WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

МАРКОВЕЦ АНТОН МИХАЙЛОВИЧ

ВОЗРАСТНЫЕ ИЗМЕНЕНИЯ ЭКСПРЕССИИ ГЕНОВ VEGFA И PEDF

ПРИ РАЗВИТИИ ДИСТРОФИИ СЕТЧАТКИ У КРЫС OXYS

03.02.07 – генетика

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Новосибирск 2011 1

Работа выполнена в секторе геномной и постгеномной фармакологии Учреждения Российской академии наук Институт цитологии и генетики СО РАН, г. Новосибирск

Научный руководитель: доктор биологических наук Колосова Н.Г.

Институт цитологии и генетики СО РАН, г. Новосибирск

Официальные оппоненты: Доктор биологических наук профессор А.Л.Маркель, Институт цитологии и генетики СО РАН, г. Новосибирск Доктор биологических наук профессор А.Ю.Гришанова, Научно-исследовательский институт молекулярной биологии и биофизики СО РАМН, г. Новосибирск Ведущее учреждение: Научно исследовательский институт медицинской генетики СО РАМН, г. Томск

Защита состоится «_» 2011 г. на утреннем заседании диссертационного совета по защите диссертаций на соискание ученой степени доктора наук (Д 003.011.01) в Институте цитологии и генетики СОРАН, в конференц-зале Института по адресу 630090,г. Новосибирск, проспект академика Лаврентьева, 10.

Тел/факс: (383) 3331278, e-mail: dissov@bionet.nsc.ru

С диссертацией можно ознакомиться в библиотеке Института цитологии игенетики СО РАН.

Автореферат разослан "" 2011г.

Ученый секретарь диссертационного совета доктор биологических наук Т.М. Хлебодарова Введение Актуальность Возрастная макулярная дегенерация (ВМД) становится основной причиной нарушения и потери зрения у людей старше 50 лет в развитых странах.

Наряду с возрастной зависимостью прослеживается генетическая составляющая ВМД в сочетании с влиянием факторов внешней среды. Значительное количество вовлеченных в развитие ВМД генов и наличие симптомов, характерных так же и для других комплексных заболеваний, усложняют диагностику. В основе патогенеза ВМД лежат характерные для старения изменения хориокапилляров, ретинального пигментного эпителия (РПЭ) и мембраны Бруха, но механизмы, запускающие переход обычных возрастных изменений в патологический процесс, не известны. Считается, что развитие ВМД связано с гипоксией и воспалением (Feigl, 2007, 2009).





В качестве основного повреждающего звена выступает окислительный стресс - нарушение баланса в системах генерации и детоксикации активных форм кислорода (АФК). Клинические проявления сильно зависят от формы ВМД: при «сухой» форме – зоны атрофии клеток РПЭ и фоторецепторов, наличие депозитов веществ в сетчатке; при «влажной» - отеки, кровоизлияния, рост новых сосудов или неоваскуляризация и отслойка пигментного эпителия, которые приводят к гибели фоторецепторов и потере зрения. Растт количество аргументов в пользу того, что ключевую роль в развитии заболевания играют повреждения клеток РПЭ в силу множества выполняемых ими функций и уникального расположения во внешней сетчатке (Strauss, 2005, Bonilha, 2008). Клетки РПЭ секретируют множество ростовых факторов, в том числе – эндотелиальный фактор роста А (vascular endothelial growth factor А- VEGF-А, далее VEGF) – главный ангиогенный фактор в сетчатке. Именно с повышенным уровнем VEGF связано развитие неоваскуляризации (главной причины потери зрения при ВМД). Ингибиторы VEGF подавляют процесс патологического роста сосудов. Усиление экспрессии гена Vegfa на поздних стадиях заболевания вызывают гипоксия и воспаление, играющие ключевую роль в патогенезе ВМД.

