степенью редукции парапротеина. В то же время статистически достоверные отличия были получены в отношении частоты развития таких осложнений, как трахеобронхит (р=0,02) и эрозивный гастрит (р=0,039).

Достоверно чаще у больных с низкой химиочувствительностью опухоли состояние осложнилось сепсисом и септическим шоком (р=0,039), пневмонией (р=0,016), тяжелым геморрагическим синдромом (желудочно-кишечное кровотечение, кровоизлияние в головной мозг, геморрагический трахеобронхит, гематурия).

Токсические осложнения на этапе VAD-терапии наблюдались крайне редко. В частности, у 2 пациентов развилась винкристиновая полинейропатия, и в одном случае были зафиксированы тревожные расстройства, обусловленные терапией кортикостероидами. Тромботические осложнения на фоне профилактической терапии гепарином наблюдались у 3 (9%) больных.

Если говорить о переносимости проведенного лечения в целом, то обращает на себя внимание тот факт, что у 14 из 22 (63,6%) больных с хорошим противопухолевым эффектом VAD-терапии осложнений вообще не было отмечено. В то же время среди больных, у которых противоопухолевый эффект от лечения был недостаточный, осложнения отсутствовали лишь у 4 (36.4%) из пациентов.

Мы также провели сравнительный анализ основных клинико-лабораторных показателей первичного обследования больных, у которых наблюдался хороший противоопухолевый эффект VAD-терапии (полная ремиссия, частичная ремиссия, частичный ответ; n=22) и пациентов, у которых эффективность лечения оказалась недостаточной (снижение секреции моноклонального парапротеина менее чем на 50%; n=11). Статистически достоверные отличия получены только в отношении показателя бета2-микроглобулина (р=0,0292).

Как уже упоминалось выше, у 5 из 40 включенных в клиническое исследование больных в качестве индукционной терапии использовали сочетание талидомида и дексаметазона (протокол THAL-2MM003). Эффективность этой программы оценивали после 3-5 курсов. У двух больных была констатирована частичная ремиссия ММ. Одна из них (М40) погибла через 4 месяца от момента начала лечения от септического шока. Второй пациент с ЧР после 5 курсов «талидомид + дексаметазон» был переведен на протокол «Тотальная терапия». В двух случаях эффект от лечения отсутствовал, в связи с чем, больные были сняты с протокола и переведены на стандартную терапию. У одного пациента после проведения курсов «талидомид + дексаметазон» была констатирована полная ремиссия ММ, однако уже через 3 месяца развился рецидив заболевания и больной также был переведен на лечение по стандартной программе химиотерапии «М-2». Подводя итог описанию последовательной селекции больных ММ, проведенной в первую очередь на основании эффективности тех или иных курсов терапии, мы суммировали в схеме 1 основные этапы разделения больных на две различные группы. Одним больным продолжили интенсивное лечение ММ, другие пациенты были переведены на программы химиотерапии в стандартных дозах.

Схема 1.

Таким образом, на втором этапе исследования были выделены две группы больных. Одну группу составили больные, которым предполагалось продолжить и выполнить в полном объеме программу «Тотальная Терапия» (n=19). Во вторую группу вошли пациенты, которым исходно проводили стандартную химиотерапию ММ и больные, которые были позже переведены на данные программы (n=19).

В соответствии с протоколом «Тотальная Терапия» следующими после курсов «VAD» этапами индукционной терапии являются: 1) мобилизация гемопоэтических стволовых клеток периферической крови циклофосфаном в высоких дозах (6г/м2) и гранулоцитарным колониестимулирующим фактором (Г-КСФ по 5 мг/кг/день) с последующим сбором стволовых гемопоэтических клеток; 2) курс химиотерапии по схеме «EDAP».

Мобилизация и сбор стволовых клеток крови были выполнены 19-ти больным.

Длительность применения Г-КСФ составила 11-20 дней. После проведения курса циклофосфана в высоких дозах у большинства больных (63%) инфекционные осложнения либо отсутствовали (n=8), либо были легкой степени тяжести (n=4).

Число лейкаферезов варьировало от 2 до 4. Было собрано от 4,2106/кг до 79,6106/кг CD34-позитивных клеток (медиана - 14,0106/кг). Только у одной больной не удалось собрать достаточное для трансплантации количество CD34позитивных клеток, она была переведена на стандартные программы лечения ММ. После проведения мобилизации ГСКК состояние двух больных осложнилось активным вирусным гепатитом В, что также потребовало снятия больных с протокола «Тотальная терапия».

Полная ремиссия после курса циклофосфана в высоких дозах констатирована у 6 пациентов (31.6%). В одном из этих случаев она была достигнута уже после курсов «VAD», а у пяти пациентов ранее наблюдалась частичная ремиссия. В остальных случаях (n=7), когда после 3-х курсов «VAD» была установлена ЧР, после курса циклофосфана сохранился прежний клинико-лабораторный статус.

Процент ЧР составил 36.8%. Что же касается больных, у которых после VADтерапии был зафиксирован частичный ответ (n=6), во всех этих случаях дальнейшей редукции моноклонального иммуноглобулина не произошло. Более того, у одного больного отмечена прогрессия заболевания.

Таким образом, основным эффектом курса циклофосфана в высоких дозах стало значительное увеличение частоты ПР (с 3% до 31,6%) за счет пациентов, у которых на предыдущем этапе лечения была достигнута частичная ремиссия.

Следующий курс химиотерапии по схеме «EDAP» был проведен 17 больным. В целом переносимость данного курса оказалась удовлетворительной. В половине случаев инфекционных осложнений отмечено не было. Тяжелых осложнений также не наблюдалось.

Оценка противоопухолевого эффекта курса «EDAP» показала, что на данном этапе лечения процент полных ремиссий возрос до 47% (8 из 17 больных), то есть ПР была констатирована еще у двух пациентов. Во всех остальных случаях клинико-лабораторный статус больных не изменился.

