WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

-1

На правах рукописи

Аксенова Елена Владиславовна

СТАНДАРТИЗИРОВАННОЕ ИССЛЕДОВАНИЕ ЭКСПРЕССИИ

ГЕНОВ BCR-ABL, PRAME И WT1

У БОЛЬНЫХ ХРОНИЧЕСКИМ МИЕЛОЛЕЙКОЗОМ

14.01.21 - гематология и переливание крови

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва, 2011 -2

Работа выполнена в Федеральном Государственном Бюджетном Учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации (ФГБУ ГНЦ Минздравсоцразвития) Научные руководители:

доктор медицинских наук, профессор Туркина Анна Григорьевна кандидат биологических наук Мисюрин Андрей Витальевич

Официальные оппоненты:

доктор медицинских наук, профессор Румянцев Сергей Александрович доктор биологических наук Хамаганова Екатерина Георгиевна Ведущее научное учреждение:

Учреждение Российской Академии Медицинских Наук Российский онкологический научный центр имени Н.Н. Блохина РАМН (РОНЦ им. Н.Н. Блохина РАМН)

Защита состоится 2011г.

на заседании диссертационного совета Д. 208.135.02.при Федеральном Государственном Бюджетном Учреждении Гематологический научный центр Минздравсоцразвития РФ по адресу: Москва, Новый Зыковский проезд, д.4а

С диссертацией можно ознакомиться в библиотеке ФГБУ Гематологический научный центр Минздравсоцразвития РФ

Автореферат разослан _2011г.

Ученый секретарь диссертационного Совета, кандидат медицинских наук Зыбунова Е.Е.

-3

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы исследования Транслокация (9;22) является специфической генетической аномалией, характерной для хронического миелолейкоза (ХМЛ). В результате этой реципрокной транслокации соединяются 5'-область гена BCR из 22 хромосомы и 3'- область гена ABL из 9 хромосомы, что приводит к образованию химерного онкогена BCR-ABL.

Онкоген BCR-ABL кодирует белок с нерегулируемой тирозинкиназной активностью, функционирование этого белка играет решающую роль в патогенезе заболевания (Melo JV, et al, 2004).

Молекулярный мониторинг экспрессии BCR-ABL методом полимеразной цепной реакции (ПЦР) в реальном времени является в настоящее время обязательным методом контроля лечения ХМЛ у пациентов на терапии ингибиторами тирозинкиназ (ИТК) 1 и 2 поколения. Достижение большого молекулярного ответа (БМО) признано показателем оптимальной терапии и важным прогностическим фактором безрецидивной выживаемости больных ХМЛ [Baccarani M, et al, 2009, Palandri F, et al, 2009].



Для адекватной оценки уровня транскрипта BCR-ABL применяемый метод молекулярного мониторинга должен обладать достаточной чувствительностью, воспроизводимостью и специфичностью. Множество существующих вариаций метода молекулярной диагностики не позволяют напрямую сравнивать результаты, получаемые в разных лабораториях, затрудняют совместное участие в научных и клинических исследованиях. Наиболее универсальным инструментом стандартизации методики признана концепция международной шкалы (International Scale, IS), переход на которую осуществляется путем обмена образцами с референсными лабораториями и вычисления фактора конверсии. Международная шкала позволяет представлять результаты мониторинга в единых координатах, создает общее информационное пространство для исследователей [Branford S, et al, 2008]. Однако до настоящего времени в России совершенно отсутствовал опыт подобной работы.

Опираясь на факт об одном основном генетическом происхождении ХМЛ, применяемая в настоящее время терапия ИТК позволяет целенаправленно блокировать функционирование белка BCR-ABL. Однако, несмотря на значительные успехи подобной терапии, у части больных не удается добиться оптимального ответа на лечение. По результатам международного исследования IRIS, только 60% больных, у которых терапия иматинибом была начата в ранней хронической фазе (РХФ), оставались на этой терапии через 7 лет после ее начала (O’Brien S G, et al, 2008). Причинами прекращения терапии явились прогрессия заболевания, неэффективность или непереносимость терапии. Полного цитогенетического ответа (ПЦО) на терапии иматинибом достигли 82% пациентов, 17 % из достигших ответа пациентов впоследствии его потеряли.

-4Клинические различия хронической фазы (ХФ) ХМЛ обусловлены, повидимому, биологической гетерогенностью заболевания. Известно, что при ХМЛ в опухолевой клетке, по сравнению с нормальной, существенно изменяется уровень экспрессии многих генов. Геномная нестабильность, наблюдаемая при ХМЛ, может являться следствием образования гена BCR-ABL, или наоборот, хромосомная транслокация возникает как последствие ранее существующей геномной нестабильности (Cilloni D, Saglio G, 2009).

Гены PRAME и WT1, по данным литературы, занимают одно из ключевых мест среди ряда генов, экспрессия которых значительно изменяется при ХМЛ. Так, при исследовании профиля экспрессии генов методом микроэрреев, PRAME и WT оказались в числе тех 10 генов из 3500 изученных, у которых экспрессия при прогрессии ХМЛ наиболее сильно отличалась от экспрессии в ХФ (Radich JP, et al, 2006).

Экспрессия гена PRAME в норме наблюдается в тканях репродуктивной системы и надпочечников, а гиперэкспрессия обнаружена при многих видах солидных опухолей и при гемобластозах, что позволило отнести белок PRAME к классу канцертестис антигенов (Epping MT, Bernards R, 2006). Экспрессия PRAME хорошо изучена при острых лейкозах, при которых в дебюте заболевания является признаком благоприятного прогноза. Данные о частоте и уровне экспрессии PRAME в разных фазах ХМЛ являются противоречивыми, что не позволяет однозначно определить его роль в прогрессии заболевания. Получены сообщения о негативном влиянии экспрессии PRAME на миелоидную дифференцировку (Oehler VG, et al, 2009).





Экспрессия транскрипционного фактора WT1 ассоциируется со многими злокачественными заболеваниями, в ряде случаев он рассматривается как онкосупрессор, а при гематологических заболеваниях как онкоген (Yang L, et al, 2007). При острых лейкозах повышенный уровень экспрессии WT1 имеет прогностическое значение и ассоциируется с плохим ответом на терапию. По мнению немецких исследователей, уровень экспрессии WT1 в фазе акселерации и бластном кризе ХМЛ может служить индикатором гематологического рецидива (Na IK, et al, 2005).

Однако о значении раннего выявления экспрессии генов WT1 и PRAME у больных ХМЛ на дальнейшее течение этого заболевание ничего не было известно.

Кроме того, ничего не было известно о работе этих генов у больных ХМЛ с мутациями BCR-ABL, приводящими к резистентности к терапии ИТК.

Получение информации о дополнительных молекулярных механизмах в патогенезе ХМЛ и анализ их функционирования при прогрессии заболевания может помочь в разработке критериев прогноза эффективности терапии. Изучение динамики экспрессии гена BCR-ABL и других генов, экспрессия которых изменяется при ХМЛ, сопоставление этих параметров для более детальной характеристики биологии заболевания, послужило основанием для проведения собственных исследований.

Анализ молекулярно-биологических особенностей хронического миелолейкоза на основе изучения закономерностей экспрессии генов BCR-ABL, PRAME, WT1 у больных, получающих терапию ингибиторами тирозинкиназ.

Задачи исследования:

1.Разработать на основе ПЦР в реальном времени диагностические тест-системы для количественной оценки экспрессии генов BCR-ABL, PRAME, WT1, провести стандартизацию метода определения экспрессии гена BCR-ABL.

2. Осуществить валидацию метода молекулярной оценки экспрессии гена BCRABL путем сравнения параметров молекулярного и цитогенетического ответов.

3. Определить, как уровень экспрессии BCR-ABL у больных в хронической фазе ХМЛ, получающих терапию иматинибом и достигших полного цитогенетического ответа, коррелирует с дальнейшим течением заболевания.

4. Изучить закономерности достижения молекулярного ответа у больных ХМЛ, получающих терапию иматинибом, и оценить прогностическое значение экспрессии BCR-ABL на ранних сроках терапии.

5. Определить частоту встречаемости и уровень экспрессии генов PRAME и WT1, оценить взаимосвязь уровня экспрессии этих генов с уровнем экспрессии гена BCRABL и возможное прогностическое значение их экспрессии у больных ХФ ХМЛ в дебюте заболевания и при терапии иматинибом.

