WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

МОИСЕЕВА ЕЛЕНА НИКОЛАЕВНА

АМПЕРОМЕТРИЧЕСКИЕ ДНК-СЕНСОРЫ НА ОСНОВЕ

СТАЦИОНАРНЫХ ЭЛЕКТРОДОВ ДЛЯ ОПРЕДЕЛЕНИЯ ТЯЖЕЛЫХ

МЕТАЛЛОВ И ФАРМПРЕПАРАТОВ И ДЛЯ ИЗУЧЕНИЯ

ПРОЦЕССА ГИБРИДИЗАЦИИ ДНК

02.00.02 – аналитическая химия

АВТОРЕФЕРАТ

Диссертации на соискание ученой степени кандидата химических наук

Казань – 2006

Работа выполнена на кафедре неорганической химии Химического института им. А.М. Бутлерова государственного образовательного учреждения высшего профессионального образования «Казанского государственного университета им. В.И. УльяноваЛенина»

Научный руководитель доктор химических наук, профессор Бабкина Софья Сауловна

Официальные оппоненты доктор химических наук, профессор Евтюгин Геннадий Артурович кандидат химических наук, старший научный сотрудник Халдеева Елена Владимировна

Ведущая организация Казанский государственный технологический университет (КГТУ)

Защита состоится «16» ноября 2006 г. в 14.00 ч. на заседании диссертационного Совета К 212.081.04 по химическим наукам Казанского государственного университета по адресу: ул. Кремлевская 18, КГУ, Бутлеровская аудитория.

С диссертацией можно ознакомиться в научной библиотеке им. Н.И. Лобачевского Казанского государственного университета.

Отзывы на автореферат просим направлять по адресу:

420008, г. Казань, ул. Кремлевская 18, КГУ, Научная часть.

Автореферат разослан «13» октября 2006 г.

Ученый секретарь диссертационного Совета, кандидат химических наук Л.Г. Шайдарова

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. Определение и изучение взаимодействия эффекторов ДНК различной природы является актуальной проблемой современной аналитической химии. К таким эффекторам относятся, в частности, тяжелые металлы, противоопухолевые препараты и комплементарные фрагменты цепи ДНК. Эти эффекторы имеют высокое сродство к молекулам ДНК организма, поэтому их определение с помощью ДНК как аналитического реагента и ДНК-содержащих аналитических систем, в том числе с помощью электрохимических биосенсоров (БС) на основе ДНК, очень перспективно и актуально.





Известно, что тяжелые металлы, в частности медь и кобальт, являются необходимыми (эссенциальными) для организма, так как они, наряду с железом, принимают участие в образовании гема и их недостаток приводит к развитию злокачественных анемий. С другой стороны, согласно решению Целевой группы по выбросам Европейской экономической комиссии ООН содержание данных тяжелых металлов в биосфере должно строго контролироваться, и данные металлы признаны генотоксичными Межународным агентством по исследованию раковых заболеваний.

Эффекторами ДНК являются также цитостатики - противоопухолевые препараты, которые прочно связываются с ее цепями и подавляют синтез ДНК раковых клеток. Однако, с целью снижения возможных побочных эффектов и подбора правильной индивидуальной дозировки препаратов, выяснения их фармакокинетики является актуальным определение данных фармпрепаратов в многокомпонентных биологических жидкостях, в том числе в сыворотке крови человека.

В эколого-аналитическом мониторинге тяжелых металлов и в анализе противоопухолевых препаратов в объектах окружающей среды и в биологических жидкостях применяется ряд стандартных методов – это методы масс-спектрометрии, атомно-абсорбционной спектрометрии, спектрофотометрии и др. Однако применение их на практике имеет ряд недостатков, например дорогостоящее оборудование, длительность проведения анализа и пробоподготовки и др.

В последнее время становится крайне актуальным новое направление в аналитической химии – изучение биохимического процесса гибридизации ДНК. Он основан на комплементарности азотистых оснований ДНК и применяется для расшифровки генетической информации, определения повреждений в структуре ДНК (вызванных химическими, либо физическими факторами) и генетических аномалий, а также для ранней диагностики заболеваний различной природы. Электрохимические ДНК-зонды, или геносенсоры, широко применяются на практике для изучения процесса гибридизации ДНК, поскольку их изготовление и применение достаточно просто, не требует квалифицированного персонала, а определения экспрессны и чувствительны.

Цель исследования. Разработка и оптимизация биоаффинных методов определения эффекторов ДНК различной природы – тяжелых металлов на примере ионов меди и кобальта и противоопухолевых препаратов – адрибластина и онковина, и изучение биохимического процесса гибридизации ДНК с помощью разработанных амперометрических ДНК-сенсоров на основе стационарных электродов.

Для достижения поставленной цели необходимо было решить следующие задачи:

• получение количественных характеристик процесса комплексообразования эффекторов с денатурированной неиммобилизованной и различными формами иммобилизованной ДНК с целью оптимизации биоаффинного метода их определения;

• изучение специфической адсорбции тяжелых металлов в процессе их мембранного концентрирования на БС и определение аффинных констант связывания тяжелых металлов с иммобилизованной на мембране д-ДНК (д-ИДНК);





• на основании полученных данных разработать методики определения тяжелых металлов и фармпрепаратов в модельных растворах и реальных образцах природной воды и сыворотки крови;

• разработать и оптимизировать ДНК-зонд на основе синтетических олигонуклеотидов для определения последовательности азотистых оснований ДНК в ее фрагментах;

• оценить возможность применения разработанного геносенсора в анализе реальных образцов ДНК с длинной последовательностью нуклеотидов.

Научная новизна полученных в диссертации результатов заключается в том, что • проведено изучение комплексообразования различных форм ДНК с ее эффекторами – ионами тяжелых металлов Cu(II) и Co(II) и получены количественные характеристики: константы устойчивости, константы связывания, доли комплексных форм для целенаправленной разработки амперометрических ДНК-сенсоров и методов определения на их основе;

• построены изотермы биоаффинной сорбции тяжелых металлов на ДНКмодифицированной мембране на примере ионов меди (II) и кобальта(II), позволившие установить максимальную сорбционную емкость биочувствительной части сенсора и возможность определения данных металлов в совместном присутствии;

• получены количественные характеристики комплексообразования молукул цитостатиков, являющихся интеркаляторами, с иммобилизованной ренатурированной ДНК, подтверждающие целесообразность использования выбранной формы ДНК при иммобилизации в составе БС;

• разработаны биоаффинные методы определения тяжелых металлов и противоопухолевых препаратов с помощью ДНК-сенсоров на основе СРПЭ;

• достигнута высокая чувствительность и селективность при определении малых концентраций эффекторов в многокомпонентных системах путем предварительного биоаффинного мембранного концентрирования на ДНКсенсоре;

• разработан новый аффинный амперометрический БС на основе иммобилизованных в нитроцеллюлозной матрице олигонуклеотидов, то есть ДНКзонд, в котором для упрощения и достижения экспрессности анализа совмещены поверхность гибридизации и детектирующая поверхность;

• предложен и оптимизирован метод определения длинной нуклеотидной последовательности ДНК и ее фрагментов с помощью разработанного геносенсора;

• оптимизированы условия практического использования разработанных методов определения тяжелых металлов, фармпрепаратов, молекул ДНК в сыворотке крови при диагностике заболеваний и в природных объектах при Практическая значимость. Разработаны амперометрические БС на основе иммобилизованной ДНК и стационарных электродов для определения тяжелых металлов и фармпрепаратов и для изучения процесса гибридизации ДНК. Анализ образцов на содержание фармпрепаратов необходим при контроле их качества в процессе фармпроизводства и в сыворотке крови пациентов в процессе терапевтического мониторинга.

Все методики просты, относительно дешевы, требуют очень малый объем образцов.