В соответствии с программой «Тотальная Терапия» консолидация достигнутого противоопухолевого эффекта осуществляется путем последовательного выполнения двойной трансплантации аутологичных стволовых гемопоэтических клеток. Предтрансплантационное кондиционирование состояло из мелфалана в дозе 200 мг/м2 (по 100 мг/м2 в -3 и -2 дни), трансфузию аутологичных гемопоэтических клеток крови осуществляли в 0 день. Первая ауто-ТСКК была выполнена 16 больным. Вторая трансплантация к сроку окончания исследования была произведена 7 пациентам. Интервал между двумя трансплантациями в среднем составил 4,5 месяца. У 5 больных ММ от проведения второй ауто-ТСКК пришлось воздержаться по следующим причинам: сохраняющаяся более месяцев глубокая аплазия кроветворения (2 случая), вирусный гепатит С (один случай), развитие синдрома слабости синусного узла (один случай), отказ больной (один случай).

Следует отметить, что наиболее частыми инфекционными осложнениями в ходе выполнения первой ауто-ТСКК были: стоматит (87.5% случаев), некротическая энтеропатия (56.2%), эзофагит (43.7%), фарингит (43.7%). В одном случае была диагностирована пневмония, у 2 больных (12,5%) наблюдались проявления тяжелой герпетической инфекции (опоясывающий герпес, острый цистит вирусной этиологии). Переносимость 2-ой трансплантации аутологичных СКК оказалась хуже. В частности у трех из 7 больных был диагностирован сепсис. У одной из указанных больных также наблюдалась двусторонняя пневмония, протекавшая с дыхательной недостаточностью.

Оценка противоопухолевого эффекта после выполнения первой ауто-ТСКК показала, что на данном этапе лечения процент полных ремиссий возрос до 56,25% (9 из 16-ти больных), то есть ПР была констатирована еще у 2 пациентов.

В 3 случаях клинико-лабораторный статус больных изменился с частичного ответа на частичную ремиссию, в двух случаях статус частичной ремиссии сохранился, у одного больного через 2 месяца после выполнения первой трансплантации развился рецидив ММ. После второй ауто-ТСКК показатели противоопухолевого ответа оставались практически такими же, как и после первой. Только у одной пациентки с частичной ремиссией после 2-ой аутотрансплантации была констатирована полная ремиссия, но хотелось бы сразу отметить, что в данном случае уже через 13 месяцев был зафиксирован рецидив ММ.

Не вызывает сомнений явное нарастание числа полных ремиссий от этапа к этапу тотальной терапии. Очень высокая эффективность описанного подхода лечения ММ, основанного на интенсификации дозы химиотерапевтического воздействия, объясняется грамотной селекцией больных на всех этапах терапии.

Как оказалось, самым важным этапом селекции является индукционная VADтерапия. Эффективность и переносимость курсов «VAD» послужили главными критериями для отбора больных на программу ВХТ. Благодаря этому, нам удалось выделить группу пациентов, у которых был достигнут максимальный эффект от проведенного лечения и которые в большинстве случаев удовлетворительно перенесли интенсивную терапию ММ.

Мы отдельно оценили эффективность лечения больных, которым исходно проводили химиотерапию в стандартных дозах, а также пациентов, которые были переведены на стандартные программы после 1-3 курсов «VAD» или 3-5 курсов «талидомид + дексаметазон» (n=19). В данный анализ не включены больные, которые были переведены на стандартную терапию после проведения курса циклофосфана в высоких дозах или курса «EDAP» (n=3). Необходимо сразу отметить, что описываемая группа больных крайне разнородна в отношении начальных этапов терапии. Тем не менее мы сочли возможным объединить этих больных для анализа эффективности лечения в группу, пациентам в которой по тем или иным причинам не проводили ВХТ (условно группа не тотальной терапии). Эффективность лечения оценили через 3, 6, 12 месяцев от момента его начала. Через 3 месяца от начала лечения у 36,8% больных (7 из 19) были установлены частичная ремиссия или частичный ответ. Эффективность терапии была расценена как недостаточная (редукция концентрации парапротеина менее чем на 50% от исходной) у 9 из 19 больных, что составило 47,4%. В трех случаях на фоне проводимой терапии наблюдалась прогрессия заболевания. Оценка результатов лечения через 6 месяцев показала увеличение числа пациентов, у которых удалось достигнуть ЧР и ЧО, у одного больного была констатирована полная ремиссия ММ. Через 12 месяцев наблюдения полная ремиссия была констатирована у 3 больных ММ. Хотелось бы отметить, что у всех этих пациентов уже через 3 месяца лечения была достигнута частичная ремиссия. Судьба одного из 3-х больных после года наблюдения не известна, а вот у двух других пациентов через 38 месяцев ПР сохранялась. Процент летальности в этой группе больных к моменту окончания исследования составил – 36,8% (7 из 19 больных).

Таким образом, анализ результатов проведенного клинического исследования в первую очередь показал принципиальное значение селекции больных ММ на начальных этапах индукционной терапии по протоколу «Тотальная Терапия». В частности было отмечено, что хорошая эффективность и переносимость курсов «VAD» являются определяющими для выделения группы больных, которым целесообразно продолжать лечение с использованием интенсивной программы химиотерапии, включающей трансплантацию аутологичных гемопоэтических стволовых клеток крови. Именно у этих пациентов удается достичь максимального эффекта ВХТ при ее удовлетворительной переносимости.

Результаты и обсуждение первичного молекулярного исследования.

Первичный молекулярный анализ клональности проведен у 46 больных парапротеинемическими гемобластозами. Пять пациентов, страдающих ММ, были химиотерапии по схеме «VAD». Клинико-гематологический статус этих больных на момент определения клональности в одном случае соответствовал полной перечисленных пациентов не удалось выявить молекулярный маркер опухоли – клонально перестроенный вариабельный регион генов тяжелых цепей иммуноглобулинов. Это связано с существенной редукцией опухолевой массы и, соответственно, отсутствием явного преобладания клеток миеломы с клональной перестройкой над поликлональной популяцией В-лимфоцитов. Таким образом, хотелось бы отметить, что для обнаружения молекулярного маркера при ММ необходимо исследование биологического материала, взятого до начала лечения или на самых ранних этапах терапии, пока сохраняется количественное преимущество опухолевых клеток.