6. Сравнить экспрессию генов PRAME и WT1 у больных ХФ ХМЛ с оптимальным ответом на терапию иматинибом и у больных, резистентных к терапии, сопоставить экспрессию этих генов с мутационным статусом гена BCR-ABL у резистентных больных.

Научная новизна:

Впервые показано, что уровень экспрессии генов PRAME и WT1 отражает наблюдаемые у больных ХМЛ различия в ответах на терапию иматинибом, установлена ассоциация между экспрессией гена PRAME и мутационным статусом гена BCR-ABL. Обнаружен высокий уровень экспрессии гена BCR-ABL у ряда больных ХМЛ с полным цитогенетическим ответом, получавших терапию иматинибом. У больных с уровнем экспрессии гена BCR-ABL равным или превышающим 1% IS, зафиксированным при полном цитогенетическом ответе, продемонстрирована значительная вероятность цитогенетического рецидива. На ранних этапах лечения иматинибом установлены пороговые значения экспрессии гена BCR-ABL, характерные для больных ХМЛ с последующей неудачей данного вида терапии. Показано, что при достижении полного цитогенетического ответа методом, наиболее полно отражающим динамику опухолевого клона, является молекулярный мониторинг экспрессии гена BCR-ABL.

Стандартизация метода молекулярного мониторинга экспрессии гена BCR-ABL позволяет представить данные об экспрессии гена BCR-ABL у больных ХМЛ, полученные в лаборатории генной инженерии ФГБУ ГНЦ, в международной шкале в единицах IS. Пересчет данных молекулярного мониторинга, полученных в лаборатории за несколько лет, в формат международной шкалы, дал возможность объединить данные экспрессии BCR-ABL в регистре больных ХМЛ РФ и оценить результаты мониторинга в течение длительного периода терапии. Использование шкалы IS позволяет применять данные молекулярного мониторинга для оценки эффективности терапии больных ХМЛ в соответствии с общепринятыми критериями ответа на терапию, рекомендованными международным консорциумом European Leukemia Net (ELN) и другими межклиническими и межлабораторными исследовательскими группами.

Опыт лаборатории генной инженерии ФГБУ ГНЦ по проведению молекулярного мониторинга успешно применяется в других российских лабораториях, что ведет к существенному повышению качества диагностики и мониторинга ХМЛ в нашей стране. Применение дополнительных молекулярных маркеров расширяет возможности дифференцированной оценки клинических проявлений ХМЛ и дает возможность выявить неблагоприятные варианты течения этого заболевания.

Внедрение результатов в практику: Лаборатория генной инженерии ФГБУ ГНЦ применяет разработанный метод молекулярной оценки экспрессии BCR-ABL для диагностики и мониторинга ХМЛ у пациентов ФГБУ ГНЦ, городской клинической больницы им. С.П. Боткина, МОНИКИ им. М.Ф. Владимирского, и других гематологических отделений и клиник Российской Федерации. Созданные в ходе исследования тест-системы используются в ряде диагностических лабораторий Российской Федерации: ОДКБ №1 г. Екатеринбург, КНИИГ и ПК г. Киров, РостГМУ г. Ростов-на-Дону, ОДКБ г. Архангельск.

Основные положения, выносимые на защиту:

1. Характеристики стандартизованного метода мониторинга экспрессии BCRABL, разработанного в лаборатории генной инженерии, отвечают необходимым международным требованиям по чувствительности, линейности и стабильности.

2. Уровень экспрессии гена BCR-ABL в периферической крови больных ХМЛ коррелирует с процентным содержанием Ph-позитивных клеток в костном мозге этих же больных. Мониторинг уровня экспрессии BCR-ABL позволяет отслеживать динамику опухолевой нагрузки.

3. У больных ХМЛ, достигших полного цитогенетического ответа на терапии иматинибом, наблюдается широкий разброс значений молекулярного ответа, при ответа.

4. Уровень экспрессии гена BCR-ABL у больных ХМЛ на ранних этапах терапии иматинибом позволяет прогнозировать достижение цитогенетического и молекулярного ответа.

5. Высокая частота гиперэкспрессии гена PRAME характерна для резистентных к терапии иматинибом больных ХФ ХМЛ с мутациями киназного домена гена BCRABL, при этом частота гиперэкспрессии PRAME не коррелирует с уровнем опухолевой нагрузки.

6. Гиперэкспрессия гена WT1 в большей степени характерна для пациентов с высокой экспрессией гена BCR-ABL и служит дополнительным маркером плохого прогноза и резистентности у больных ХФ ХМЛ при терапии иматинибом.

Публикации:

По теме диссертации опубликовано 16 печатных работ в отечественной и зарубежной литературе.

Апробация работы:

Работа апробирована 05.07.2010 г. на заседании проблемной комиссии «Гемопоэз, молекулярная биология, биотехнология, иммуногематология;

гемобластозы и депрессии кроветворения» ФГБУ Гематологический научный центр Минздравсоцразвития.

Основные положения диссертационной работы доложены на VI симпозиуме НИИДГ «Биологические основы терапии онкологических и гематологических заболеваний» (январь 2009г., Москва), на Всероссийском декаднике по гематологии (ГНЦ, апрель 2009г., апрель 2010г., Москва), на 15-м Конгрессе Европейской Гематологической Ассоциации (июнь 2010г., Барселона).

Объем и структура работы:

Материалы диссертации изложены на 138 страницах машинописного текста.

Работа состоит из введения, обзора литературы, главы материалов и методов исследования, главы собственных исследований и обсуждения результатов, заключения, выводов и списка литературы. Библиографический указатель содержит 202 источника литературы. Работа иллюстрирована 14 таблицами и 16 рисунками.

Работа выполнена в лаборатории генной инженерии ФГБУ ГНЦ (руководитель к.б.н. А.В. Мисюрин). Большинство больных ХМЛ, включенных в исследование, являлись пациентами отделения химиотерапии лейкозов и патологии эритрона (руководитель – д.м.н., проф. Н.Д. Хорошко) и поликлинического отделении (руководитель – д.м.н., проф. Л.Г. Ковалева) ФГБУ ГНЦ Минздравсоцразвития РФ (генеральный директор – член-корр. РАМН, д.м.н., проф. В.Г.Савченко).

-8СОДЕРЖАНИЕ РАБОТЫ

Материалы и методы Основные определения Фазы ХМЛ: 1) ранняя хроническая фаза (РХФ) - хроническая фаза с длительностью заболевания менее 6 месяцев; 2) поздняя хроническая фаза (ПХФ) хроническая фаза с длительностью заболевания более 6 месяцев; 3) 2-я хроническая фаза (2-я ХФ) – больные, ранее имевшие клинические признаки фазы акселерации, которые в момент исследования находились в гематологической ремиссии.

Цитогенетический ответ (ЦО) определяется по процентному содержанию Phпозитивных клеток (клеток с транслокацией (9;22)) в пунктате костного мозга.

Выделяют: 1) полный цитогенетический ответ (ПЦО) - 0% Ph+, 2) частичный цитогенетический ответ (ЧЦО) - 1-35% Ph+, 3) малый цитогенетический ответ (МЦО) - 36-95% Ph+, 4) отсутствие цитогенетического ответа - 95-100% Ph+. ПЦО и ЧЦО были объединены под названием большой цитогенетический ответ (БЦО).

Большой молекулярный ответ (БМО)- уровень транскрипта BCR-ABL 0,1% по международной шкале Ответ на терапию интерпретировался как оптимальный, субоптимальный и неудача терапии в соответствии с критериями ELN (Baccarani M, et al, 2009).

Характеристика больных В исследование включено 322 больных ХМЛ, из них 265 пациентов из ГНЦ, остальные 57 пациентов из клиник Москвы, Московской области и других регионов России. Информация обо всех пациентах внесена в регистр больных ХМЛ России.

288 больных на момент исследования находились в ХФ ХМЛ, 34 больных во 2-й ХФ.

Всего было исследовано 1250 образцов периферической крови.