Проведением параллельных анализов оценена правильность предложенных методик. Использование этих методик позволяет определять токсиканты на уровне ПДК и меньших концентраций и судить об их потенциальной мутагенной и канцерогенной активности. Разработанные методики определения апробированы при анализе реальных образцов. Представляет интерес использовать данные ДНК-сенсоры в анализе образцов природной воды и биологических жидкостей в условиях медицинских лабораторий, лабораторий экологоаналитического контроля и судебно-медицинской экспертизы.

На защиту автор выносит:

БС на основании исследования комплексообразования тяжелых металлов • результаты изучения специфической адсорбции ионов Cu(II) и Cо(II) на ДНК-содержащей мембране в составе БС как из индивидуальных растворов, так и при совместном присутствии ионов металлов в растворе;

• методики определения тяжелых металлов и противоопухолевых препаратов - интеркаляторов с помощью амперометрических БС на основе различных форм иммобилизованной ДНК и СРПЭ, выбор оптимальных параметров работы ДНК-сенсоров: время концентрирования, время реактивации, выбор рН, условия реактивации;

• разработку амперометрического ДНК-зонда или геносенсора на основе СУЭ для изучения процесса гибридизации ДНК и определения нуклеотидной последовательности в длинноцепочечных образцах ДНК;

• применение разработанных ДНК-сенсоров и ДНК-зонда в анализе реальных объектов.

Апробация работы. Результаты исследований были доложены и обсуждены на международных и российских конференциях и изложены в материалах: Международной конференции «Ломоносов-2000» (Москва, 2000), Международной конференции «Сенсор-2000»

(Санкт Петербург, 2000), Поволжской конференции по аналитической химии (Казань, 2001), Итоговой научной студенческой конференции КГУ (Казань, 2000), региональной научной конференции «Методы аналитического контроля материалов и объектов окружающей среды» (Пермь, 2001), Всероссийской конференции «Современные проблемы теоретической и экспериментальной химии» (Саратов, 2001), Междисциплинарной конференции с международным участием «Новые биокибернетические и телемедицинские технологии 21-го века для диагностики и лечения заболеваний человека» (Петрозаводск, 2002), Всероссийской конференции «Актуальные проблемы аналитической химии» (Москва, 2002), Всероссийской конференции «Проблемы теоретической и экспериментальной аналитической химии» (Пермь, 2002), Международной научной конференции «Химия, химическая технология и биотехнология на рубеже тысячелетий» (Томск, 2006), Всероссийской конференции «ЭкоаналитикаСамара, 2006), Международного конгресса по аналитической химии ICAS-2006 (Москва, 2006).

Публикации. По тематике диссертационной работы опубликовано 12 работ. Из них статьи в научных журналах и 9 тезисов докладов на всероссийских и международных конференциях.

Настоящая работа является частью исследований проводимых на кафедре неорганической химии Казанского государственного университета в рамках темы Министерства образования и науки РФ «Координационные соединения 3D-переходных, платиновых и редкоземельных металлов, термодинамика и кинетика образования в различных средах, синтез строение, свойства, направления практического использования» (рег. № 01.960002010). Работа поддержана также грантами Агентства по грантам Чешской Республики (грант №203/02/0422) и Агентства по грантам Академии наук Чешской Республики (грант № А1163201).

Структура и объем работы. Диссертация изложена на 156 страницах, содержит таблиц, 30 рисунков и библиографию, включающую 163 ссылки. Диссертационная работа состоит из списка сокращений, общей характеристики работы, обзора литературы, экспериментальной части, четырех глав результатов и их обсуждения, выводов и списка используемой литературы.

В первой главе представлен обзор литературных данных по функционированию ДНК и ее эффекторов в организме и электрохимическим методам их определения. Основное внимание уделено использованию электрохимических ДНК-БС. Во второй главе описаны объекты и методы исследования, аппаратура. Приведены методики иммобилизации ДНК и олигодезоксинуклеотидов, а также методики построения изотерм биоаффинной сорбции тяжелых металлов и получения констант устойчивости и аффинного связывания тяжелых металлов и фармпрепаратов с различными формами иммобилизованной ДНК. В третьей главе изложены результаты изучения взаимодействия тяжелых металлов Cu(II) и Co(II) с ДНК и их определения с помощью амперометрического ДНК-сенсора. В четвертой главе отражено изучение взаимодействия с ДНК противоопухолевых препаратов, оказывающих цитостатическое действие за счет интеркаляции; приведены результаты их определения с помощью ДНК-сенсора.

Глава 5 посвящена разработке нового типа геносенсора и изучению процесса гибридизации ДНК и определению последовательности нуклеотидов с его помощью. Глава 6 посвящена аналитическому применению амперометрических ДНК-сенсоров на основе стационарных электродов в анализе объектов окружающей среды и сыворотки крови человека.

1. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

С целью решения поставленных задач использовались следующие методы исследования: различные виды вольтамперометрии с использованием вольтамперометрической системы SVA-1BM-01 «Аналитик» (Болгария); потенциостата AUTOLAB «EcoChemie» (Нидерланды), соединенного с VA-Stand 663 «Metrohm» (Швейцария). Использовались также спектрофотометрия, атомно-абсорбционная спектрофотометрия (с использованием спектрофотометра U-2000 «Hitachi» (Япония), атомно-абсорбционного спектрофотометра Z – 6100 «Hitachi» (Япония)).

В работе изучены следующие объекты: денатурированная ДНК (д-ДНК), ее комплексы с ионами металлов (Cu(II), Co(II)), противоопухолевыми препаратами – антибиотиком адрибластином и алкалоидом онковином; стрептавидин, меченный щелочной фосфатазой (ЩФ); ЩФ и ее субстрат 1-нафтилфосфат (С10Н9РО4); олигодезоксинуклеотиды (ОДН): целевые ДНК с последовательностью 5’СAGGCACAAACACGCACCTCA(A)203' (p53-273) и 5’TTGG(TTTTTTCTC)4TTTTTG(A)253' (71-мер), биотинированные ОДН с последовательностью GAGGTGCGTGTTTGTGCCTG-3’-биот (p53-273-соm) и 12 TTC-биот, образцы плазмидной ДНК pBluescript и fra (продукты полимеразных цепных реакций).

Получение биосенсорной части ДНК-сенсоров и ДНК-зонда.

Для получения биосенсорной части ДНК-сенсоров навеску НЦ со средним содержанием азота 11,5-12 % растворяли в смеси ацетона и толуола, добавляли раствор д-ДНК, раствор глутарового альдегида и гексан в качестве коагулянта. Из этой смеси на стеклянной поверхности получали пленку. Полученную пленку закрепляли на поверхности стационарного ртутно-пленочного электрода (СРПЭ).

Для получения биосенсорной части ДНК-зонда навеску НЦ растворяли в смеси ацетона и толуола, приливали раствор ОДН, после перемешивания добавляли раствор глутарового альдегида и гексан. Полученную смесь наносили на рабочую поверхность стеклоуглеродного электрода (СУЭ) и высушивали.

Обработка данных комплексообразования тяжелых металлов и фармпрепаратов с ИДНК. При обработке результатов исследований комплексообразования металл-д-ИДНК и фармпрепарат-р-ИДНК для установления состава и определения констант устойчивости данных комплексов определяли равновесную концентрацию ионов металла, либо фармпрепарата в процессе их комплексообразования при постоянной концентрации лиганда - ДНК (L) спектрофотометрически по поглощению комплексоната Cu(II) при 276 нм и комплексоната Co(II) при 215 нм, адрибластина при 232 нм, вольтамперометрически по величине Ip при -0, В, -1,3 В для комплексоната Cu(II) и комплексоната Co(II), соответственно, и при -0,46 В и -0,9 В для адрибластина и онковина, соответственно и по градуировочным графикам. Обработка результатов проводилась методом математического моделирования с использованием программы CPESSP (Shevelkova A.N., Salnikov Yu.I. et.al. FEBS Letters. 1996.V.383).