Основным антагонистом VEGF в сетчатке является фактор пигментного эпителия (pigment-epithelium derived factor – PEDF), также секретируемый клетками РПЭ и обладающий ангиостатическими и нейротрофическими свойствами. Гипоксия является основным регулятором экспрессии гена VEGF через фактор транскрипции HIF-1, стабильность которого определяет пролил гидроксилаза 2 (prolyl hyxroxylases 2 –PHD-2). На сегодня вклад изменений экспрессии генов этих ключевых регуляторов ангиогенеза (VEGF, PEDF, PHD2) в процесс нормального физиологичного старения и тем более в развитие ВМД, особенно на ранних стадиях, остатся до конца не ясным в силу сложности проведения таких исследований у людей.

Создание биологических моделей заболеваний человека – один из подходов к выяснению их этиологии и патогенеза, к разработке новых способов лечения. В последние годы получены убедительные аргументы в пользу того, что в качестве модели ВМД можно рассматривать созданную в ИЦиГ СО РАН генетическую линию крыс OXYS, для которой характерно преждевременное старение. Линия получена селекцией и инбридингом крыс Wistar, чувствительных к катарактогенному эффекту галактозы (Соловьева и др., 1975). В 5-ти первых поколениях развитие катаракты провоцировали нагрузкой галактозой, в дальнейшем отбор шл по ранней спонтанной катаракте, сцеплено с которой животные унаследовали синдром преждевременного старения, в том числе – ретинопатию, по клиническим проявлениям аналогичную ВМД у людей. Для доказательства соответствия адекватности модели необходимо установить молекулярные основы развития ретинопатии. Максимально полная характеристика линии крыс OXYS как модели ВМД имеет как фундаментальное, так и прикладное значение. Е использование позволит исследовать патогенез заболевания, анализировать генетически детерминированные особенности его течения и давать объективную оценку эффективности новых способов лечения. Примером успешного использования крыс OXYS явилось выявление уникального терапевтического потенциала соединения принципиально нового класса – антиоксиданта, способного проникать и накапливаться в митохондриях - пластохинонил-децилтрифенилфосфония (SkQ1, Скулачев, 2007, Neroev et al., 2008). Соединение уже используется в ветеринарии в форме глазных капель, проводятся его клинические испытания, однако молекулярные механизмы действия SkQ при ретинопатии не изучены.





Цель и задачи исследования Цель настоящей работы - исследование связи развития ретинопатии у крыс OXYS с изменениями экспрессии генов Vegfa, Pedf и Phd-2 в тканях глазного дна и влияния на не митохондриального антиоксиданта SkQ1.

Для достижения поставленной цели решались следующие задачи:

1. Провести сравнение возрастных изменений паттернов экспрессии генов Vegfa, Pedf и Phd-2 в тканях глазного дна крыс OXYS и Wistar.

2. Сопоставить изменения экспрессии генов Vegfa, Pedf и Phd-2 с морфологическими изменения хориоретирального комплекса сетчатки крыс OXYS.

3. Исследовать возможную связь развития ретинопатии у крыс OXYS с изменениями экспрессии генов Vegfa, Pedf и Phd-2.

4. Изучить влияние митохондриального антиоксиданта SkQ1 на уровень экспрессии генов Vegfa, Pedf и Phd-2 в тканях глазного дна крыс OXYS.