На терапии иматинибом в момент исследования находилось 268 больных, на терапии ИТК 2 линии после неудачи терапии иматинибом находилось 40 больных в ХФ ХМЛ и 14 больных во 2-й ХФ. Из 34 больных во 2-й ХФ 20 находились на терапии иматинибом (медиана срока терапии 66 месяцев), 14 на терапии ИТК 2 линии после неудачи терапии иматинибом (медиана срока терапии 34,4 месяца).

Изучение параметров молекулярного мониторинга экспрессии гена BCR-ABL проводилось для 213 больных в ХФ ХМЛ на терапии иматинибом.. Медиана возраста больных на момент диагноза составила 40,5 лет (9-68). Медиана длительности заболевания на момент исследования составила 84 месяца (от 5 до 244 месяцев). Доза иматиниба в разные периоды наблюдения колебалась от 300 до 800 мг/сутки. (36,6%) больных на момент начала терапии иматинибом находились в РХФ, (63,4%) больных находились в ПХФ.

Исследование экспрессии генов PRAME и WT1 проводилось у 154 больных ХМЛ, 120 больных находилось в ХФ, 34 – во 2-й ХФ. У всех этих пациентов составили 16 человек, не имеющих гематологических и онкологических заболеваний:

8 сотрудников лаборатории и 8 доноров крови.

Методы исследования Выделение РНК проводилось гуанидин тиоционат хлороформ-фенольным методом (Chomczynski P, Sacchi N, 1987) из периферической крови и костного мозга больных ХМЛ. Реакцию обратной транскрипции проводили с использованием набора случайных нуклеотидных гексамеров в качестве праймеров и обратной транскриптазы M-MLV (Promega).

Количественное определение экспрессии генов BCR-ABL, PRAME и WT проводилось методом ПЦР в реальном времени по технологии TaqMan с использованием приборов IQ Cycler (BioRad) и Applied Biosystems 7500.

Флуоресцентный сигнал определяли при 600С с использованием фильтров для FAM.

В качестве положительных контролей (стандартов) использовали разведения плазмид с известным числом копий, с вставкой участка соответствующего гена. Количество копий каждого гена в образцах пациентов определялось по калибровочной кривой, построенной по 10-кратным разведениям стандартов. Экспрессия генов вычислялась как относительная: число копий изучаемого гена/ число копий контрольного гена х100%. Все значения экспрессии BCR-ABL, используемые в работе, представлены в формате международной шкалы (International Scale, IS). Последовательность используемых праймеров и зондов приведена в таблице 1.

Клонирование фрагментов генов и очистка полученных плазмид, содержащих вставку соответствующего гена, осуществлялось с использованием вектора pGEM®-T Easy и набора Wizard® Plus SV Minipreps DNA Purification System (Promega), по стандартной методике производителя.

Определение мутаций в киназном домене гена BCR-ABL проводилось методом прямого секвенирования после амплификации фрагмента гена в двухстадийной ПЦР реакции с использованием тест-системы производства ООО «Генотехнология».

Секвенирование осуществлялось в ЦКП «Геном» РФФИ (руководитель к.б.н. А.Б.

Полтараус) в институте молекулярной биологии им. Энгельгарта.

Стандартное цитогенетическое исследование (СЦИ) клеток костного мозга было выполнено в кариологической лаборатории ГНЦ (руководитель д.м.н., профессор Е.В.

Домрачева). Исследование проводилось прямым методом и методом культивирования клеток с равномерной и G-дифференциальной окраской хромосом (G-banding).

Статистическая обработка данных Статистическая обработка данных проводилась с помощью электронных таблиц Excel и пакета STATISTICA 6.0, и включала в себя определение медианы, определение вероятности потери ответа методом Каплан-Майер. Для оценки достоверности различий применялись 2 критерий Пирсона для связанных таблиц, критерии Манн-Уитни, Краскал-Уоллеса, log-Rank тест. Консультации по проведению ряда этапов статистического анализа осуществлялись лабораторией медицинской статистики ГНЦ (руководитель – к.т.н. Куликов С.М.).

Таблица 1. Нуклеотидные последовательности праймеров и зондов, используемых для определения экспрессии генов BCR-ABL, PRAME, WT1 и ABL.

ENR561 CACTCAGACCCTGAGGCTCAA

ENF501 TCCGCTGACCATCAAYAAGGA

BCR-ABL

WT1F CAGGCTGCAATAAGAGATATTTTAAGCT

WT1R GAA GTC ACA CTG GTA TGG TTT CTC A

PRM RQ F GGA CTC TTT ATT TTT CCT TAG AGG C

PRM RQ R TAT TGA GAG GGT TTC CAA GG

PRAME

ENF1003 TGGAGATAACACTCTAAGCATAACTAAAGG

ENR ABL TAG TTG CTT GGG ACC CAG CC

Основные результаты работы и их обсуждение Разработка тест-систем для количественной оценки экспрессии генов BCRABL, PRAME, WT1 методом ПЦР в реальном времени, определение характеристик метода и его стандартизация Разработка тест-систем для количественной оценки экспрессии генов включала в себя: 1) качественный и количественный подбор компонентов для реакций выделения РНК, обратной транскрипции, ПЦР в реальном времени (праймеров, зондов, буфера, полимеразы); 2) подбор температурных и временных параметров реакции ПЦР в реальном времени; 3) создание положительных контролей и достижение осуществлялись по параметрам реакции ПЦР в реальном времени: эффективность реакции; коэффициент детерминации R2; значение порогового цикла (Ct) и коэффициент вариации для него (CV%); чувствительность.

Характеристики используемых нами положительных контролей практически не изменялись при длительном хранении при температуре +4С и многократном использовании, наблюдалась высокая стабильность контролей и воспроизводимость значений (таблица 2). Стабильность характеристик положительных контролей позволяет добиться высокой точности и воспроизводимости в определении экспрессии генов в образцах пациентов в течение длительного периода мониторинга.

Таблица 2. Значения эффективности, коэффициента детерминации (R2), порогового цикла (Ct) и коэффициента вариации (CV%) реакции ПЦР в реальном времени, проведенной на контрольных плазмидах с разным сроком хранения Для метода количественного определения экспрессии гена BCR-ABL при разведении клеток линии К-562 клетками здорового донора была достигнута чувствительность 0,01% IS, что соответствует одной опухолевой клетке на здоровых. При разведении РНК больного ХМЛ РНК здорового донора детектировалось разведение 10-4, что соответствовало экспрессии 0, 003% IS. Для контрольных плазмид была достигнута воспроизводимая чувствительность копий/мкл, коэффициент вариации для 96 повторов составил 1,86%. Полученные значения чувствительности удовлетворяют требованиям, предъявляемым международными исследовательскими группами для данного метода (Gabert J, et al, 2003, Hughes T, et al, 2006).

При разработке тест-систем для генов Prame и WT1 применялись те же подходы и требования, что и для гена BCR-ABL, для этих генов достигнуты сходные с BCRABL значения чувствительности, воспроизводимости и стабильности.

Метод количественного определения экспрессии гена BCR-ABL, разработанный и применяемый в лаборатории генной инженерии ГНЦ, был стандартизован по международной шкале путем двухэтапного обмена образцами клеток больных ХМЛ с референсной лабораторией. Метод стандартизации был предложен и осуществлен для европейских лабораторий референсной лабораторией в Мангейме, Германия (Mller конверсии, который составил 0,9631. Умножение результатов экспрессии BCR-ABL, полученных в лаборатории, на фактор конверсии, позволяет представлять значения экспрессии в формате международной шкалы (IS): BCR-ABL/ABLх100%x 0,9631.

Данные молекулярного мониторинга, полученные в лаборатории за несколько лет и выраженные в других единицах измерения (log, %) были пересчитаны в формат международной шкалы. Это позволило объединить данные экспрессии BCRABL в общей базе данных и оценить результаты мониторинга в течение длительного периода терапии.

Использование международной шкалы позволяет сравнивать результаты различных стандартизованных лабораторий между собой, участвовать в международных клинических и научных исследованиях. Стандартизация подтверждает также то, что метод, используемый в лаборатории генной инженерии, обладает такими необходимыми характеристиками, как эффективность амплификации, чувствительность, линейность и стабильность во времени.

Сопоставление данных молекулярного и цитогенетического анализа Для валидации разработанного метода молекулярной диагностики было проведено сопоставление значений экспрессии BCR-ABL, полученных методом ПЦР в реальном времени в периферической крови больных ХМЛ, и значений процентного содержания Ph-позитивных клеток в костном мозге этих же больных, полученных при СЦИ. Сопоставление данных осуществлялось на 274 образцах больных ХФ ХМЛ, у которых оба анализа были выполнены одновременно.