Построение изотерм адсорбции тяжелых металлов с помощью ДНК-сенсора. Построение изотерм адсорбции проводили на основании зависимостей оптических плотностей растворов комплексонатов соответствующих металлов, либо по величине Ip этих растворов от исходной концентрации ионов тяжелых металлов (Cu(II) или Со(II)). По градуировочным графикам зависимости определяли остаточные концентрации ионов Cu(II) или Cо(II).

Определение констант аффинного связывания комплексов металл– д-ИДНК и фармпрепарат - р-ИДНК. Константы аффинного связывания (Ксвяз) комплексов определяли вольтамперометрически по токам восстановления комплексонатов Cu(II) или Со(II) при потенциалах – 0,4 В, либо – 1,3 В, соответственно, для фармпрепаратов при – 0,46 В или – 0, В для адрибластина и онковина, соответственно. По градуировочным зависимостям определяли концентрации комплексов металл-д-ИДНК и фармпрепарат-р-ИДНК и равновесные концентрации ионов Cu(II) или Со(II), либо адрибластина и онковина, которые использовали для построения графика Скетчарда.

2. ВЗАИМОДЕЙСТВИЕ ТЯЖЕЛЫХ МЕТАЛЛОВ С ДНК:

КОМПЛЕКСООБРАЗОВАНИЕ С РАЗЛИЧНЫМИ ФОРМАМИ ДНК И

БИОАФФИННАЯ СОРБЦИЯ НА ДНК-СОДЕРЖАЩЕЙ МЕМБРАНЕ

БИОСЕНСОРА. ОПРЕДЕЛЕНИЕ ТЯЖЕЛЫХ МЕТАЛЛОВ С ПОМОЩЬЮ

Комплексообразование тяжелых металлов с различными формами ДНК проводилось на примере ионов Cu(II) или Со(II), так как с одной стороны эти металлы являются жизненно необходимыми, с другой стороны установлена их потенциальная генотоксичность, что делает определение данных ионов в сыворотке крови и в экологических объектах актуальным.

Для выбора формы ДНК, позволяющей наиболее эффективно решить поставленную аналитическую задачу, изучено взаимодействие ионов Cu(II) (выбраны в качестве модели, так как имеют наибольшее сродство к ДНК) с денатурированной неиммобилизованной и денатурированной иммобилизованной ДНК. Результаты определения констант устойчивости () всех значимых форм комплексов различного состава Cu(II)-д-ДНК и Cu(II)-д-ИДНК и долей их накопления () представлены в табл. 1. Установлено, что форма д-ИДНК является биолигандом с наибольшей комплексообразующей способностью и оптимальна для использования в составе БС. С учетом описанных выше результатов, комплексообразование ионов Co(II) изучалось только с выбранной формой д-ИДНК. Для оценки параметров комплексообразования ионов Cо(II) с д-ИДНК были определены равновесные концентрации ионов Cо(II) после проведения реакции комплексообразования с д-ИДНК спектрофотометрическим методом (СФ) и методом атомно-абсорбционной спектрофотометрии (ААС). Результаты представлены на рис. 1 и в табл. 1. Обработка полученных данных выполнена методом математического моделирования (см. раздел 1).

0, 0, 0, 0, 0, 0, Таким образом, на основании экспериментальных данных получены количественные характеристики процесса комплексообразования ионов Cu(II) и Сo(II) с д-ИДНК, которые указывают на то, что ионы металлов образуют достаточно прочные комплексы с д-ИДНК, что свидетельствует об их взаимодействии именно с азотистыми основаниями иммобилизованных молекул. Однако, по сравнению с ионами Cu(II) взаимодействие ионов Сo(II) протекает менее эффективно, что хорошо согласуется с литературными данными.

Биоаффинная сорбция тяжелых металлов на д-ИДНК-содержащей мембране.

Была оценена сорбционная емкость модифицированной НЦ мембраны с д-ИДНК по отношению к ионам Cu(II) и Cо(II) для получения значения максимального количества молей тяжелых металлов, способных адсорбироваться на данной поверхности.

Результаты изучения комплексообразования ионов Cu(II) и Cо(II) В исследуемой системе происходит хемосорбция выбранных ионов на биочувствительной части сенсора за счет комплексообразования с д-ИДНК, что позволяет получить более точные и воспроизводимые характеристики процесса. Для контроля специфичности адсорбции проводили холостой опыт с НЦ матрицей, не содержащей д-ИДНК.

При построении изотерм адсорбции Ленгмюра (см. раздел 1) концентрацию исходного раствора ионов металла увеличивали до выхода изотерм на предел (а), обусловленный сорбционной емкостью мембраны (рис. 2). Это свидетельствует о предельном заполнении возможных мест связывания с д-ИДНК на модифицированной мембране сорбируемыми ионами. Полученные значения а (рис. 2, кривые 1,3) для ионов Cu(II) 8,7х10-3 моль/м2, для ионов Cо(II) (3,8±0,2)х10-3 моль/м2, что свидетельствует о большем сродстве ионов Cu(II) к д-ИДНК, чем Cо(II), что соответствует литературным данным о наличии у Cu(II) большего числа вариантов связывания с ДНК. Были также построены изотермы адсорбции ионов Cu(II) и Cо(II) из раствора, в котором данные ионы присутствовали совместно в соотношении 1:1 за счет достаточной разницы потенциалов этих пиков (Е более, чем 250 мВ) (рис. 2, кривые 2,4). Как видно из рис. 2, при соотношении концентраций ионов металлов в исходном растворе 1:1, на мембрану с д-ИДНК сорбируется практически одновременно оба вида ионов. Следовательно, с помощью ДНК-сенсора возможно определение этих ионов в совместном присутствии. Из рис. 2 также следует, что при условии конкурентной адсорбции, сорбционная способность ионов Cu(II) больше, чем ионов Со(II), что еще раз подтверждает большее их сродство к молекулам д-ИДНК.

М(II) – д-ИДНК проводилось для оценки специфичности изучаемых процессов методом Скетчарда, основанным на получении зависимости отношения концентрации образующегося комплекса [М(II)-д-ИДНК] к равновесной концентрации металла-комплексообразователя [M(II)] от равновесной концентрации образующегося комплекса [М(II)-д-ИДНК]. По тангенсу угла наклона полученных прямолинейных зависимостей найдены значения величин констант аффинного связывания Ксвяз ионов тяжелых металлов с д-ИДНК (n=5, P=0,95):

Ксвяз Cu(II)-д-ИДНК = (19,1±0,1)х105 л/моль (вольтамперометрические данные);

Ксвяз Cо(II)-д-ИДНК = (3,9±0,2)х104 л/моль (спектрофотометрические данные).

Эти данные еще раз подтверждают достаточно высокое сродство ионов Cu(II) и Co(II) к выбранной форме молекул ДНК и факт образования прочной связи данных ионов с д-ИДНК за счет координационного взаимодействия с азотистыми гетероциклическими основаниями ДНК и наличия дополнительных вариантов комплексообразования: образования внутринитевого хелата между атомами N(7) и О(6) гуанина д-ИДНК, образование внутринитевых сшивок с атомами N(7) гуанина д-ИДНК.

Полученные количественные характеристики взаимодействия ионов Cu(II) и Co(II) с д-ИДНК свидетельствуют о целесообразности определения данных металлов в различных объектах с помощью предложенного БС.

Разработка метода определения ионов тяжелых металлов Cu(II) и Co(II) с помощью амперометрического биосенсора на основе д-ИДНК. С учетом проведенного исследования был разработан амперометрический д-ИДНК-содержащий БС на основе СРПЭ, который использовали для разработки метода определения тяжелых металлов на примере ионов Cu(II) и Co(II).