Из первичных больных (n=41), включенных в исследование до начала химиотерапии, клональная реаранжировка VH-генов была определена в случаях (90%). Кроме того, у одного пациента с несекретирующей миеломой молекулярный маркер был выявлен после развития рецидива и появления моноклонального иммуноглобулина в сыворотке крови. Суммарно клональная реаранжировка VH-генов была определена у 38 больных.

В настоящем исследовании молекулярный маркер опухоли не был обнаружен у первичных больных ММ. Необходимо отметить, что все 4 случая не выявления клональной перестройки VH-генов касались миеломы Бенс-Джонса и несекретирующей миеломы. Отсутствие парапротеина в сыворотке крови при этих вариантах ММ может быть обусловлено соматическим гипермутагенезом перестроенных IgH генов с возникновением аномальных стоп-кодонов или наличием более крупных дефектов нуклеотидных последовательностей VH-генов (делеций, инсерций, дупликаций), что во многих случаях приводит к невозможности их амплификации. Всего в нашем исследовании было первичных больных, у которых отсутствовал сывороточный парапротеин. Как мы отметили, у 4 больных перестройки IgH выявить не удалось, однако у 3 первичных пациентов с миеломой Бенс-Джонса последовательность VH-генов была успешно определена. Но оказалось, что в 2 из 3 случаев VDJ-последовательности имели нефункциональный вид, в них были многочисленные стоп-кодоны, дупликации и наблюдался сдвиг рамки считывания. Этим объясняется отсутствие парапротеина в сыворотке крови данных больных. В то же время столь существенные изменения нуклеотидной структуры генов не помешали реакции амплификации.

У большинства обследованных больных (n=35) опухолевый маркер был обнаружен как в системе праймеров VH.L, так и в VH.D, в одном случае – только в VH.L системе, в 2-х случаях – только в VH.D системе. Отсутствие амплификации в одной из систем объясняется, главным образом, существенным искажением места посадки L или D праймера за счет соматических мутаций.

Хотелось бы отметить, что у одной больной, для которой искомые ПЦРфрагменты были получены с двумя L- и двумя D-праймерами, семействспецифичные варианты соответствовали двум разным клонально перестроенным генам IgH. Причем, если расшифрованная последовательность одного из фрагментов, отнесенная к соматически мутированному варианту VH4-39, имела функциональный вид, то во втором гене IgH (VH3-23) наблюдалось серьезное нарушение структуры, обусловленное дупликацией последовательности в 47 п.н., захватывающей часть CDR2- и часть FWR3-района и вызывающей не только сдвиг белковой рамки считывания, но и образование раннего стоп-кодона. Если принять во внимание, что у указанной больной по данным иммунохимического исследования отсутствовала секреция тяжелых цепей иммуноглобулина (миелома Бенс-Джонса), то представляется вполне обоснованным отнесение к миеломному клону второго из двух описанных выше маркеров, имеющего нефункциональный вид. Можно предположить, что наличие второго опухолеспецифичного маркера в данном случае связано с нарушением механизма (отсутствием) аллельного исключения. Однако, использованная система идентификации (ОТ-ПЦР) свидетельствует, по крайней мере, о наличии его экспрессии на уровне мРНК.

Нельзя полностью исключить и существования двух, независимо возникших миеломных клонов. Но в таком случае при установленных нами характеристиках одного из выявленных VH-генов (высокий уровень экспрессии относительно мРНК и отсутствие принципиальных дефектов в структуре) должна наблюдаться секреция сывороточного парапротеина. И, наконец, второй клон может свидетельствовать о наличии какого-то другого лимфопролиферативного заболевания (например, хронического лимфолейкоза), не имевшего на период диагностики ММ клинико-гематологических проявлений. К сожалению, нам не удалось развить данную часть исследования в связи с ранней смертью пациентки, наступившей от инфекционных осложнений через 5 недель после взятия первичного материала и начала лечения. Однако в литературе мы встретили описание ряда клинических случаев одновременной диагностики ММ и других гемобластозов. Большая часть сообщений касалась сочетания миеломной болезни и ХЛЛ. Диагностика двух данных заболеваний у одного пациента является редкой клинической ситуацией. Практически во всех описанных случаях сначала устанавливали диагноз хронического лимфолейкоза, а уже затем ММ. До диагностики миеломы химиотерапию больным не проводили, таким образом, речь шла не о вторичном опухолевом процессе. Интересно отметить, что у большинства описанных больных отсутствовала секреция тяжелых цепей иммуноглобулинов (миелома Бенс-Джонса или несекретирующая форма заболевания). Биологические причины сочетанного развития ММ и ХЛЛ остаются неясными. Часть исследователей утверждает, что оба заболевания имеют общего предшественника, другие считают, что два гемобластоза возникают независимо друг от друга.

Анализ частоты встречаемости различных семейств VH-генов у больных с парапротеинемическими гемобластозами показал, что более чем в 50% случаев (21 из 39) выявлены VH-гены, относящиеся к 3-му семейству и почти в 25% (9 из 39) - к первому семейству. Преобладание VH3-сегментов в клонально перестроенных IgH обусловлено наибольшей представленностью этого семейства среди функциональных реаранжирующихся VH-генов: из 65 VH3-сегментов - функциональных. Характер использования генов вариабельного региона в исследуемой группе в целом соответствует частоте использования VH-генов в нормальном репертуаре В-клеток, где явно преобладают гены 3-го семейства, что согласуется с литературными данными. Сходная ситуация в распределении VHгенов по семействам наблюдается при фолликулярной лимфоме и хроническом лимфолейкозе. В то время как при ОЛЛ наблюдается некоторая избирательность реаранжировок генных сегментов, отличная от случайного выбора, характерного для нормальной дифференцировки В-лимфоцитов. Так, в частности, у больных ОЛЛ в отличие от больных ММ довольно часто используется сегмент VH6-1, что связывают с проксимальным расположением этого сегмента (по отношению к точке соединения) и участием в реаранжировке в первую очередь.

Таблица 3. Частота встречаемости различных семейств VH-генов Семейство Распределение по семействам Встречаемость семейств VHVH-генов известных функциональных генов в исследовании Секвенирование клонально перестроенных VDJ последовательностей проведено во всех случаях успешной амплификации – 39 ПЦР-продуктов. Моноклональная реаранжировка VH-генов была подтверждена секвенированием у 38 больных с парапротеинемическими гемобластозами. Все последовательности VH-генов, определенные в нашем исследовании, представлены в базе данных GenBank NCBI (Acc.No AY999993-97, AY994078-83, AY996325-42, DQ001065-68, DQ487220DG459436-37).