Было подтверждено наличие положительной корреляции между процентным содержанием Ph-позитивных клеток и уровнем экспрессии BCR-ABL. Коэффициент ранговой корреляции Спирмена составил 0,713 (p0,0001). В трех группах больных с разным уровнем цитогенетического ответа: 1) отсутствие ЧЦО, n=63; 2) ЧЦО, n=43;

3) ПЦО, n=168 – обнаружены значимые различия по медиане уровня экспрессии BCRABL (p0,0001). Значения медианы уровня экспрессии BCR-ABL в этих трех группах составили 64,4%, 6,1%, 0,07% соответственно.

Каждая группа с определенным уровнем цитогенетического ответа неоднородна по структуре молекулярного ответа (МО), в ней есть образцы с более высокой и более низкой экспрессией. Группа пациентов с ПЦО оказалась наиболее неоднородна по составу образцов с разным уровнем молекулярного ответа, экспрессия BCR-ABL колеблется от недетектируемого уровня транскрипта до уровня экспрессии свыше 10% (рисунок 1). Такая неоднородность показывает, что при отсутствии цитогенетически детектируемых Ph-позитивных клеток у больных ХМЛ сохраняется некоторый остаточный объем опухолевой массы, и может значительно варьировать как этот объем, так и интенсивность экспрессии BCR-ABL, что подтверждает необходимость молекулярного мониторинга у больных с ПЦО.

разным цитогенетическим ответом На основании этих же данных было установлено, что уровню экспрессия BCRABL 1% в 91,4% случаев соответствует ПЦО, а уровню экспрессии от 1 до 10% в 82,4% случаев соответствует БЦО. При уровне экспрессии BCR-ABL выше 10% в большинстве случаев наблюдается отсутствие БЦО. Это вполне согласуется с данными, полученными другими исследователями (Ross DM, et al, 2006) и позволяет по уровню молекулярного ответа судить об опухолевой нагрузке и при необходимости проводить примерную оценку цитогенетического ответа, что особенно важно, когда цитогенетический анализ не может быть проведен.

Вероятность сохранения ПЦО у больных с разным уровнем МО Отличия в уровне экспрессии BCR-ABL у больных с ПЦО заставляют предположить, что дальнейшее течение заболевания у таких больных может быть различно. У 45 больных ХФ ХМЛ с ПЦО на терапии иматинибом сроком 24- месяцев, была проведена оценка вероятности сохранения ПЦО при дальнейшей терапии в зависимости от уровня экспрессии BCR-ABL.

59 образцов этих больных были разделены на три группы по уровню экспрессии BCR-ABL. Для групп с уровнем экспрессии BCR-ABL 0,1% (n=31), от 0,1% до 1% (n=15) и более 1% (n=13) вероятность сохранения ПЦО через год составила 93%, 90% и 35% соответственно. Через три года вероятность составила 63%, 47% и 9% для каждой из групп соответственно (рисунок 2). Группы с более низкой экспрессией значимо отличались по этому параметру от группы с экспрессией более 1% (p0, и p=0,0011, log-Rank тест). Медиана сохранения ПЦО в группах с экспрессией от 0,1% до 1% и более 1% составила 32,5 и 7,9 месяцев соответственно.

Вероятность сохранения ПЦО Рис.2. Вероятность сохранения ПЦО у больных ХФ ХМЛ с разным уровнем экспрессии BCR-ABL.

Можно заключить, что две части нашего исследования привели к одному и тому же выводу – уровень экспрессии BCR-ABL равный 1%, у пациентов с ПЦО является пограничным значением для сохранения ПЦО, при превышении этого уровня вероятность потери ПЦО значительно возрастает. Именно при значениях экспрессии 1% и выше необходимо рекомендовать дополнительно к молекулярному мониторингу выполнять цитогенетическое исследование, чтобы вовремя диагностировать цитогенетический рецидив.

Взаимосвязь уровня экспрессии BCR-ABL у больных ХФ ХМЛ на ранних сроках лечения и достижения молекулярного и цитогенетического ответа на терапии иматинибом Уже на ранних этапах терапии иматинибом у больных ХФ ХМЛ наблюдаются существенные различия в уровне экспрессии гена BCR-ABL. У больных с продолжительностью терапии иматинибом 6 и 12 месяцев (n= 25 и n= соответственно) уровень экспрессии колебался от недетектируемого уровня до уровня более 100%. Больные в каждой из этих временных точек были разделены на три группы по уровню экспрессии BCR-ABL. В каждой группе оценивались два параметра: 1) доля пациентов, достигших БМО к 24 месяцам терапии; 2) доля терапию оценивался на срок 12 месяцев, и интерпретировался как оптимальный, субоптимальный и неудача терапии.

Между группами с разным уровнем экспрессии BCR-ABL на 6 месяцев терапии получены значимые различия по доле больных, достигших цитогенетического ответа (р=0,00039) и по доле больных с БМО (р=0,00022) (таблица 3). На 12 месяцев терапии иматинибом нет различий по достижению ЦО между группами с экспрессией BCRABL 0,1% и c экспрессией от 0,1 до 10%. При объединении двух первых групп в одну и сравнения ее с группой с экспрессией более 10% наблюдаются значимые различия по доле больных, достигших цитогенетического ответа (p0,0001). При этом все три группы значимо различаются по доле больных, достигших БМО к 24 месяцам терапии иматинибом (p0,0001) (таблица 3).

Таблица 3. Достижение ЦО и БМО у больных ХФ ХМЛ с разным уровнем экспрессии BCR-ABL на 6 и 12 месяцев терапии иматинибом.

экспрессия ЦО на терапии иматинибом, % больных БМО к Полученные данные демонстрируют, что различия в уровне экспрессии BCRABL у больных ХФ ХМЛ на ранних этапах терапии отражают биологическую гетерогенность опухолевых клеток, проявляющуюся в возможности дальнейшего ответа на терапию иматинибом. Уровень экспрессии BCR-ABL к 6 месяцев терапии является весьма информативным и позволяет достаточно четко прогнозировать дальнейший цитогенетический и молекулярный ответ. Прогностическая роль уровня экспрессии BCR-ABL к 12 месяцев терапии по достижению ЦО невелика, однако прогностическое значение уровня экспрессии на этот срок по достижению МО остается значительным. Можно заключить, что уровень экспрессии BCR-ABL у больных ХФ ХМЛ 10% и более на сроки 6 и 12 месяцев в значительной степени служит показателем неудачи проводимой терапии, а уровень 0,1% и менее на срок месяцев – показателем дальнейшего оптимального ответа.

больных ХМЛ в ХФ при разной длительности терапии иматинибом и во 2-й ХФ Изучение экспрессии генов PRAME и WT1 у больных ХМЛ в различных временных точках терапии и в разных фазах позволит полнее понять роль этих генов в развитии и прогрессии заболевания.

Частота и уровень экспрессии генов PRAME и WT1 были исследованы в следующих группах больных ХМЛ: первичные больные в ХФ, не получавшие терапии, больные в ХФ на сроках терапии иматинибом 12 и 18 месяцев, и больные во 2-й ХФ. Было введено понятие гиперэкспрессии. Под гиперэкспрессией понималась экспрессия, превышающая медиану экспрессии у здоровых доноров на один порядок, для PRAME это значение составило 0,063% и выше, для гена WT1 – 0,035% и выше.

Частота гиперэкспрессии PRAME в этих группах значимо не различалась (рисунок 3). При этом медиана уровня гиперэкспрессии PRAME увеличилась у больных ХФ на терапии иматинибом по сравнению с первичными больными более чем на порядок (таблица 4). У больных во 2-й ХФ медиана уровня гиперэкспрессии была немного ниже уровня у больных ХФ на терапии иматинибом, но превышала уровень у первичных больных также примерно на порядок. Для гиперэкспрессии гена WT1 была продемонстрирована другая закономерность – в группах больных на 12 и 18 месяцев терапии иматинибом и в группе больных во 2-й ХФ значительно уменьшалась частота гиперэкспрессии по сравнению с группой первичных больных (p0,0001), а медиана уровня гиперэкспрессии изменялась мало (рисунок 3, таблица 4). Частота гиперэкспрессии WT1 не различалась в группах больных в ХФ на терапии иматинибом и в группе больных во 2-й ХФ.