В качестве материала для изготовления матрицы для иммобилизованных биомолекул в данной работе был выбран нитрат целлюлозы (НЦ), как обладающий гидрофильностью и минимальной неспецифической сорбцией. Ковалентный способ иммобилизации д-ДНК предполагает включение молекул ДНК в полимерную матрицу из НЦ с одновременной кросс-сшивкой при обработке глутаровым альдегидом в качестве бифункционального реагента (см. раздел 1). Подобраны смеси растворителей, максимально сохраняющие структуру и свойства биомолекул. Предложенный способ иммобилизации позволяет получить воспроизводимые, устойчивые матрицы, модифицированные биомолекулами, благодаря сочетанию механической фиксации ДНК в полимере с химическим связыванием.

Аналитические возможности разработанного БС на основе д-ИДНК были оценены на примере определения ионов тяжелых металлов Cu(II) и Co(II). Предлагаемый биоаффинный метод определения ионов Cu(II), или Co(II) в объектах аналитического контроля с помощью амперометрического ДНК-сенсора основан, с одной стороны, на установленном нами высоком сродстве ионов Cu(II) и Co(II) к молекулам д-ИДНК, что позволяет провести эффективное биоаффинное концентрирование данных ионов из анализируемого раствора с малой концентрацией на мембране с д-ИДНК в составе БС. С другой стороны, в методике используется реактивация БС путем удаления ионов Cu(II), либо Co(II) с поверхности ДНК-сенсора обработкой его раствором комплексона III и определение ионов тяжелых металлов в виде комплексонатов. При этом возможно определение более низких концентраций Cu(II), либо Co(II), а БС реактивируется и может быть многократно использован. Появление на вольтамперограмме катодных пиков при – 0,4 В или при – 1,3 В после концентрирования ионов Cu(II) или ионов Cо(II) на биосенсоре и его реактивации еще раз подтверждает факт разрушения комплекса ионов Cu(II), либо ионов Cо(II) с д-ИДНК под действием комплексона III.

Величина этих сигналов зависит от концентрации ионов Cu(II), либо ионов Cо(II), а при их постоянной концентрации - от способности молекул ДНК к комплексообразованию. Молекулы д-ДНК после иммобилизации сохраняют свою активность не менее 30 дней. Равенство аналитических сигналов, полученных при использовании различных участков мембраны с иммобилизованной д-ДНК равной площади, свидетельствует об однородности биочувствительной части сенсора по составу. С помощью данного ДНК-сенсора возможно провести около 10 циклов измерений. Следует сказать, что при необходимости можно легко заменить модифицированную мембрану после проведения анализа на новую.

Выбрано оптимальное время концентрирования (10 мин) и время реактивации ( мин) для определения изучаемых ионов металлов. Проведено определение ионов Cu(II) и Cо(II) в модельных растворах по градуировочным графикам зависимости lgIр (мкА) от lgс (моль/л), которые имеют следующий вид: lgIр = (0,273±0,001)lgc + (2,62±0,03), r = 0,9986, для ионов Cu(II); lgIр = (0,262±0,002)lgc + (1,95±0,02), r = 0,9978, для ионов Cо(II) (пример определения - в табл. 2). Линейная область определяемых концентраций ионов Cu(II) и Co(II) с помощью амперометрического ДНК-сенсора составляет 1,0х10-5 4,0х10-11 моль/л для ионов Сu(II), 1,0х10-5 2,0х10-8 моль/л для ионов Co(II). Нижняя граница определяемых содержаний (сн) составляет 4,0х10-11 моль/л и 2,0х10-8 моль/л (sr=0,33) для ионов Сu(II) и Co(II), соответственно. В случае определения более низких концентраций ионов тяжелого металла объем раствора при накоплении можно увеличить.

Результаты определения ионов Cо(II) в модельных растворах биоаффинным методом на основе амперометрического Таким образом, разработанный биоаффинный метод определения тяжелых металлов на примере ионов Cu(II) и Co(II) с помощью амперометрического ДНК-сенсора может применяться для анализа различных объектов. С помощью разработанного БС возможно оценить потенциальную генотоксичность тяжелых металлов для ДНК организма.

3. ВЗАИМОДЕЙСТВИЕ ПРОТИВООПУХОЛЕВЫХ ПРЕПАРАТОВ С

ИММОБИЛИЗОВАННОЙ ДНК В СОСТАВЕ АМПЕРОМЕТРИЧЕСКОГО

ДНК-СЕНСОРА И ИХ ОПРЕДЕЛЕНИЕ

При поиске новых, более эффективных и менее токсичных онкопрепаратов, а также при их получении, выяснении фармакокинетики, метаболизма и при контроле их содержания актуально изучение взаимодействия препаратов с ДНК и их определение. В данном исследовании было оценено взаимодействие адрибластина и онковина с ДНК и проведено их определение с помощью ДНК-сенсора. Решена задача оптимизации состава биочувствительной части сенсора, при этом был учтен механизм действия данных препаратов на двунитевую ДНК, как интеркаляторов, а также их способность связываться в организме с денатурированной однонитевой ДНК за счет электростатического взаимодействия. Поэтому при приготовлении биочувствительной части БС на основе ИДНК после термической денатурации ДНК проводили медленное охлаждение. В результате, при сохранении одинарных цепей, образуются и фрагменты вторичной структуры, т.е. двойных цепей ДНК за счет восстановления водородных связей либо между двумя цепями, либо внутри одной спирали, т.е. происходит процесс частичной ренатурации. В данном случае образуется ренатурированная ДНК, или р-ДНК. Затем проводили ковалентную иммобилизацию данной формы биомолекулы в НЦматрице и получали образцы р-ИДНК (см. раздел 1). Нами было изучено комплексообразование адрибластина и онковина с молекулами р-ИДНК в составе НЦ матрицы для количественной оценки сродства эффектора именно к данной форме ДНК, а также для оптимизации разрабатываемого аналитического метода.

На основе полученных данных (для достоверности получаемой информации использовали два независимых метода - СФ, ВА) методом математического моделирования с использованием программы CPESSР рассчитаны составы комплексов, доли их накопления () и константы устойчивости комплексов адрибластин-р-ИДНК и онковин-р-ИДНК и построены графики накопления всех значимых форм изучаемых комплексов. На рис. 3 приведен для примера график в присутствии онковина. Полученные данные по комплексообразованию фармпрепаратов с р-ИДНК систематизированы в табл. 3.

Результаты изучения комплексообразования адрибластина и онковина с р-ИДНК Из полученных данных (табл. 3) видно, что оптимизированный состав разработанного р-ИДНК-содержащего биосенсора позволяет провести высокоэффективное концентрирование препаратов на БС, поскольку доля связанного онкопрепарата в составе комплекса при его больших концентрациях составляет порядка 99% (для онковина).

Таким образом, проведенное исследование позолило установить факт эффективного связывания онковина и адрибластина с р-ИДНК.

Определение констант аффинного связывания комплексов адрибластин – р-ИДНК и онковин – р-ИДНК проводили для количественной характеристки специфичности комплексообразования методом Скетчарда. Ксвяз оценены на основании вольтамперометрических данных полученных по описанной выше методике (см. раздел 1). Строили графики в координатах: [СДНК-Преп]/[CПреп] – [СДНК-Преп], где [СДНК-Преп] – равновесная концентрация комплекса р-ИДНК-онкопрепарат, [CПреп] – равновесная, т.е. оставшаяся несвязанной после образования комплекса, концентрация препарата. Значение Ксвяз составило для адрибластина - (2.5±0.2)х106 л/моль, для онковина - (5.0±0.4)х105 л/моль; высокие значения Ксвяз свидетельствуют о перспективности проведения биоаффинного концентрирования данных препаратов на ДНК-сенсоре, возможности повышения чувствительности анализа и актуальности определения противоопухолевых препаратов этого класса с помощью биоаффинного метода на основе амперометрического р-ИДНК-содержащего сенсора.