Первичную структуру клонально перестроенных генов вариабельного региона сравнили с герминальными VH-генами и установили степень гомологии к наиболее близкому V-сегменту. У обследованных больных уровень гомологии варьировал от 74,2 до 96%. Ни в одном случае степень гомологии не превышала 98%, что говорит о наличии соматических гипермутаций у всех больных.

Пограничный показатель гомологии, равный 98%, используется авторами аналогичных исследований с учетом поправки на аллельный полиморфизм. В настоящем исследовании мы оценили реальный вклад аллельных вариаций для одного наименее консервативного сегмента VH1-69, для которого известно около 50 различных SNP (single nucleotide polymorphism). С этой целью мы амплифицировали и секвенировали фрагменты неперестроенных герминальных аллелей VH1-69 у 5 пациентов, миеломные клоны которых имели данный вариант IgH. Полученные результаты свидетельствовали о том, что и в случае максимальной вариабельности VH-сегмента вкладом аллельного полиморфизма можно с полным основанием пренебречь, поскольку для 4 из 5 пациентов только одна нуклеотидная замена была обусловлена SNP, у пятого больного наблюдались две замены, все остальные являлись соматическими мутациями.

Герминальные VH, D, JH сегменты, участвовавшие в перестройках генов IgH, были идентифицированы при помощи двух баз данных: IgBLAST и IMGT. В данной выборке больных наиболее часто использовались аллельные варианты генов VH1-69 (5 из 39=12,8%), VH3-23 (5 из 39=12,8%). Преобладание из всех генов 1-го семейства именно VH1-69 (5 / 9; 55,6%) пока является необъясненным событием.

В опубликованных ранее работах, включавших большее число больных, такой феномен также был отмечен. Хотелось бы обратить внимание, что аналогичная особенность наблюдается при хроническом лимфолейкозе.

Идентификация D сегмента генов IgH при использовании базы данных IMGT оказалась возможной в 33 из 39 последовательностей (84,6%). Нами было отмечено явное преобладание D сегментов, относящихся к третьему и пятому семействам, частота их использования составила 54,5% (n=18 из 33) и 21.2% (n= из 33) соответственно. JH сегменты, задействованные в перестройках генов IgH, были определены в 35-ти секвенированных последовательностях. Наиболее представленными оказались генные сегменты JH4 и JH6, они составили 57% (n=20 из 35) и 20% (n=7 из 35) соответственно. Для сравнения, генные сегменты JH1, JH2 встретились всего по одному разу.

В соответствии с литературными данными нуклеотидная последовательность генов IgH при ММ является абсолютно постоянной. В ходе развития заболевания структура VH-генов не претерпевает каких-либо изменений, в том числе в ней не происходит накопления дополнительных соматических мутаций. У 2 больных ММ мы провели сравнительный анализ VDJ-последовательностей, которые были определены в дебюте ММ со структурой VH-генов у тех же больных в одном случае после развития рецидива, в другом – на фоне прогрессии заболевания.

Секвенирование нуклеотидных последовательностей, которые были определены у одного и того же больного в дебюте заболевания и после развития рецидива (через 27 месяцев) показало их полную идентичность. Аналогичный результат секвенирования, а именно идентичность структуры VH-гена был получен у больного, у которого сравнивали VDJ-последовательность до лечения и на фоне прогрессии ММ.

Таким образом, перестроенный ген IgH в опухолевых клетках у больных ММ отличается высокой стабильностью на разных стадиях болезни и при развитии рецидива, в нем не накапливаются дополнительные изменения структуры, в том числе соматические мутации. Перестроенный VH-ген является характеристикой всего опухолевого клона, а не отдельных субклонов.

Результаты мониторинга МРБ.

Мониторинг МРБ выполняли методом двухэтапной ПЦР. Чувствительность метода при динамическом исследовании перестроек генов IgH составила 10–4.

Материалом для мониторинга минимальной резидуальной болезни служили ДНКобразцы костного мозга и периферической крови. Как уже говорилось выше, молекулярный маркер опухоли был обнаружен у 38 больных, из них в исследование по мониторингу МРБ были включены 24 пациента. Мы оценили результаты молекулярного мониторинга отдельно у пациентов, которым проводили ВХТ с последующей трансплантацией аутологичных стволовых клеток крови, и отдельно у больных, которые не были приняты или на ранних этапах лечения были переведены с протокола «Тотальная Терапия» на стандартные программы. В каждую группу вошло по 12 больных. Необходимо отметить, что молекулярный мониторинг проводили у всех больных вне зависимости от клиниколабораторного статуса.

В первичных образцах костного мозга миеломные клетки, содержащие клонально перестроенные VH-гены, были обнаружены у всех пациентов. В то время как в периферической крови опухолевые клетки были определены только у 20 из 24 (88%) первичных больных.

В ходе динамического исследования реаранжировок VH-генов было отмечено, что в 100% случаев после 3-х курсов «VAD» и курса циклофосфана в высоких дозах в костном мозге сохраняются остаточные опухолевые клетки, даже если по данным цитологического исследования в пунктате КМ плазматические клетки не выявляются. У 2 из 9 пациентов, которым проводился курс ПХТ по схеме «EDAP», на данном этапе лечения молекулярный маркер опухоли обнаружен не был. При дальнейших исследованиях у этих больных клональные перестройки генов IgH не определялись, что позволило нам констатировать молекулярную ремиссию ММ. У 7 из 9 (77,8%) больных после курса «ЕDAP» мы выявляли клональные перестройки генов IgH. После выполнения второй трансплантации аутологичных стволовых клеток еще у одного больного была констатирована молекулярная ремиссия. В двух случаях наблюдается персистенция МРБ. У остальных больных опухолевые клетки к моменту завершения исследования продолжали выявляться.