доля больных с гиперэкспессией, Рис. 3. Частота гиперэкспрессии генов PRAME и WT1 у больных ХМЛ в ХФ на разных сроках терапии иматинибом и в 2-й ХФ и WT1 у больных ХМЛ в ХФ на разных сроках терапии иматинибом и у больных ХМЛ во 2-й ХФ.

Группы больных Таким образом, в нашем исследовании не было обнаружено значимых различий в частоте и уровне экспрессии генов PRAME и WT1 у больных ХФ и 2-й ХФ ХМЛ на терапии ИТК. Можно заключить, что заболевание в фазе акселерации с последующей нормализацией клинических показателей на терапии ИТК не приводит к стойкому (необратимому) изменению экспрессии этих генов.

Соотношение уровней экспрессии генов BCR-ABL, PRAME и WT1 у больных ХФ ХМЛ на терапии иматинибом. Зависимость последующего ответа на терапию иматинибом от уровня экспрессии генов PRAME и WT1 у больных ХФ ХМЛ Для изучения закономерностей изменения экспрессии генов PRAME и WT1 у больных ХФ ХМЛ на разных сроках терапии иматинибом была исследована корреляция уровней экспрессии этих генов и гена BCR-ABL, уровень экспрессии которого отражает размер опухолевой массы. Уровень экспрессии BCR-ABL закономерно уменьшается при терапии иматинибом, в группах первичных больных, больных со сроком терапии 12 и 18 месяцев медиана этого уровня составила 72,4%, 0,33% и 0,14% соответственно (таблица 4).

Была обнаружена положительная корреляция уровня экспрессии BCR-ABL и уровней экспрессии PRAME и WT1 на срок 12 месяцев терапии, коэффициент корреляции Спирмена составил 0,36 (р=0,019) и 0,52 (р=0,0005) соответственно.

Корреляция уровней экспрессии генов BCR-ABL и WT1 сохраняется и на срок месяцев терапии (коэффициент корреляции 0,66, p0,0001), корреляция между экспрессией BCR-ABL и PRAME теряется. В группе первичных больных значимой корреляции между экспрессией этих трех генов обнаружено не было (таблица 5).

Таким образом, корреляция экспрессии генов PRAME и WT1 с экспрессией BCR-ABL не является высокой, но при этом зависимость между экспрессией WT1 и BCR-ABL более значительная и сохраняется на более длительный срок.

экспрессии BCR-ABL у больных ХФ ХМЛ.

Группы больных первичные (n=26) Наличие изменений в частоте и уровне экспрессии и положительная корреляция экспрессии PRAME и WT1 с экспрессией BCR-ABL у больных ХМЛ на разных сроках терапии иматинибом позволяют предположить, что экспрессия PRAME и WT1 может служить показателем дальнейшего ответа на терапию. Была проведена оценка корреляции уровня экспрессии генов PRAME, WT1 и BCR-ABL у больных ХФ ХМЛ в группах первичных больных, на срок 12 и 18 месяцев терапии иматинибом с МО через год после исследования. МО оценивался следующим образом:1) хороший экспрессия BCR-ABL 0,1%; 2) промежуточный - экспрессия BCR-ABL от 0,1% до 10%; 3) плохой - экспрессия BCR-ABL 10%.

Экспрессия PRAME и WT1 на срок 12 месяцев терапии иматинибом коррелирует с МО через год, коэффициент корреляции составляет 0,33 и 0,49 соответственно (таблица 6). На срок 18 месяцев терапии и у первичных больных корреляции экспрессии PRAME и WT1 с последующим ответом не обнаружено. Экспрессия гена BCR-ABL на сроки 12 и 18 месяцев терапии коррелирует с МО через год после исследования, коэффициент корреляции составляет 0,8 и 0,71 соответственно, что значительно выше, чем коэффициенты для PRAME и WT1.

Таблица 6. Корреляция уровней экспрессии PRAME, WT1 и BCR-ABL на разных сроках терапии иматинибом с молекулярным ответом через год после исследования у больных ХФ ХМЛ Корреляция уровней экспрессии с молекулярным ответом Группы больных первичные (n=26) гиперэкспрессией генов PRAME и WT, и с отсутствием гиперэкспрессии на срок месяцев терапии достигает БМО через год после исследования, т.е. к 24 месяцам терапии. Доля больных, достигших БМО к 24 месяцам терапии, была достоверно ниже у больных с гиперэкспрессией WT1 (р=0,0078). Из 11 больных с гиперэкспрессией WT1 ни один не достиг БМО к 24 месяцам, из 26 больных с отсутствием гиперэкспрессии, БМО к 24 месяцам достигли 50%. Доля больных, достигших БМО, была также существенно ниже в группе с гиперэкспрессией PRAME, чем в группе с отсутствием гиперэкспрессии, и составила 16,7% (2 из 12) и 44% (11 из 25) соответственно. Однако эти различия оказались на грани достоверности (р=0,086).

Таким образом, гиперэкспрессия генов PRAME и WT1 на 12 месяцев терапии является дополнительным признаком неблагоприятного прогноза у больных ХФ ХМЛ на терапии иматинибом.

Экспрессия генов PRAME и WT1 у больных ХФ ХМ, резистентных к терапии иматинибом и больных с оптимальным ответом на терапию. Корреляция с мутационным статусом гена BCR-ABL Была проведена оценка экспрессии PRAME и WT1 в двух группах больных ХФ ХМЛ с разным ответом на терапию иматинибом (по критериям ELN 2009 г.). Группу больных, резистентных к терапии иматинибом, составили 64 больных, которые не достигли ПЦО на терапии иматинибом или потеряли достигнутый на этой терапии ПЦО. На момент исследования 24 из них получали терапию иматинибом (медиана срока терапии 28 месяцев), 40 больных получали терапию ИТК 2 линии (медиана срока терапии 16 месяцев). В подгруппах резистентных больных, получавших терапию иматинибом и ИТК 2 линии, не было значительных отличий в медиане уровня BCR-ABL и в доле больных с гиперэкспрессией PRAME и WT1, поэтому мы сочли возможным оценивать группу резистентных больных целиком. Группу больных с оптимальным ответом составили больные, достигшие ПЦО к 12 месяцам терапии иматинибом, медиана срока терапии на момент исследования составила месяцев (n=23). Медиана экспрессии BCR-ABL составила в этих группах 74,6% и 0,3% соответственно.

Группы значимо отличались по доле больных с гиперэкспрессией WT1(р=0,013), по доле больных с гиперэкспрессией PRAME отличий между группами не обнаружено (р=0,148) (рисунок 4).

% больных с гиперэкспрессией Рис. 4. Гиперэкспрессия генов PRAME и WT1 у больных ХФ ХМЛ с разным ответом на терапию иматинибом Больные, резистентные к терапии иматинибом, были разделены на группы с отсутствием мутаций киназного домена BCR-ABL (n=41) и с наличием мутаций (n=23). Медиана экспрессии BCR-ABL составила в этих группах 31,2% и 113,9% соответственно.

Были обнаружены значимые различия между группами по доле больных с гиперэкспрессией PRAME (р=0,0018), по доле больных с гиперэкспрессией WT группы значимо не отличались(р=0,247) (рисунок 5).

Суммируя результаты этой части исследования, можно заключить, что доля пациентов с гиперэкспрессией PRAME практически не зависит от опухолевой нагрузки, а корреляция уровня экспрессии этого гена с экспрессией BCR-ABL невысока, так же, как и прогностическая значимость экспрессии этого гена по достижению молекулярного ответа. Частота гиперэкспрессии PRAME не отражает наличие резистентности к иматинибу, но при этом коррелирует с мутационным статусом резистентных больных. Можно предположить, что экспрессия PRAME связана с клеточными процессами, которые не зависят напрямую от тирозинкиназной активности BCR-ABL, а скорее являются следствием общей геномной нестабильности в клетках пациентов ХМЛ.