Разработка метода определения противоопухолевых препаратов с помощью амперометрического биосенсора на основе р-ИДНК. Предлагаемый метод определения фармпрепаратов с помощью амперометрического ДНК-сенсора основан на количественно установленном нами высоком сродстве адрибластина и онковина к молекулам р-ИДНК, что позволяет провести эффективное концентрирование данных препаратов из анализируемого раствора с малой концентрацией, в том числе из многокомпонентных биологических жидкостей. Удаление фармпрепаратов с поверхности БС обработкой его раствором с большой ионной силой (нами был выбран 1 М NaCl) позволяет использовать БС многократно, что делает метод более экономичным и экспрессным. Оптимальное время концентрирования препаратов на мембране с р-ИДНК составило 15 и 20 мин для адрибластина и онковина, соответственно. Оптимальное время реактивации составило 20 мин. Таким образом, выбраны рабочие условия определения с помощью ДНК-сенсора для сокращения времени проведения анализа без возможного ухудшения его чувствительности. Уравнения градуировочных графиков зависимости lgIр (мкА) от lgc (моль/л) имеют следующий вид: lgIр = (0,365±0,003)lgc + (1,06±0,02), r = 0,9997 для адрибластина; lgIр = (0,427±0,015)lgc + (2,82±0,21), r = 0,9992 для онковина. Линейная область определяемых концентраций адрибластина с помощью БС на основе р-ИДНК составляет 1,0х10-5 1,0х10-10 моль/л, для онковина 1,0х10-5 2,0х10- моль/л. Нижние границы определяемых содержаний (сн) составляют 1,0х10-10 моль/л (адрибластин), 2,0х10-9 моль/л (онковин) (sr = 33%). Ошибка определения не превышает 10%. В случае определения более низких содержаний фармпрепаратов можно увеличить объем раствора при накоплении. В табл. 4 для примера представлены результаты определения адрибластина в модельных растворах с помощью ДНК-сенсора.

Таким образом, результаты изучения процесса комплексообразования выбранных фармпрепаратов с р-ИДНК, найденные оптимальные условия проведения анализа, широкий диапазон определяемых содержаний, возможность селективного определения адрибластина и онковина в присутствии электрохимически неактивных компонентов матрицы, либо восстанавливающихся в иной области потенциалов, позволяют использовать разработанный амперометрический ДНК-сенсор как новое средство биохимического контроля за содержанием данных онкопрепаратов в многокомпонентных биологических системах, в том числе в сыворотке крови человека.

Результаты определения адрибластина с помощью амперометрического

4. ИЗУЧЕНИЕ ПРОЦЕССА ГИБРИДИЗАЦИИ ДНК И ОПРЕДЕЛЕНИЕ

ПОСЛЕДОВАТЕЛЬНОСТИ НУКЛЕОТИДОВ С ПОМОЩЬЮ

АМПЕРОМЕТРИЧЕСКОГО ДНК-ЗОНДА (ГЕНОСЕНСОРА) НА ОСНОВЕ СУЭ

С целью определения повреждений структуры молекулы ДНК или наличия в системе «чужеродной» ДНК, определения последовательности нуклеотидов для ранней диагностики генетических и онкологических заболеваний, либо обнаружения патогенных микроорганизмов в биологических жидкостях, в пищевых продуктах (генетически модифицированные продукты) и в окружающей среде актуально изучение процесса гибридизации ДНК с помощью ДНК-зонда.

В представленном ДНК-зонде на рабочей поверхности СУЭ находится биоаффинная НЦ матрица с включенными в ее полимерную сетку и ковалентно иммобилизованными с помощью бифункционального реагента – глутарового альдегида олигодезоксинуклеотидами (ОДН) (см. раздел 1). Получены воспроизводимые, устойчивые, полупроницаемые матрицы, модифицированные биомолекулами. Для контроля за образованием гибридного комплекса при гибридизации целевой ДНК (ц-ДНК), иммобилизованной в НЦ матрице, с комплементарной последовательностью использованы высокоспецифичная система биотинстрептавидин и ферментативное усиление биоаффинного сигнала с помощью щелочной фосфатазы (ЩФ). Продукт ферментативной реакции субстрата ЩФ 1-нафтил-фосфата – 1-нафтол электрохимически активен и на вольтамперограмме дает анодный пик на СУЭ при Ер = +0,4 В, по которому судили о прохождении реакции гибридизации. В данном методе биотин является меткой пробы ОДН, а ЩФ - меткой образования комплекса биотинстрептавидин, а в итоге меткой всего процесса гибридизации. Схема гибридизации приведена на рисунке 4. Важной задачей является оптимизация различных этапов разрабатываемого метода.

Рис. 4. Схема гибридизации на амперометрическом ДНК-зонде на основе СУЭ и ОДН, иммобилизованного в составе НЦ мембраны.

Оценено и влияние количества целевой ДНК р53-273, либо неспецифичного ОДН 71-мера, иммобилизованных в НЦ мембране на поверхности модифицированного СУЭ, на высоту тока пика при +0,4 В после гибридизации с пробой биотинированного ОДН р53-273сom. Результаты представлены на рис. 6. Для выбора оптимальных условий проведения реакции гибридизации и ее детекции изменяли время инкубации ДНК-зонда в растворе субстрата ЩФ, при этом иммобилизовали 600 нг ц-ДНК.

Таким образом, на основании проведенного исследования выбраны следующие параметры: 600 нг ц-ДНК в составе НЦ-матрицы на поверхности электрода, блокирование 5% раствором БСА в течение двух минут, время инкубации в растворе субстрата 5 минут без перемешивания.

Рисунок 5. Влияние условий блокирования НЦ мембраны ДНК-зонда на интенсивность аналитического сигнала комплементарных и некомплементарных пар целевая ДНК – биотинированная проба. 1) отсутствие блокирования; 2) 1% БСА; 3) 2% раствор БСА; 4) 5% раствор БСА; 5) 8% раствор БСА; 6) раствор сухих молочных белков в ФСБ, рН=7,3. Целевая ДНК - р53-273 (штриховка), некомплементарный ОДН 71-мер (черный).

Ip, мкА Специфичность процесса гибридизации, протекающего на разработанном ДНК-зонде, подтверждали изучением взаимодействия комплементарного и некомплементарного биотинированных олигонуклеотидов с ц-ДНК, входящей в состав ДНК-зонда, либо оценкой взаимодействия биотинированного олигодезоксинуклеотида (пробы) с комплементарной или некомплементарной по отношению к нему ц-ДНК, иммобилизованной на зонде (рис. 7).

Ip, мкА 2) при иммобилизации ц-ДНК р53-273 и проведения гибридизации с некомплементарной биотинированной пробой ОДН 12 ТТС;

4) после гибридизации некомплементарного ОДН 71-мера, иммобилизованного на ДНК-зонде, с биотинированной пробой ОДН р53-273-com.

Таким образом, разработан новый способ ковалентной иммобилизации олигонуклеотидов на поверхности амперометрического трансдьюсера (СУЭ). Данный способ иммобилизации позволил получить амперометрический ДНК-зонд и разработать биоаффинный метод для экспрессного (15-20 мин) и высокоспецифичного контроля за процессом гибридизации ДНК.

Отличительной особенностью разработанного амперометрического ДНК-зонда является то, что в данной биоаффинной системе поверхность для проведения гибридизации и детектирующая поверхность совмещены, что упрощает как конструкцию ДНК-зонда, так и сам метод контроля гибридизации с его использованием, за счет устранения необходимости разделения гибридизованных и негибридизованных ОДН. Метод позволяет получить достаточно специфичный сигнал как для коротких, так и для длинных повторяющихся последовательностей ОДН в составе ДНК.

5. ПРИМЕНЕНИЕ АМПЕРОМЕТРИЧЕСКИХ ДНК-СЕНСОРОВ

В АНАЛИЗЕ РЕАЛЬНЫХ ОБЪЕКТОВ

Для оценки аналитических возможностей разработанных амперометрических ДНКсенсоров на основе СРПЭ и ДНК-зонда на основе СУЭ они были применены в анализе реальных объектов. При определении тяжелых металлов в природной воде и сыворотке крови человека была адаптирована методика на основе д-ИДНК-сенсора.