Хотелось бы отметить, что у большинства больных молекулярный маркер переставал выявляться в периферической крови уже с момента достижения частичной ремиссии. Эти данные подтверждают нецелесообразность использования образцов периферической крови для мониторинга МРБ ввиду низкой чувствительности метода. К такому заключению пришли большинство исследователей, занимающихся проблемой мониторинга резидуальной болезни при ММ.

Наибольший интерес представляют собой данные молекулярного мониторинга у больных, у которых была достигнута полная ремиссия (5 из 11). Так, в частности отмечено, что во всех случаях на момент констатации ПР в образцах КМ методом двухраундовой ПЦР остаточные опухолевые клетки обнаруживаются.

Молекулярная ремиссия у 3-х больных была установлена через 2, 2 и 10 месяцев после достижения клинико-гематологической ремиссии. В двух случаях после достижения полной ремиссии наблюдалась персистенция МРБ.

У больных, которым выполняли сбор гемопоэтических стволовых клеток крови, помимо исследования образцов костного мозга и периферической крови проводили ПЦР-анализ лейкоконцентратов. У 7 из 11 (64%) больных в лейкоконцентратах были обнаружены опухолевые клетки с клональными перестройками генов IgH. Было отмечено, что у 3 из 4 больных, у которых молекулярный маркер опухоли в лейкоконцентратах не был обнаружен, после курса циклофосфана в высоких дозах уже была констатирована ПР заболевания.

Это позволяет говорить о том, что вероятность обнаружения миеломных клеток в лейкоконцентратах напрямую зависит от степени редукции опухолевого клона.

Молекулярное исследование также было выполнено у 12 больных, которым проводили стандартную химиотерапию. Полная ремиссия была констатирована у 4 из 12 больных. В 2-х случаях через 13 и 14 месяцев после констатации полной ремиссии ММ отмечено исчезновение из КМ резидуальных опухолевых клеток. У остальных больных на протяжении всего периода наблюдения в образцах костного мозга выявлялся молекулярный маркер заболевания. В периферической крови, также как и при проведении ВХТ, опухолевые клетки переставали обнаруживаться с момента достижения ЧР. Результаты проведенного нами исследования показывают, что достижение молекулярной ремиссии возможно не только при использовании программ высокодозной химиотерапии, но и на фоне химиотерапии в стандартных дозах.

Определение чувствительности метода молекулярного мониторинга МРБ, способы повышения чувствительности ПЦР.

Чувствительность ПЦР, проводимой с пациент-специфичными праймерами, зависит от количества опухолевых клеток в исследуемом образце и от специфичности подобранной для конкретного больного системы праймеров. У всех больных, которым проводили молекулярный мониторинг эффективности лечения, была проанализирована зависимость чувствительности двухраундовой ПЦР, оцененная методом «предельных разведений», от процентного содержания плазматических клеток в первичных образцах костного мозга. Молекулярный маркер опухоли был обнаружен в образцах ДНК костного мозга при содержании плазматических клеток от 0.5 до 4%, однако, по данным исследования «методом предельных разведений» чувствительность оказалась достаточно низкой (в образцах – 10-1, еще в 2 - 10–2, в одном - 10–3). В тех случаях, когда процент плазматических клеток в костном мозге был 6.4%, чувствительность составила 10-3 - 10–4. В отношении образцов периферической крови можно с уверенностью говорить о существенно более низкой чувствительности исследования и отсутствии значимой зависимости от процента миеломных клеток в костном мозге.

Как и предполагалось, чувствительность ПЦР, оцененная методом «предельных разведений», в значительной степени зависит от процента плазматических клеток в первичных образцах костного мозга. Анализ результатов мониторинга реаранжировок генов IgH показал, что чувствительность метода двухраундовой ПЦР с пациент-специфичными праймерами в большинстве случаев достаточно высока и достигает 10-4. При недостаточной чувствительности подобранных тестсистем возможно повышение результативности реакции амплификации. В нашем исследовании наглядно продемонстрировано три методических подхода, позволяющих обнаруживать меньшее количество остаточных опухолевых клеток, а именно: 1) многократный повтор амплификации с одним и тем же образцом ДНК, 2) повышение концентрации исследуемой ДНК, 3) использование в качестве матрицы проб РНК. Кроме того, повышения чувствительности ПЦР можно добиться путем подбора оптимальной концентрации хлорида магния, цикловых режимов, температуры отжига, а также путем изменения системы праймеров.

Таким образом, метод двухраундовой полимеразной цепной реакции с пациентспецифичными праймерами хотя и является трудоемким, позволяет надежно и с высокой чувствительностью определять МРБ у больных ММ. К бесспорным положительным характеристикам метода можно отнести существование множества подходов для повышения чувствительности реакции амплификации.

Результаты статистического анализа.

множественной миеломой (n=38) вне зависимости от интенсивности проводимой химиотерапии. В анализ не включены двое пациентов, у которых были диагностированы болезнь Вальденстрема и острый плазмобластный лейкоз.

Оценка общей выживаемости представлена на рисунке 2.

Рисунок 2. Общая выживаемость больных ММ.

Как видно на представленной кривой 4-летняя общая выживаемость больных ММ составила около 73%. При сроке наблюдения 52 месяца медиана общей выживаемости не достигнута. На момент завершения исследования среди больных, которым в полном объеме была реализована стратегия высокодозной химиотерапии, живы без прогрессии 13 из 16. В то же время среди пациентов, которые были исходно приняты или переведены на стандартные программы лечения ММ, живы без прогрессии 9 из 19 больных (различия статистически достоверны, р=0,03).

Для отбора совокупности признаков, наиболее точно предсказывающих продолжительность жизни больных, был проведен многомерный пошаговый анализ выживаемости (модель пропорциональных рисков Кокса). В качестве исходного набора параметров для данного анализа были взяты следующие признаки: стадия заболевания, иммунохимический вариант множественной миеломы, показатели альбумина сыворотки, скорости оседания эритроцитов, креатинина, С-реактивного белка, бета2-микроглобулина, кальция, лактат дегидрогеназы, а также процент гомологии по нуклеотидной последовательности клональных VH-генов с герминальными вариабельными генами и семейство вариабельных генов. В результате работы пошаговой процедуры была выбрана группа наиболее значимых прогностических факторов, а именно, сывороточный альбумин, бета2-микроглобулин и процент гомологии вариабельных генов. В сочетании эти три параметра показали наиболее значительную взаимосвязь с продолжительностью жизни.