Частота гиперэкспрессии гена WT1 значимо коррелирует с опухолевой нагрузкой и наиболее высока в группах первичных и резистентных к терапии больных ХМЛ, имеющих высокий уровень экспрессии BCR-ABL. Более значительная корреляция уровня экспрессии WT1 с экспрессией BCR-ABL и прогностическая роль экспрессии этого гена могут являться отражением возможной взаимосвязи гиперэкспрессии WT с тирозинкиназной активностью BCR-ABL.

% больных с гиперэкспрессией Рис. 5. Гиперэкспрессия генов PRAME и WT1 у резистентных больных ХФ ХМЛ в группах с наличием и отсутствием мутаций киназного домена BCR-ABL Практические рекомендации:

Количественное определение экспрессии BCR-ABL должно являться обязательным компонентом мониторинга минимальной остаточной болезни при ХМЛ. В случае, когда проведение цитогенетического анализа невозможно, определение уровня экспрессии BCR-ABL позволяет отслеживать динамику изменения опухолевого клона. Необходимо руководствоваться тем, что уровню экспрессии BCR-ABL 1% соответствует в большинстве случаев ПЦО, а уровню экспрессии от 1% до 10% соответствует БЦО. Уровень экспрессии выше 10% при сроках терапии иматинибом 6 и более месяцев является показателем неудачи проводимой терапии.

У больных с ПЦО молекулярное исследование является единственным методом контроля остаточного объема опухолевой массы. При сроках терапии иматинибом и более месяцев уровень экспрессии BCR-ABL 1% и выше увеличивает вероятность потери цитогенетического ответа, поэтому рекомендуется более частое проведение молекулярного и цитогенетического анализа.

Поскольку уровень экспрессии BCR-ABL уже на ранних стадиях терапии иматинибом служит прогностически значимым показателем дальнейшего ответа на терапию, проведение молекулярной диагностики на срок 6 месяцев терапии является необходимым компонентом мониторинга. Мы полагаем также, что определение уровня BCR-ABL на срок 3 месяца терапии является весьма информативным и желательным.

Определение экспрессии генов PRAME и WT1 у больных ХМЛ позволит получить дополнительную информацию о состоянии лейкемического клона. Наличие у больного гиперэкспрессии гена WT1, наряду с высокой экспрессией BCR-ABL, резистентных к терапии больных может служить показанием к проведению мутационного анализа.

1. Разработан и стандартизован метод молекулярного мониторинга ХМЛ, основанный на ПЦР в реальном времени. Метод обладает высокой чувствительностью (0,01% IS по разведениям клеточных линий, 10-4 по разведениям РНК), достоверностью (CV=1,9% для плазмиды 10 копий/мкл), линейностью (R20,99) и стабильностью (CV от 0,3% до 0,9% для контрольных плазмид).

2. Доказана положительная корреляция (r=0,713, p0,0001) между процентным содержанием Ph-позитивных клеток и уровнем экспрессии BCR-ABL у больных ХФ ХМЛ. Группы пациентов с разным цитогенетическим ответом значимо отличаются по медиане экспрессии BCR-ABL (p0,0001).

3. Выявлена зависимость между уровнем экспрессии BCR-ABL и вероятностью цитогенетического рецидива у больных в хронической фазе ХМЛ с полным цитогенетическим ответом (после 24 месяцев терапии иматинибом). Пороговым значением, существенным для сохранения полного цитогенетического ответа, является уровень экспрессии BCR-ABL равный 1% IS.

4. Установлено, что уровень экспрессии BCR-ABL 10% и более к 6 и 12 месяцам терапии иматинибом у больных в хронической фазе ХМЛ служит показателем неудачи проводимой терапии, а уровень 0,1% и менее к 6 месяцам терапии – показателем дальнейшего оптимального ответа.

5. Показано, что при терапии иматинибом (сроки 12 и 18 месяцев) у больных в хронической фазе ХМЛ по сравнению с первичными больными значительно снижается доля больных с гиперэкспрессией гена WT1 и увеличивается медиана гиперэкспрессии гена PRAME. Частота и уровень гиперэкспрессии генов PRAME и WT1 не отличается у больных ХМЛ в хронической фазе и во 2-й хронической фазе.

6. Обнаружено, что гиперэкспрессия генов PRAME и WT1 к 12 месяцам терапии иматинибом является дополнительным признаком неблагоприятного прогноза у больных в хронической фазе ХМЛ. Выявлена корреляция уровней экспрессии генов WT1 и PRAME с экспрессией BCR-ABL у больных в хронической фазе ХМЛ после месяцев терапии иматинибом ( r=0,52, р=0,0005 и r=0,36, р=0,019 соответственно) и корреляция уровней экспрессии WT1 и BCR-ABL после 18 месяцев терапии (r=0,66, р0,0001).

7. Выявлено, что гиперэкспрессия гена WT1 является маркером резистентности к терапии иматинибом у больных в хронической фазе ХМЛ и существует взаимосвязь между наличием мутаций в киназном домене гена BCR-ABL и частотой гиперэкспрессии гена PRAME у резистентных к терапии больных.


БМО – большой молекулярный ответ БЦО – большой цитогенетический ответ ДНК – дезоксирибонуклеиновая кислота ИТК – ингибиторы тирозинкиназ МО – молекулярный ответ МЦО – малый цитогенетический ответ ПХФ – поздняя хроническая фаза ПЦО – полный цитогенетический ответ ПЦР – полимеразная цепная реакция РНК – рибонуклеиновая кислота РХФ – ранняя хроническая фаза СЦИ - стандартное цитогенетическое исследование ХМЛ – хронический миелолейкоз ХФ – хроническая фаза 2-я ХФ – вторая хроническая фаза ЦО – цитогенетический ответ ЧЦО – частичный цитогенетический ответ CV – коэффициент вариации ELN – European Leukemia Net IS – International Scale, международная шкала Список работ, опубликованных по теме диссертации:

1. Аксенова Е.В., Лисовская Е.В., Демидова И.В., Шуравина Е.Н., Вернюк М.А., Мисюрин А.В. Тест-системы на основе метода ОТ-ПЦР для определения экспрессии химерных онкогенов при лейкозах // Здравоохранение и медицинская техника. 2005.

№ 2(16) стр. 2. A.V. Misyurin, E.V. Aksenova, E.Ju. Chelysheva, A.G. Turkina, N.D. Khoroshko.

PRAME and BCR/ABL gene expression analysis for quantitative monitoring of MRD in CML by means of Real Time PCR // The Hematology Journal : The abstracts for the 9th Congress of EHA- June 2004 - abstr. 3. E.Yu. Chelysheva, A.G. Turkina, A.V. Misiurin, N.D. Khoroshko, E.V. Aksenova, A.V. Zakharova, E.V. Domracheva, G.A. Druzhkova, T.I. Kolosheinova. Monitoring of minimal residual disease for the patients with CML receiving interferon alpha and Glivec

- 24 therapy// The Hemalogy Journal: The abstracts for the 9th Congress of EHA- June 2004 abstr. 945.

4. E.Y. Chelysheva, A.G. Turkina, A.V. Misyurin, E.V. Aksenova, G.A. Druzhkova, T.I. Kolosheinova, L.Y. Kolosova, M.A. Sokolova, O.Y. Vinogradova, T.V. Ivanova. The results of monitoring of minimal residual disease for the patients with chronic myeloid leukemia receiving interferon alpha and Glivec therapy // The Hemalogy Journal: The abstracts for the 10th Congress of EHA - June 2005 -abstr. 1205.

5. E.Y. Chelysheva, A.G. Turkina, A.V. Misyurin, E.V. Aksenova, E.V. Domracheva, A.V. Zakharova, N.D. Khoroshko. Clinical significance of quantitative real-time PCR for monitoring of minimal residual disease for patients with chronic myeloid leukemia in chronic phase receiving Glivec therapy // The Hemalogy Journal: The abstracts for the 11th Congress of EHA - June 2006 - abstr. 1149.

6. E.V. Aksenova, A.V. Misyurin, Yu.P. Finashutina, M.V. Suchkova, A.A. Krutov, E.Y. Chelysheva, A.G. Turkina, N.D. Khoroshko. Divergence of relative BCR-ABL expression level in CML patients during 5 year period of imatinib treatment // The Hemalogy Journal: The abstracts for the 12th Congress of EHA - June 2007- abstr. 1362.