Влияние матричных компонентов на результаты определения 2,0х10-5 моль/л ионов Cu(II) с помощью амперометрического ДНК-сенсора Оценено влияние матричных компонентов сыворотки крови на определения (табл. 5).

Некоторые результаты представлены в табл. 6. Достаточная разница потенциалов восстановления комплексонатов Cu(II) и Cо(II), а также установленный факт независимой сорбции этих ионов при совместном присутствии позволяют определять эти металлы в металлы в многокомпонентных системах - сыворотке крови при их совестном присутствии, что является важным при диагностике анемии.

Метод определения данных ионов металлов с помощью д-ИДНК-содержащего БС отличается селективностью, хорошей воспроизводимостью, простотой пробоподготовки, достаточной экспрессностью и требует минимальный объем пробы. Данная методика может быть использована как дополнительная к известным методам контроля за содержанием меди и кобальта в различных объектах анализа.

Анализируемый * - атомно-абсорбционная спектрометрия; • - спектрофотометрия Для оценки возможности использования разработанного амперометрического р-ИДНК-сенсора как нового инструмента биохимического анализа при определении фармпрепаратов была разработана методика определения адрибластина и онковина в реальных объектах – в сыворотке крови человека (некоторые результаты представлены в табл. 7).

Разработанный метод был использован также для определения целевых компонентов – адрибластина и онковина – в инъекционной форме препарата в присутствии компонентов лекарственных форм с целью контроля состава готовой продукции (табл. 8).

Результаты определения адрибластина и онковина в сыворотке крови с помощью амперометрического ДНК-сенсора (n=5, Р=0,95) Результаты определения адрибластина и онковина в лекарственных формах с помощью амперометрического р-ИДНК-содержащего БС (n=5, Р=0,95) Как видно из таблицы 8 случайная погрешность незначима и не превышает 10%.

Для определения нуклеотидной последовательности в образцах ДНК различной длины их иммобилизовали в составе ДНК-зонда, причем при иммобилизации использовали и специфичные и неспецифичные последовательности ДНК. Результаты определения представлены на рис. 8. И ОДН 12GAA, и продукт полимеразной цепной реакции (ПЦР) fra содержат последовательность (GAA)n и дают хорошие и специфичные аналитические сигналы после проведения гибридизации с комплементарной биотинированной пробой 12ТТС, в отличие от гибридизации с некомплементарным биотинированным ОДН р53-273-com, что согласуется с правилом комплементарности азотистых оснований. С образцом плазмидной ДНК pBluescript, не содержащей нуклеотидной последовательности, комплементарной к использованным биотинированным пробам (р53-273-com и 12ТТС) не было получено специфических сигналов, соответствующих процессу гибридизации (см. рис. 8).

Рис. 8. Величины аналитического сигнала различных целевых ДНК (2-6), иммобилизованных в НЦ мембране в составе ДНК-зонда после гибридизации с биотинированными пробами р53-273-com (штриховка) или 12ТТС (черный). (mДНК = 600 нг): 1) холостой опыт:

НЦ без ДНК; 2) р53-273; 3) 12GAA; 4) 71-мер; 5) fra; 6) pBluescript.

Предложенный способ иммобилизации фрагментов ДНК и простота изготовления ДНК-зонда позволяют в дальнейшем использовать геносенсор такого типа для параллельных анализов образцов ДНК на ДНК-чипах и в условиях автоматизации анализа, а также использовать его для определения точечных мутаций в длинных ДНК, полученных в условиях ПЦР.

Таким образом, в настоящей работе продемонстрированы примеры изучения взаимодействия и определения эффекторов ДНК различной природы с помощью предложенных методов с использованием амперометрических ДНК-сенсоров на основе стационарных электродов. Разработанные методы селективны, экспрессны и высокочувствительны, что позволило использовать их в анализе модельных систем и реальных образцов на содержание выбранных эффекторов (тяжелых металлов, противоопухолевых препаратов - интеркаляторов и фрагментов ДНК).

1) Установлены составы и доли комплексов и получены количественные характеристики процессов взаимодействия тяжелых металлов на примере ионов Cu(II) и Co(II) с денатурированной и денатурированной иммобилизованной ДНК (д-ИДНК) в составе НЦ мембраны и взаимодействия противоопухолевых препаратов - интеркаляторов на примере адрибластина и онковина с ренатурированной иммобилизованной ДНК (р-ИДНК). Определены константы аффинного связывания комплексов эффектор-ИДНК. Результаты указывают на целесообразность использования формы д-ИДНК в качестве аналитического реагента в составе БС при определении тяжелых металлов и формы р-ИДНК при определении цитостатиков.

2) Выявлено преимущественное сродство ионов Cu(II) к д-ИДНК по сравнению с ионами Cо(II) как в условиях адсорбции из индивидуальных растворов, так и при адсорбции при соотношении концентраций металлов в растворе 1:1; доказана возможность их селективного определения при совместном присутствии.

3) Разработаны биоаффинные методы определения тяжелых металлов на примере ионов Cu(II) и Co(II) с помощью амперометрического д-ИДНК-сенсора на основе СРПЭ и противоопухолевых препаратов на примере адрибластина и онковина с помощью амперометрического р-ИДНК-сенсора на основе СРПЭ с использованием биоспецифического мембранного концентрирования на БС. Найдены рабочие условия функционирования и реактивации БС для их многократного использования в зависимости от природы эффекторов ДНК; широкий линейный диапазон определяемых содержаний позволяет использовать разработанные ДНК-сенсоры как новое средство биохимического и экоаналитического контроля для определения эффекторов ДНК с сн=4,0х10-11 моль/л для ионов Cu(II), сн=1,0х10-8 моль/л для ионов Co(II), сн = 1,0х10-10 моль/л для адрибластина, сн = 2,0х10-9 моль/л для онковина.

4) Разработаны амперометрический ДНК-зонд на основе СУЭ с совмещенными поверхностями гибридизации и детекции и для изучения и экспрессного определения процесса гибридизации ДНК и метод определения последовательности олигодезоксинуклеотидов, в том числе в длинных фрагментах ДНК; выбраны рабочие условия (тип мембраны, способ иммобилизации фрагментов ДНК, время и условия блокирования инертным белком, время выдерживания в субстрате щелочной фосфатазы). Доказана высокая специфичность метода; методика экспрессна (15- минут), требует малого количества образца (600 нг) и может быть использования для анализа коротких и длинных последовательностей ДНК.

5) Разработанные амперометрические ДНК-сенсоры и методики определения на их основе были применены для анализа реальных образцов природной воды и сыворотки крови человека на содержание Cu(II), Co(II), адрибластина, онковина, а также для анализа нуклеотидной последовательности реальных образцов ДНК.

1) Бабкина С.С. Определение противоопухолевого антибиотика доксорубицина с помощью амперометрического биосенсора на основе иммобилизованной ДНК / С.С. Бабкина, Е.Н. Моисеева, Н.А. Улахович // Фармация. – 2006. – №. 5. – С. 9-11.

2) Бабкина С.С. Взаимодействие иммобилизованной ДНК с адрибластином и ионами кобальта (II) и их определение биоаффинными методами, основанными на использовании амперометрического ДНК-сенсора / С.С. Бабкина, Е.Н. Моисеева, Ю.И. Сальников // Вестник Казанского технологического университета. – 2006. - №2. – С. 103-110.

3) Бабкина С.С. Комплексообразование Cu(II)-ДНК: выбор формы биолиганда и условий определения Cu(II) с помощью биосенсора / С.С.Бабкина, Е.Н. Моисеева, Ю.И.

Сальников // Ученые записки КГУ. - 2006 – Т.148 №.1 – С. 111-122.