Мы также проанализировали время до достижения клинико-гематологической и молекулярной ремиссии в зависимости от исходных показателей альбумина (более или менее 35 г/л), бета2-микроглобулина (более или менее 4 мг/л) и процента гомологии вариабельных генов (более или менее 90%). Оказалось, что скорость развития и вероятность достижения эффекта ниже у пациентов, у которых в дебюте заболевания сывороточный альбумин был ниже 35 г/л, а 2микроглобулин выше 4 мг/л, причем полученные отличия статистически достоверны. В то же время никакой зависимости скорости развития ПР от мутационного статуса вариабельных генов нет (р=0,9319). Сходные данные получены при оценке скорости достижения молекулярной ремиссии. В частности у больных с исходным уровнем альбумина более 35 г/л медиана времени до констатации МР составила 1,5 года, в то время как у больных, у которых альбумин в дебюте заболевания составил менее 35 г/л, медиана данного показателя не достигнута (различия статистически достоверны, р=0,0457). Отличия, выявленные при определении зависимости скорости достижения МР от показателя 2микроглобулина, оказались статистически недостоверными (р=0,0975).

Зависимости скорости развития молекулярной ремиссии от мутационного статуса VH-генов не выявлено.

Анализ зависимости временных интервалов от момента установления диагноза ММ до достижения ПР и МР от таких факторов, как сывороточный альбумин и бета2-микроглобулин позволил отметить роль этих показателей в качестве маркеров реактивности процесса. Низкий уровень альбумина и повышенная концентрация 2-микроглобулина в дебюте заболевания не свидетельствуют о невозможности получения ремиссии, просто в этих случаях ремиссия достигается позже, а процент ее достижения ниже. Однако если ремиссия ММ достигается, этот факт значительно превалирует над прогностическими факторами, которые определяются в дебюте заболевания.

Выводы:

1. Клональная реаранжировка генов тяжелых цепей иммуноглобулинов выявлена у 90% больных парапротеинемическими гемобластозами. Перестройки VH-генов в опухолевых клетках не обнаружены только у больных миеломой Бенс-Джонса и несекретирующей миеломой.

2. Вероятность участия различных генных сегментов в формировании полноценного вариабельного гена иммуноглобулинов в опухолевых клетках у больных множественной миеломой соответствует таковой в нормальном репертуаре В-клеток, однако среди VH-генов первого семейства обращает на себя внимание аномально высокая частота использования сегмента VH1-69 (55,6%).

3. Установлено, что в опухолевых клетках всех больных парапротеинемическими гемобластозами в нуклеотидных последовательностях вариабельных генов IgH прошел процесс соматического гипермутирования. Степень гомологии с герминальными VH-генами составила 74,2-96%.

4. Нуклеотидная последовательность перестроенных генов IgH в опухолевых клетках у больных множественной миеломой отличается высокой стабильностью на разных этапах эволюции опухолевого клона, в нем не накапливаются дополнительные изменения структуры, в том числе соматические мутации.

5. В ходе терапии множественной миеломы молекулярный маркер опухоли в образцах периферической крови перестает обнаруживаться значительно раньше, чем в костном мозге, поэтому для мониторинга минимальной резидуальной болезни целесообразно использовать образцы костного мозга.

6. Программная химиотерапия (VAD, HDCph) ни у одного из больных ММ не привела к эрадикации опухолевого клона. Дальнейшая интенсификация лечения (EDAP) привела к уменьшению вероятности обнаружения молекулярного маркера опухоли до 77,8%. Молекулярная ремиссия констатирована у 5 больных, в том числе у 2-х пациентов на фоне «стандартного» воздействия.

7. В лейкоконцентратах, полученных методом лейкафереза после предшествующей стимуляции гранулоцитарным колониестимулирующим фактором, опухолевые клетки могут быть обнаружены более чем у половины от общего числа больных (64%). Вероятность их обнаружения напрямую зависит от степени редукции опухолевого клона до проведения сбора СКК.

Список опубликованных работ по теме диссертации:

1. В.А. Жеребцова, В.Г. Савченко, В.Л. Сурин, Л.П. Менделеева, Н.Г. Тюрина, А.В.

Мисюрин. Молекулярный мониторинг минимальной резидуальной болезни у пациентов с множественной миеломой. Материалы конференции «Новое в гематологии и клинической трансфузиологии», Проблемы гематологии и переливания крови, 2003, 2, стр. 40-41.

2. Жеребцова В.А., Савченко В.Г., Сурин В.Л., Менделеева Л.П., Тюрина Н.Г., Мисюрин А.В. Оценка эффективности различных методов лечения миеломной болезни с использованием высокочувствительных пациент-специфичных ПЦРсистем для тестирования опухолевого клона. Материалы конференции «Новое в гематологии и клинической трансфузиологии» Москва, 13-15 апреля 2004г.

Проблемы гематологии и переливания крови 2004, 2, стр. 36.

3. В.А. Жеребцова, В.Л. Сурин, А.В. Мисюрин, Н.Г. Тюрина, Л.П. Менделеева, В.Г.Савченко. Индивидуальный молекулярный мониторинг минимальной остаточной болезни при множественной миеломе. Материалы I РоссийскоАмериканской конференции «Биотехнология и онкология», 2005, 2, стр. 103-104.

4. Л.П. Менделеева, В.Г. Савченко, Н.Г. Тюрина, Е.Ю. Варламова, К.С. Момотюк, Л.С. Любимова, Е.О. Грибанова, Е.Н. Устинова, О.С. Покровская, Н.Е. Митиш, В.А.

Жеребцова, И.Б. Капланская, И.А. Воробьев, Е.М. Грецов, Н.Н. Калинин.

Высокодозная химиотерапия и аутотрансплантация при множественной миеломе.

Онкогематология, 2006, 1, стр. 55-57.

5. В.А. Жеребцова, В.Г.Савченко, В.Л. Сурин, Л.П. Менделеева, А.В. Мисюрин.

Молекулярный мониторинг минимальной резидуальной болезни при множественной миеломе. Проблемы гематологии и переливания крови, 2006, 2, стр. 25-31.