7. Yu.P. Finashutina, E.V. Aksenova, A.V. Misyurin, A.G. Turkina, N.D. Khoroshko, M.I. Lukashina, A. Yu. Baryshnikov. PRAME expression in chronic myeloid leukemia // The Hemalogy Journal: The abstracts for the 12th Congress of EHA - June 2007- abstr.

1015.

8. Челышева Е.Ю., Туркина А.Г., Мисюрин А.В., Аксенова Е.В., Домрачева Е.В., Захарова А.В., Хорошко Н.Д. Мониторинг минимальной остаточной болезни у больных с ХМЛ: клиническое значение ПЦР в режиме реального времени // Терапевтический архив, 2007, 79(4): 49-53.

9. А.В.Мисюрин, Е.В.Аксенова, А.А.Крутов, А.В.Лукьяненко, Ю.П.Финашутина, М.В.Сучкова, В.В.Тихонова, Е.Ю.Челышева, И.Н.Солдатова, А.Г.Туркина, Н.Д.Хорошко. Молекулярная диагностика хронического миелолейкоза // Гематология и трансфузиология. – 2007.- №2.- С.35-40.

10. E.V. Aksenova, E.Yu. Chelysheva, A.A. Krutov, I.N. Soldatova, A.V. Misyurin, O.Yu. Vinogradova, G.A. Gusarova, E.S. Zakharova, M.A. Sokolova, I.S. Nemchenko, S.V. Kuznetsov, O.V. Lazareva, A.V. Vorontsova, T.I. Kolosheinova, L.Yu. Kolosova, S.R.

Goryacheva, T.V. Ivanova, A.G. Turkina, N.D. Khoroshko. Complete molecular response in patients with chronic myeloid leukemia on imatinib therapy // The Hemalogy Journal: The abstracts for the 15th Congress of EHA - June 2010- abstr.0827.

11. E.V. Aksenova, A.A. Krutov, A.V. Misyurin, I.N. Soldatova, L.A. Kesaeva, A.G.

Turkina, N.D. Khoroshko. Correlation between PRAME, WT1 and BCR-ABL expression and response to the therapy at CML // The Hemalogy Journal: The abstracts for the 15th Congress of EHA - June 2010- abstr. 1303.

12. A.V.Misyurin, E.V. Aksenova, A.A. Krutov, I.N. Soldatova, L.A. Kesaeva, A.G.

Turkina, N.D. Khoroshko. WT1 and PRAME expression in CML patients predict imatinib

- 25 resistance and BCR/ABL gene mutations // The Hemalogy Journal: The abstracts for the

15th Congress of EHA - June 2010- abstr.0800.

13. Е.В.Аксенова, А.А. Крутов, И.Н. Солдатова, А.В. Мисюрин. Стандартизация молекулярной диагностики хронического миелолейкоза. Международный опыт и шаги российских лабораторий в этом направлении // Медицинская генетика. 2010.

Материалы VI Съезда Российского общества медицинских генетиков. Стр. 14. Е.В.Аксенова, А.А. Крутов, И.Н. Солдатова, Е.Ю. Челышева, О.Ю.

Виноградова, С.В. Кузнецов, М.А. Соколова, О.В. Лазарева, Т.И. Колошейнова, Л.Ю.

Колосова, С.Р. Горячева, Т.В. Иванова, А.Г. Туркина, Н.Д. Хорошко, А.В. Мисюрин.

Молекулярный мониторинг у пациентов с ХФ хронического миелолейкоза на терапии гливеком: итоги 5-ти летней работы в ГНЦ РАМН // Медицинская генетика. 2010.

Материалы VI Съезда Российского общества медицинских генетиков. Стр.4-5.

15. Е.В.Аксенова, А.А. Крутов, И.Н. Солдатова, Е.Ю. Челышева, А.Г. Туркина, Н.Д. Хорошко, А.В. Мисюрин. Молекулярный мониторинг у пациентов с хроническим миелолейкозом: корреляция с цитогенетическим ответом, прогностическое значение, оценка ответа на терапию // Клиническая онкогематология, 2010, №2, стр.151-159.

16. Е.В.Аксенова, А.А. Крутов, И.Н. Солдатова, Т.В. Ахлынина, Н.А. Лапшина, А.В. Мисюрин. Стандартизация молекулярной диагностики хронического миелолейкоза // Клиническая онкогематология, 2010, №2, стр.160-165.



 


Похожие работы:

«КИМИРИЛОВА Ольга Геннадьевна КЛИНИЧЕСКОЕ ЗНАЧЕНИЕ ПОКАЗАТЕЛЕЙ МИКРОБИЦИДНОЙ СИСТЕМЫ ЛЕЙКОЦИТОВ И ФИБРОНЕКТИНА ПЛАЗМЫ КРОВИ ПРИ АРБОВИРУСНЫХ МЕНИНГИТАХ У ДЕТЕЙ 14. 00. 09 – педиатрия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Астрахань – 2009 Работа выполнена в ГОУ ВПО Астраханская государственная медицинская академия Федерального агентства по здравоохранению и социальному развитию доктор медицинских наук, профессор Научный руководитель...»

«Забокрицкий Николай Александрович ОБОСНОВАНИЕ НАПРАВЛЕНИЙ В РАЗРАБОТКЕ И ЭКСПЕРИМЕНТАЛЬНОМ ИЗУЧЕНИИ НОВЫХ ФАРМАКОЛОГИЧЕСКИХ ПРЕПАРАТОВ НА ОСНОВЕ ПРОБИОТИКОВ И ИХ БИОЛОГИЧЕСКИ АКТИВНЫХ ПРОДУКТОВ 14.03.06 – Фармакология, клиническая фармакология Автореферат диссертации на соискание ученой степени доктора медицинских наук Челябинск – 2014 Работа выполнена на кафедре фармакологии и клинической фармакологии Государственного бюджетного образовательного учреждения высшего...»

«ОГАНЕСЯН Самвел Сергеевич ХИРУРГИЯ РИНОСКОЛИОЗА 14.00.04 – Болезни уха горла и носа Автореферат диссертации на соискание ученой степени доктора медицинских наук Санкт-Петербург – 2009 2 Работа выполнена в Федеральном государственном учреждении СанктПетербургский научно-исследовательский институт уха, горла, носа и речи Федерального агентства по высокотехнологичной медицинской помощи Научный консультант : Заслуженный врач РФ, доктор медицинских наук, профессор Янов Ю. К....»

«КРЮЧКОВА ЕЛЕНА НИКОЛАЕВНА НАУЧНО-МЕТОДИЧЕСКИЕ ПОДХОДЫ ЛАБОРАТОРНОЙ ДИАГНОСТИКИ К ИЗУЧЕНИЮ ФУНКЦИОНАЛЬНОГО ПОТЕНЦИАЛА РАБОТАЮЩЕГО НАСЕЛЕНИЯ 14.02.01 - Гигиена АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Москва-2012 2 Работа выполнена в ФБУН Федеральный научный центр гигиены им.Ф.Ф.Эрисмана Федеральной службы по надзору в сфере защиты прав потребителей и благополучия человека Научные консультанты: доктор биологических наук, профессор Юдина...»

«Гапонова Надежда Ильинична Совершенствование системы оказания скорой медицинской помощи больным с гипертоническими кризами на догоспитальном этапе 14.01.05 – Кардиология (мед. наук и) 14.02.03 – Общественное здоровье и здравоохранение (мед. науки) Автореферат диссертации на соискание ученой степени доктора медицинских наук Москва – 2012 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Московский государственный...»

«ЛИТВИН ЕВГЕНИЙ АЛЕКСАНДРОВИЧ БИОТРАНСФОРМАЦИЯ И ФАРМАКОКИНЕТИКА НОВОГО ПРОТИВОПАРКИНСОНИЧЕСКОГО ПРЕПАРАТА ГИМАНТАНА (ЭКСПЕРИМЕНТАЛЬНОЕ ИССЛЕДОВАНИЕ) 14.03.06 – фармакология, клиническая фармакология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва - 2012 Работа выполнена в Федеральном государственном бюджетном учреждении “Научно-исследовательском институте фармакологии имени В.В.Закусова” Российской академии медицинских наук (ФГБУ “НИИ...»