4) Бабкина С.С. Амперометрический сенсор на основе дезоксирибонуклеиновой кислоты (ДНК) для определения ДНК / С.С. Бабкина, Н.А. Улахович, Ю.И. Зявкина, Е.Н.

Моисеева // Междунар.конференция «Сенсор-2000». Сенсоры и микросистемы. Тез. докл.

– С. Петербург, 2000. - С. 123-124.

5) Моисеева Е.Н. Амперометрический биосенсор на основе иммобилизованной ДНК и его использование для определения тяжелых металлов / Е.Н. Моисеева // Тез. докладов Международной конференции «Ломоносов-2000». – Москва, 2000. - С. 184.

6) Моисеева Е.Н. Амперометрический биосенсор на основе иммобилизованной ДНК и его использование для определения тяжелых металлов / Е.Н. Моисеева// Тез. докладов Итоговой студенческой научной конференции КГУ. - Казань, 2000. – С. 48.

7) Бабкина С.С. Контроль содержания тяжелых металлов в воде и продуктах питания путем их концентрирования на биосенсоре, содержащем дезоксирибонуклеиновую кислоту (ДНК) / С.С.Бабкина, Н.А.Улахович, Е.Н.Моисеева, Е.Е.Филюшина // Материалы и тез.докладов региональной научной конференции «Методы аналитического контроля материалов и объектов окружающей среды». - Пермь, Изд-во Пермского университета, 2001. - С.120.

8) Бабкина С.С. Определение ионов тяжелых металлов и комплексов платины в сыворотке крови человека с помощью иммобилизованной дезоксирибонуклеиновой кислоты в составе биосенсора / С.С. Бабкина, Н.А. Улахович, Е.Н. Моисеева, Ю.И. Зявкина, Е.Е. Филюшина / Тез. докл. Междисциплинарной конференции с международным участием «Новые биокибернетические и телемедицинские технологии 21-го века для диагностики и лечения заболеваний человека» НБИТТ-21. – Петрозаводск, 2002. – С. 64.

9) Бабкина С.С. Определение ионов железа(Ш) в сыворотке крови с помощью иммобилизованной дезоксирибонуклеиновой кислоты (ДНК) в составе биосенсора / С.С.

Бабкина, Н.А. Улахович, Е.Н. Моисеева, Е.Е. Филюшина // 2-я Российская научная конференция Всероссийской конференции «Проблемы теоретической и экспериментальной аналитической химии». – Пермь, 2002. – С. 86-87.

10) Бабкина С.С. Биоаффинные методы, основанные на использовании амперометрического ДНК-биосенсора, для изучения взаимодействия и противоопухолевых препаратов и токсичных металлов с ДНК и для их определения / С.С. Бабкина, Е.Н. Моисеева, Н.А. Улахович // Материалы Междунар. научной конфер. «Химия, химическая технология и биотехнология на рубеже тысячелетий». - Томск, 2006. – Т.2, С. 332-334.

11) Бабкина С.С. Амперометрический анализ экологических объектов с помощью ДНК-сенсора на содержание тяжелых металлов как генотоксичных эффекторов ДНК / Бабкина С.С., Моисеева Е.Н., Улахович Н.А. // Тез. докл. Всероссийской конференции «Экоаналитика-2006».- Самара, 2006. – С. 68.

12) Babkina S.S. Amperometric DNA biosensor for investigation of Co(II)-DNA interaction and cobalt assay / S.S. Babkina, E.N. Moiseeva, N.A. Ulakhovich // Abs. International congress on analytical sciences ICAS-2006. – Moscow, 2006. – C. 834.



 
Похожие работы:

«Словохотов Юрий Леонидович АТОМНОЕ СТРОЕНИЕ И ОСОБЕННОСТИ КРИСТАЛЛОХИМИИ НОВЫХ ПРОИЗВОДНЫХ ФУЛЛЕРЕНОВ 02.00.03 – органическая химия 02.00.04 – физическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора химических наук Москва - 2007 Работа выполнена в Институте элементоорганических соединений имени А.Н.Несмеянова Российской академии наук Доктор химических наук, Официальные...»

«Кожунова Елена Юрьевна Термочувствительные полиэлектролитные гели: особенности перехода набухший-сколлапсированный гель Специальность 02.00.06 - высокомолекулярные соединения АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук Москва - 2012 Работа выполнена на кафедре физики полимеров и кристаллов физического факультета Московского государственного университета имени М.В. Ломоносова Научный руководитель доктор физико-математических наук,...»

«КАРТАВЦЕВА МАРИЯ СЕРГЕЕВНА СИНТЕЗ И СВОЙСТВА ТОНКИХ ЭПИТАКСИАЛЬНЫХ ПЛЕНОК BiFeO3 И ТВЕРДЫХ РАСТВОРОВ НА ЕГО ОСНОВЕ АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Специальность 02.00.21 – химия твердого тела Москва – 2008 Работа выполнена на Факультете наук о материалах и кафедре неорганической химии Химического факультета Московского государственного университета имени М.В. Ломоносова. Научный руководитель : доктор химических наук Горбенко Олег...»

«Шамшин Дмитрий Викторович АЦИКЛИЧЕСКИЕ АНАЛОГИ НУКЛЕОЗИДОВ И ИХ АМФИФИЛЬНЫЕ ПРОИЗВОДНЫЕ 02.00.10 – Биоорганическая химия. АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Москва, 2006 Работа выполнена на кафедре Биотехнологии Московской государственной академии тонкой химической технологии им. М.В. Ломоносова. Научный руководитель : доктор химических наук, профессор Василенко И.А. Официальные оппоненты : доктор химических наук, профессор Юркевич...»

«Парфенова Людмила Вячеславовна МЕХАНИЗМЫ РЕАКЦИЙ ГИДРО-, КАРБО- И ЦИКЛОМЕТАЛЛИРОВАНИЯ АЛКЕНОВ С ПОМОЩЬЮ АЛЮМИНИЙОРГАНИЧЕСКИХ СОЕДИНЕНИЙ, КАТАЛИЗИРУЕМЫХ 5-КОМПЛЕКСАМИ Zr 02.00.15- Кинетика и катализ Автореферат диссертации на соискание ученой степени доктора химических наук Уфа-2012 2 Работа выполнена в Учреждении Российской академии наук Институте нефтехимии и катализа РАН член-корреспондент РАН, Научный консультант : доктор химических наук, профессор Джемилев Усеин...»

«ЗВЕРЕВ ДЕНИС МИХАЙЛОВИЧ СИНТЕЗ, СВОЙСТВА И БИОЛОГИЧЕСКОЕ ДЕЙСТВИЕ ГЕТЕРААЛИФАТИЧЕСКИХ АМИНОСПИРТОВ И ИХ АЦИЛИРОВАННЫХ ПРОИЗВОДНЫХ 02.00.03. Органическая химия АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата химических наук Москва 2011 г. Работа выполнена на кафедре органической химии Московской государственной академии тонкой химической технологии им. М.В. Ломоносова. Научный руководитель : доктор химических наук, профессор Борисова Елена Яковлевна Официальные...»

«Песенцева Мария Сергеевна ФЕРМЕНТЫ МОРСКОГО МОЛЛЮСКА Littorina sitkana: 13D-ГЛЮКАНАЗА, -D-ГЛЮКОЗИДАЗА, СУЛЬФАТАЗА И ТИРОЗИЛПРОТЕИН СУЛЬФОТРАНСФЕРАЗА 02.00.10 – Биоорганическая химия Автореферат диссертации на соискание ученой степени кандидата химических наук Владивосток – 2013   Работа выполнена в Федеральном государственном бюджетном учреждении науки Тихоокеанском институте биоорганической химии им. Г.Б. Елякова ДВО РАН и Национальном институте агрономических исследований...»