6. V. Zherebtsova, V. Surin, V. Savchenko, L. Mendeleeva, O. Pokrovskaya, N. Turina, A. Misurin. Individual molecular monitoring of minimal residual disease after autotranslantation in patients with multiple myeloma. Материалы международного симпозиума Европейской группы трансплантации костного мозга, 2007, стр. 143.



 


Похожие работы:

«Зимин Владислав Николаевич РЕЗУЛЬТАТЫ ПРИМЕНЕНИЯ СТЕНТОВ С АНТИПРОЛИФЕРАТИВНЫМ ПОКРЫТИЕМ В РЕНТГЕНОЭНДОВАСКУЛЯРНОМ ЛЕЧЕНИИ ХРОНИЧЕСКИХ ТОТАЛЬНЫХ ОККЛЮЗИЙ КОРОНАРНЫХ АРТЕРИЙ 14.01.26 - сердечно-сосудистая хирургия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2011 г. Работа выполнена в Научном Центре сердечно - сосудистой хирургии им. А.Н. Бакулева РАМН. Научные руководители: доктор медицинских наук, академик РАМН Бокерия Л.А. доктор...»

«ХАРБЕДИЯ Шалва Демнаевич СОСТОЯНИЕ И ПУТИ ОПТИМИЗАЦИИ СПЕЦИАЛИЗИРОВАННОЙ ПОМОЩИ СЕРОПОЗИТИВНЫМ ПО СИФИЛИСУ БЕРЕМЕННЫМ В УСЛОВИЯХ КОЖНО-ВЕНЕРОЛОГИЧЕСКОГО ДИСПАНСЕРА 14.02.03 – общественное здоровье и здравоохранение 14.01.10 – кожные и венерические болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Санкт-Петербург 2014 2 Работа выполнена на кафедре общественного здоровья и здравоохранения и кафедре дерматовенерологии Государственного...»

«Жиляева Юлия Александровна СОСТОЯНИЕ ЖЕСТКОСТИ СОСУДИСТОЙ СТЕНКИ И ФУНКЦИИ ЭНДОТЕЛИЯ У БОЛЬНЫХ ИШЕМИЧЕСКОЙ БОЛЕЗНЬЮ СЕРДЦА НА ФОНЕ ТЕРАПИИ СИМВАСТАТИНОМ ИЛИ АТОРВАСТАТИНОМ 14.01.05 – кардиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Курск – 2014 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Курский государственный медицинский университет Министерства здравоохранения...»

«Малюгина Татьяна Николаевна СОСТОЯНИЕ ГОМЕОСТАЗА И ПРОБЛЕМА АДАПТАЦИИ У ЛИЦ, ПЕРЕНЕСШИХ ДИФТЕРИЮ 14.00.10 – Инфекционные болезни 14.00.09 - Педиатрия Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва – 2009 Работа выполнена в ГОУ ВПО Саратовский ГМУ Росздрава Научные консультанты: академик РАМН, доктор медицинских наук, профессор Малеев Виктор Васильевич член-корреспондент РАЕН, доктор медицинских наук, профессор Зайцева Ирина Александровна...»

«ПОГРЕБНИЧЕНКО Игорь Викторович ЭФФЕКТИВНОЕ ИСПОЛЬЗОВАНИЕ ПЕЧЕНИ МУЛЬТИОРГАННОГО ДОНОРА ДЛЯ ТРАНСПЛАНТАЦИИ 14.01.24 - трансплантология и искусственные органы АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2014 Работа выполнена в ФГБУ Федеральный научный центр трансплантологии и искусственных органов им. академика В.И.Шумакова Минздрава России. Научный руководитель : Доктор медицинских наук, профессор Мойсюк Ян Геннадиевич Официальные...»

«МИРЗОЕВ НАТИГ МАЛИК-ОГЛЫ МИНИИНВАЗИВНОЕ ШУНТИРОВАНИЕ КОРОНАРНЫХ АРТЕРИЙ НА РАБОТАЮЩЕМ СЕРДЦЕ С ТОРАКОСКОПИЧЕСКОЙ УЛЬТРАЗВУКОВОЙ МОБИЛИЗАЦИЕЙ ВНУТРЕННИХ ГРУДНЫХ АРТЕРИЙ (экспериментальное исследование) /14.01.26 – сердечно-сосудистая хирургия/ АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2010 2 Работа выполнена в Научном Центре сердечно-сосудистой хирургии им. А.Н. Бакулева РАМН. Научные руководители: Бокерия Лео Антонович Академик...»

«Дегтярева Дарья Витальевна Объективные неинвазивные методы исследования голосовой функции у детей 14.01.03 –– болезни уха, горла, носа Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва–2014 2 Работа выполнена в ГБОУ ВПО Российский национальный исследовательский медицинский университет имени Н.И. Пирогова Министерства здравоохранения Российской Федерации Научный руководитель : доктор медицинских наук, профессор Радциг Елена Юрьевна...»

«ВОЕВОДИН Сергей Михайлович ДИФФЕРЕНЦИАЛЬНАЯ ДИАГНОСТИКА ЗАБОЛЕВАНИЙ И ПОРОКОВ РАЗВИТИЯ ЦЕНТРАЛЬНОЙ НЕРВНОЙ СИСТЕМЫ И ЛИЦА У ПЛОДА 14.01.01 – акушерство и гинекология 14.01.13 – лучевая диагностика, лучевая терапия Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва – 2012 1 Работа выполнена в отделении функциональной диагностики ФГУ Научный центр акушерства, гинекологии и перинатологии им. академика В.И. Кулакова Минздравсоцразвития России....»

«РАБАДАНОВ Гусейн Рабаданович МИНИИНВАЗИВНЫЕ МЕТОДЫ ЛЕЧЕНИЯ КИСТОЗНЫХ ОБРАЗОВАНИЙ ПОЧЕК У ДЕТЕЙ 14.01.19 – детская хирургия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Уфа – 2010 Работа выполнена в Государственном образовательном учреждение высшего профессионального образования Пермская государственная медицинская академия имени академика Е.А. Вагнера Федерального агентства по здравоохранению и социальному развитию Научный руководитель :...»