«ГУСЕВ АЛЕКСАНДР ОЛЕГОВИЧ НАУЧНОЕ ОБОСНОВАНИЕ ОРГАНИЗАЦИИ ОТДЕЛЕНИЙ ВОССТАНОВИТЕЛЬНОГО ЛЕЧЕНИЯ БОЛЬНЫХ С ЗАБОЛЕВАНИЯМИ СИСТЕМЫ КРОВООБРАЩЕНИЯ В КРУПНОМ МНОГОПРОФИЛЬНОМ СТАЦИОНАРЕ Автореферат диссертации на соискание ученой степени доктора медицинских наук 14.02.03-общественное здоровье и здравоохранение Санкт - Петербург 2014 Работа выполнена на кафедре общественного здоровья и здравоохранения с курсом экономики и управления здравоохранением государственного бюджетного...»

«Хамидова Джамиля Магомедрасуловна ЭОЗИНОФИЛЬНЫЙ КАТИОННЫЙ ПРОТЕИН КАК ДИАГНОСТИЧЕСКИЙ МАРКЕР ХРОНИЧЕСКОГО РЕЦИДИВИРУЮЩЕГО ПОЛИПОЗНОГО РИНОСИНУСИТА И АЛЛЕРГИЧЕСКОГО РИНИТА 14.01.03 – болезни уха, горла и носа 14.03.09 – клиническая иммунология, аллергология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва–2012 2 Работа выполнена в Федеральном государственном бюджетном учреждении Научно-клинический центр оториноларингологии ФМБА России...»

«ЖУРАВЛЕВА Мария Сергеевна МОРФОФУНКЦИОНАЛЬНЫЕ ОСОБЕННОСТИ ОРГАНОВ ПИЩЕВАРЕНИЯ ПРИ НАСЛЕДСТВЕННЫХ ЗАБОЛЕВАНИЯХ С СИНДРОМОМ МАЛЬАБСОРБЦИИ 14.01.04 – внутренние болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Санкт-Петербург 2014 2 Работа выполнена на кафедре пропедевтики внутренних болезней государственного бюджетного образовательного учреждения высшего профессионального образования Северо-Западный государственный медицинский университет...»

«Покровская Ольга Станиславовна КРОВЕТВОРНАЯ ТКАНЬ И СТРОМАЛЬНОЕ МИКРООКРУЖЕНИЕ В ПРОЦЕССЕ ИНТЕНСИВНОЙ ТЕРАПИИ И МОБИЛИЗАЦИИ ГЕМОПОЭТИЧЕСКИХ СТВОЛОВЫХ КЛЕТОК У БОЛЬНЫХ МНОЖЕСТВЕННОЙ МИЕЛОМОЙ 14.01.21 – Гематология и переливание крови АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва-2011 Работа выполнена в Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития...»

«Стаценко Владислав Игоревич СОСТОЯНИЕ ФЕРМЕНТНЫХ СИСТЕМ БИОТРАНСФОРМАЦИИ ЛЕКАРСТВЕННЫХ СРЕДСТВ (СYР3А4 И СYР2С9) У БОЛЬНЫХ С ХРОНИЧЕСКИМИ ДИФФУЗНЫМИ ЗАБОЛЕВАНИЯМИ ПЕЧЕНИ 14.03.06 – фармакология, клиническая фармакология АВТОРЕФЕРАТ Диссертации на соискание ученой степени кандидата медицинских наук Волгоград – 2013 г. 1 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Волгоградский государственный медицинский...»

«Липатова Ирина Степановна АЛЛОИММУНИЗАЦИЯ ГРУППОВЫМИ АНТИГЕНАМИ ЭРИТРОЦИТОВ (ИНДИВИДУАЛЬНЫЕ И ПОПУЛЯЦИОННЫЕ ОСОБЕННОСТИ) 14. 00. 29 – гематология и переливание крови АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва, 2009 2 Работа выполнена в Учреждении Российской академии медицинских наук Гематологический научный центр РАМН, г. Москва, филиале Дзержинская станция переливания крови Государственного учреждения здравоохранения Нижегородская...»

«ГОЛОВИНСКИЙ Сергей Владимирович МНОГОФАКТОРНАЯ ОЦЕНКА И ЗАЩИТА СТРУКТУРНО-ФУНКЦИОНАЛЬНОГО СОСТОЯНИЯ ЛЕГКИХ У ДОНОРОВ СО СМЕРТЬЮ ГОЛОВНОГО МОЗГА 14.01.24 – трансплантология и искусственные органы АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва - 2014 Работа выполнена в Государственном бюджетном учреждении здравоохранения г. Москвы Научно-исследовательский институт скорой помощи имени Н.В. Склифосовского Департамента здравоохранения г....»

«Масленников Антон Васильевич ОСОБЕННОСТИ ТЕЧЕНИЯ БЕРЕМЕННОСТИ И РОДОВ У ЖЕНЩИН С НЕДИФФЕРЕНЦИРОВАННОЙ ДИСПЛАЗИЕЙ СОЕДИНИТЕЛЬНОЙ ТКАНИ 14.01.01. – акушерство и гинекология Автореферат диссертации на соискание ученой степени кандидата медицинских наук Уфа – 2014 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования Башкирский государственный медицинский университет Министерства здравоохранения Российской Федерации Научный...»

«Серебренникова Елена Викторовна ОЦЕНКА КРИТЕРИЕВ РИСКА ВОЗНИКНОВЕНИЯ ПОСТИНТУБАЦИОННЫХ СТЕНОЗОВ ТРАХЕИ 14.01.17 – Хирургия 14.01.20 – Анестезиология и реаниматология Автореферат диссертации на соискание учёной степени кандидата медицинских наук Кемерово – 2012 2 Работа выполнена в Государственном бюджетном образовательном учреждении дополнительного профессионального образования Новокузнецкий государственный институт усовершенствования врачей Министерства здравоохранения и...»

«Коровина Татьяна Ивановна Клинико-инструментальная оценка эффективности последовательной эрадикационной терапии у больных эрозивно-язвенными поражениями желудка и двенадцатиперстной кишки, ассоциированными с Helicobacter pylori 14.01.04 – Внутренние болезни (мед. наук и) Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва – 2014 2 Работа выполнена в Государственном бюджетном образовательном учреждении высшего профессионального образования...»

«1 НА ПРАВАХ РУКОПИСИ СЕРЕБРОВА СВЕТЛАНА ЮРЬЕВНА СРАВНИТЕЛЬНАЯ КЛИНИЧЕСКАЯ ФАРМАКОЛОГИЯ СОВРЕМЕННЫХ ИНГИБИТОРОВ ПРОТОННОЙ ПОМПЫ 14.00.25 – Фармакология, клиническая фармакология 14.00.05 – Внутренние болезни АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора медицинских наук МОСКВА 2009 2 Работа выполнена в Московской медицинской академии им. И.М.Сеченова Научные консультанты: Заслуженный деятель науки РФ, Академик РАМН, доктор медицинских наук, профессор Кукес Владимир Григорьевич...»

«Дегтярева Дарья Витальевна Объективные неинвазивные методы исследования голосовой функции у детей 14.01.03 –– болезни уха, горла, носа Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва–2014 2 Работа выполнена в ГБОУ ВПО Российский национальный исследовательский медицинский университет имени Н.И. Пирогова Министерства здравоохранения Российской Федерации Научный руководитель : доктор медицинских наук, профессор Радциг Елена Юрьевна...»

«Лазарева Ольга Вениаминовна ИНФОРМАЦИОННЫЕ ТЕХНОЛОГИИ МОНИТОРИНГА И АНАЛИЗА ОТДАЛЕННЫХ РЕЗУЛЬТАТОВ ТЕРАПИИ БОЛЬНЫХ ХРОНИЧЕСКИМ МИЕЛОЛЕЙКОЗОМ 14.01.21 - Гематология и переливание крови АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва, 2011 Работа выполнена в Федеральном государственном бюджетном учреждении Гематологический научный центр Министерства здравоохранения и социального развития Российской Федерации Научный руководитель : доктор...»

«Красильникова Богдана Борисовна Первичные лимфатические опухоли орбиты и придаточного аппарата глаза 14.00.29 – Гематология и переливание крови АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва – 2009 Работа выполнена в Учреждении Российской академии медицинских наук Гематологическом научном центре РАМН. Научные руководители: кандидат медицинских наук, доцент Кравченко С.К. доктор медицинских наук, профессор Гришина Е.Е. Официальные...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.