«Матвеев Евгений Владимирович СИНТЕЗ И СВОЙСТВА ДИЕН-СТИРОЛЬНЫХ ЛАТЕКСОВ, ПОЛУЧЕННЫХ В ПРИСУТСТВИИ СМЕСИ ПАВ 02.00.06 Высокомолекулярные соединения 03.00.16 Экология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата химических наук Москва – 2009 www.sp-department.ru Работа выполнена в Московской государственной академии тонкой химической технологии имени М.В.Ломоносова и в Российском университете дружбы народов Научные руководители: доктор химических наук,...»

«Воронина Наталья Вячеславовна Исследование свойств органо-неорганических молекулярных наночастиц, полученных различными методами 02.00.06 - высокомолекулярные соединения АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата физико-математических наук Москва 2009 2 Работа выполнена на кафедре физики полимеров и кристаллов физического факультета Московского государственного университета имени М.В. Ломоносова и в лаборатории синтеза элементоорганических полимеров ИСПМ...»

«МУСИН ЛЕНАР ИНАРИКОВИЧ Дезоксигенирование циклических дикарбонильных соединений производными P(III) 02.00.03 – органическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Казань – 2014 Работа выполнена в лаборатории фосфорсодержащих аналогов природных соединений Федерального государственного бюджетного учреждения науки Института органической и физической химии им. А.Е. Арбузова Казанского научного центра Российской академии наук Научный...»

«КОЗЛОВСКИЙ Анатолий Анатольевич СВОБОДНОРАДИКАЛЬНЫЕ ПРОЦЕССЫ НИЗКОТЕМПЕРАТУРНОГО ХЛОРИРОВАНИЯ И ПОЛИМЕРИЗАЦИИ МОНОМЕРОВ. ОСОБЕННОСТИ КИНЕТИКИ ТВЕРДОФАЗНОГО ХЛОРИРОВАНИЯ 02.00.04 – физическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Черноголовка – 2010 Работа выполнена в Учреждении Российской академии наук Институте проблем химической физики РАН доктор химических наук, профессор Научный руководитель : Михайлов Альфа Иванович доктор...»

«ЗВЕРЕВ ДЕНИС МИХАЙЛОВИЧ СИНТЕЗ, СВОЙСТВА И БИОЛОГИЧЕСКОЕ ДЕЙСТВИЕ ГЕТЕРААЛИФАТИЧЕСКИХ АМИНОСПИРТОВ И ИХ АЦИЛИРОВАННЫХ ПРОИЗВОДНЫХ 02.00.03. Органическая химия АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата химических наук Москва 201 г. Работа выполнена на кафедре органической химии Московской государственной академии тонкой химической технологии им. М.В. Ломоносова. Научный руководитель : доктор химических наук, профессор Борисова Елена Яковлевна Официальные...»

«ЧУКИЧЕВА ИРИНА ЮРЬЕВНА ЗАКОНОМЕРНОСТИ АЛКИЛИРОВАНИЯ ФЕНОЛОВ МОНОТЕРПЕНОИДАМИ И НАПРАВЛЕННЫЙ СИНТЕЗ ТЕРПЕНОФЕНОЛОВ 02.00.03 – Органическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора химических наук Сыктывкар 2013 2 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте химии Коми научного центра Уральского отделения Российской академии наук Научный консультант : доктор химических наук, член-корр. РАН, профессор Кучин...»

«РУБИН МИХАИЛ АЛЕКСАНДРОВИЧ КАТАЛИТИЧЕСКИЕ РЕАКЦИИ ПРИСОЕДИНЕНИЯ ЦИКЛОПРОПЕНОВ 02.00.03 - органическая химия Автореферат Диссертации на соискание ученой степени доктора химических наук Астрахань 2014 1 Работа выполнена в ФГАОУ ВПО Северо-Кавказский федеральный университет на кафедре химии доктор химических наук, Научный профессор консультант: Аксенов Александр Викторович доктор химических наук, Официальные профессор оппоненты: Ненайденко Валентин Георгиевич (ФГБОУ ВПО...»

«Аврамов Павел Вениаминович КВАНТОВО-ХИМИЧЕСКОЕ И МОЛЕКУЛЯРНО-ДИНАМИЧЕСКОЕ МОДЕЛИРОВАНИЕ СТРУКТУРЫ И СВОЙСТВ СЛОЖНЫХ НАНОКЛАСТЕРОВ ЭЛЕМЕНТОВ IV ГРУППЫ 02.00.04 физическая химия Автореферат диссертации на соискание ученой степени доктора физико-математических наук Москва 2011 год 0 Работа выполнена в Учреждении СО РАН Институт физики им. Л.В. Киренского, Красноярск Научный консультант : доктор физико-математических наук, профессор Сергей Геннадиевич Овчинников Официальные...»

«Старков Илья Андреевич КИСЛОРОДНАЯ НЕСТЕХИОМЕТРИЯ И ТРАНСПОРТНЫЕ СВОЙСТВА ПЕРОВСКИТОПОДОБНОГО ОКСИДА SrCo0,8Fe0,2O3химия твердого тела АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Новосибирск – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институте химии твердого тела и механохимии Сибирского отделения Российской академии наук, г. Новосибирск. Научный руководитель : доктор химических наук старший научный...»

«БАСОВА ЕВГЕНИЯ ЮРЬЕВНА ИММУНОХИМИЧЕСКИЕ ТЕСТ-МЕТОДЫ ОПРЕДЕЛЕНИЯ ТОКСИКАНТОВ В ПРОДУКТАХ ПИТАНИЯ И ОБЪЕКТАХ ОКРУЖАЮЩЕЙ СРЕДЫ 02.00.02. – Аналитическая химия Автореферат диссертации на соискание ученой степени кандидата химических наук Саратов – 2010 Работа выполнена на кафедре общей и неорганической химии Института химии Саратовского государственного университета им. Н.Г. Чернышевского Научный руководитель : доктор химических наук, доцент Горячева Ирина Юрьевна Официальные...»

«Логачева Надежда Михайловна СИТНЕЗ И СТРОЕНИЕ КООРДИНАЦИОННЫХ СОЕДИНЕНИЙ МЕТАЛЛОВ С БЕНЗО-15-КРАУН-5-ЗАМЕЩЕННЫМИ ТЕРПИРИДИНАМИ И ФТАЛОЦИАНИНОМ 02.00.01- неорганическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Москва – 2008 г. 2 Работа выполнена в Учреждении Российской академии наук Институте физической химии и электрохимии им А.Н Фрумкина РАН (ИФХЭ РАН) Научный руководитель : доктор химических наук, академик Цивадзе Аслан Юсупович...»

«ТРОШИН Павел Анатольевич НОВЫЕ ЭЛЕКТРОНОАКЦЕПТОРНЫЕ ПРОИЗВОДНЫЕ ФУЛЛЕРЕНОВ ДЛЯ ОРГАНИЧЕСКИХ СОЛНЕЧНЫХ БАТАРЕЙ 02.00.04 – Физическая химия Автореферат диссертации на соискание ученой степени кандидата химических наук Черноголовка-2006 Работа выполнена в Институте проблем химической физики РАН 1 Научный руководитель : доктор химических наук, профессор Любовская Римма Николаевна Официальные оппоненты : доктор химических наук, профессор Клюев Михаил Васильевич; доктор...»

«ГЕРАСЬКО Ольга Анатольевна КУКУРБИТ[n]УРИЛЫ И КОМПЛЕКСЫ МЕТАЛЛОВ – СУПРАМОЛЕКУЛЯРНЫЕ АДДУКТЫ, КОМПЛЕКСЫ И СОЕДИНЕНИЯ ВКЛЮЧЕНИЯ 02.00.01 – неорганическая химия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора химических наук Новосибирск – 2009 Работа выполнена в Учреждении Российской академии наук Институте неорганической химии им. А.В. Николаева Сибирского отделения РАН Научный консультант доктор химических наук, профессор Федин Владимир Петрович Официальные...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.