«ХАЧАТРЯН ЛИАНА ТОРНИКОВНА СТРУКТУРНО-ФУНКЦИОНАЛЬНЫЕ ОСОБЕННОСТИ ЭНДОМЕТРИЯ В ПОСТМЕНОПАУЗЕ 14.00.01 – Акушерство и гинекология Автореферат диссертации на соискание ученой степени кандидата медицинских наук МОСКВА 2008 2 Работа выполнена на кафедре акушерства и гинекологии с курсом перинатологии при ГОУ ВПО Российский университет дружбы народов Научный руководитель – профессор кафедры акушерства и гинекологии с курсом перинатологии РУДН, заведующий гинекологическим отделением...»

«Гурджидзе Теймураз Юрьевич Результаты лечения пациентов с мягкотканными дефектами дистальных отделов конечностей свободными микрохирургическими аутотрансплантатами 14.01.17 – хирургия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Диссертационный совет Д 001.027.02 Учреждение Российской академии медицинских наук Российский научный центр хирургий имени академика Б.В. Петровского РАМН 119991, г. Москва, ГСП 2, Абрикосовский переулок, д. 2....»

«Гришанова Татьяна Григорьевна КЛИНИКО-ПАТОГЕНЕТИЧЕСКАЯ И ПРОГНОСТИЧЕСКАЯ ЗНАЧИМОСТЬ НЕЙРОНСПЕЦИФИЧЕСКИХ БЕЛКОВ ПРИ ТЯЖЕЛЫХ ТРАВМАХ 14.03.03 – патологическая физиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Кемерово – 2011 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Кемеровская государственная медицинская академия Министерства здравоохранения и социального развития...»

«ХАФИЗОВА ФЛЮРА АСХАТОВНА КЛИНИКО-ЛАБОРАТОРНОЕ И ИММУНОМОРФОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ ТАКТИКИ ЛЕЧЕНИЯ РАЗНЫХ КЛИНИЧЕСКИХ ФОРМ ХРОНИЧЕСКОГО ТОНЗИЛЛИТА 14.01.03 – болезни уха, горла и носа 14.03.02 – патологическая анатомия Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва–2012 2 Работа выполнена в Уфимском филиале ФГБУ Научно-клинический центр оториноларингологии ФМБА России Научные консультанты: доктор медицинских наук, профессор Дайхес Николай...»

«БИТИЕВА Рита Лентоевна Оценка новых подходов к диагностике и терапии ротавирусной инфекции у детей 14.00.10 – Инфекционные болезни Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва – 2007 Работа выполнена в ФГУН Центральный научно-исследовательский институт эпидемиологии Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Научный руководитель : доктор медицинских наук, профессор Александр Васильевич...»

«НЕЧУШКИНА ВАЛЕНТИНА МИХАЙЛОВНА РАК ТЕЛА МАТКИ (ФАКТОРЫ ПРОГНОЗА И ТАКТИКА ЛЕЧЕНИЯ) 14.01.12 — онкология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук Москва — 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Российский онкологический научный центр имени Н.Н.Блохина Российской академии медицинских наук (директор — академик РАН и РАМН, профессор Давыдов М. И.) Научный консультант : доктор медицинских наук, профессор...»

«КАШИНЦЕВ Алексей Ариевич ЗНАЧЕНИЕ МОЛЕКУЛЯРНО – ГЕНЕТИЧЕСКИХ МЕТОДОВ В ДИАГНОСТИКЕ И ЛЕЧЕНИИ РАКА ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗЫ 14.01.12 – онкология 14.01.17 – хирургия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Санкт-Петербург – 2014 Работа выполнена в государственном бюджетном образовательном учреждении высшего профессионального образования Санкт-Петербургский Государственный педиатрический медицинский университет Министерства здравоохранения...»

«ХАМИДУЛЛИНА АЛЛА РИВГАТОВНА ВЛИЯНИЕ АНТИГИПЕРТЕНЗИВНЫХ СРЕДСТВ НА ПОКАЗАТЕЛИ ОБМЕНА ОКСИДА АЗОТА У БОЛЬНЫХ АРТЕРИАЛЬНОЙ ГИПЕРТОНИЕЙ 14.01.05 – кардиология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Казань – 2010 2 Работа выполнена в ГОУ ВПО Казанский государственный медицинский университет Федерального агентства по здравоохранению и социальному развитию доктор медицинских наук, профессор Научный руководитель : Галявич Альберт Сарварович...»

«ПИЛИПЕНКО ВЛАДИМИР ИВАНОВИЧ ЭФФЕКТИВНОСТЬ ПРИМЕНЕНИЯ ПРОБИОТИКОВ В КОМПЛЕКСНОМ ЛЕЧЕНИИ РАЗЛИЧНЫХ КЛИНИЧЕСКИХ ФОРМ СИНДРОМА РАЗДРАЖЕННОГО КИШЕЧНИКА 14.00.05 – Внутренние болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2008 2 Работа выполнена в ГУ Научно-исследовательском институте питания Российской академии медицинских наук Научный руководитель : доктор медицинских наук, профессор Исаков Василий Андреевич Официальные оппоненты :...»

«Гулян Кнар Спартаковна Клиническое и прогностическое значение мозгового натрийуретического пептида у кардиохирургических пациентов. (14.01.05 – кардиология) Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2011 1 Работа выполнена в Учреждении Российской академии медицинских наук Научный центр cердечно-cосудистой хирургии имени А.Н. Бакулева Российской академии медицинских наук. Научные руководители: доктор медицинских наук, академик РАМН...»

«ТЮРИКОВ Юрий Михайлович РАЗРАБОТКА ПРЕПАРАТА ИММУНОГЛОБУЛИНА ДЛЯ ВНУТРИВЕННОГО ВВЕДЕНИЯ И ИСПОЛЬЗОВАНИЕ ЕГО ДЛЯ ТЕРАПИИ ИММУНОДЕФИЦИТНЫХ СОСТОЯНИЙ 14.00.36. – аллергология и иммунология 14.00.29. – гематология и переливание крови Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва - 2008 Работа выполнена в Федеральном государственном учреждении науки Московский научно-исследовательский институт эпидемиологии и микробиологии им. Г.Н....»














 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.