Научная новизна Впервые изучена экспрессия генов Vegfa, Pedf и Phd-2 в сетчатке преждевременно стареющих крыс OXYS и контрольных крыс Wistar в возрасте от 20 дней до 24 мес. и выявлены межлинейные различия, ассоциированные с развитием ретинопатии у крыс OXYS. Структурно-функциональной основой развития ретинопатии являются изменения клеток ретинального пигментного эпителия (дистрофические на доклинических стадиях заболевания, дегенеративные – на поздних) и нарушение кровотока в хориокапиллярах. Они выявляются у крыс OXYS начиная с возраста 20 дней при наличии молекулярных признаков острой гипоксии в сетчатке и отсутствии характерного для не компенсаторного ответа – изменения экспрессии генов Vegfa и Pedf. Впервые показано, что первые клинические проявления ретинопатии развиваются у крыс OXYS к возрасту 3 месяцев на фоне характерного для хронической гипоксии снижения уровня мРНК гена Phd-2 и значительно сниженного по сравнению с крысами Wistar уровня мРНК и белковых продуктов генов Vegfa и Pedf. При выраженных стадиях заболевания уровень мРНК генов Vegfa и Pedf у крыс OXYS не отличается от крыс Wistar, а содержание белка Vegfa снижено. Установлено, что направленность изменений экспрессии генов Vegfa, Pedf и Phd-2 под влиянием митохондриального антиоксиданта SkQ1 у крыс OXYS и Wistar различна и зависит от возраста животных. Впервые показано, что и профилактический, и лечебный эффект SkQ1 в отношении ретинопатии у крыс OXYS связан с нормализацией экспрессии генов Vegfa, Pedf и Phd-2, характер изменения которой зависит от стадии заболевания.

Теоретическя и практическая значимость Знание закономерностей изменения с возрастом и при развитии ретинопатии экспрессии в сетчатке ключевых регуляторов ангиогенеза - генов Vegfa и Pedf - расширяет представления и о механизмах участия этих генов в процессе старения и в патогенезе ВМД, особенно на ранних стадиях заболевания. Полученные данные позволяют рассматривать эти гены как потенциальные кандидаты для создания в перспективе диагностической системы, нацеленной на раннее выявление ВМД у людей. Практическая значимость работы определяется доказательством соответствия линии крыс OXYS критериям модели ВМД на молекулярно-генетическом уровне, возможности е использования для исследования патогенеза заболевания, в том числе на ранних доклинических стадиях их развития, а также для корректной оценки эффективности терапевтических воздействий, направленных на его лечение и профилактику. Выявленная ассоциация развития ранних стадий ретинопатии со сниженным уровнем экспрессии генов Vegfa и Pedf и нарушениями сосудов хориоидеи указывает на необходимость выработки объективных критериев правомерности применения ингибиторов фактора VEGF для лечения атрофической формы ВМД с локальными точечными кровоизлияниями в сетчатке.

Положения выносимые на защиту 1. Развитие ретинопатии у крыс OXYS связано с изменениями экспрессии генов Vegfa и Pedf, в основе которых лежат структурно-функциональные изменения клеток ретинального пигментного эпителия.

2. Характер изменения экспрессии генов Vegfa, Pedf и Phd-2 в сетчатке крыс под влиянием митохондриального антиоксиданта SkQ1 зависит от генотипа животных, их возраста, а его терапевтический эффект в отношении ретинопатии у крыс OXYS связан с нормализацией экспрессии этих генов.

Апробация работы и публикация Полученные результаты были представлены и обсуждены на: XLVI и XLVII Международной научной студенческой конференции «Студент и научно-технический прогресс»: Биология в г. Новосибирске, 2008 и 2010 гг.;

ежегодной научной конференции «Фундаментальные науки – медицине»в г.

Новосибирске, 2008 и 2010 гг.; XIXth IAGG World Congress of Gerontology and Geriatrics в г. Париже в 2009 г.; Всероссийской научно-практической конференции «Фундаментальные аспекты компенсаторноприспособительных процессов» в г. Новосибирске, 2009 г.; Российском офтальмологическом форуме в г. Москве, 2009 г.; The seventh international conference of bioinformatics of genome regulation and structure\systembiology в г. Новосибирске, 2010 г.; Международной крымской конференции «Окислительный стресс и свободнорадикальные патологии» в г. Судаке, 2010 г.

Вклад автора.

Основные результаты получены автором самостоятельно. Автор принимал личное участие в планировании, проведении и обсуждении всех экспериментов, по результатам которых написана диссертация. Офтальмологические осмотры животных проводились д.м.н. А.Ж.Фурсовой, их результаты анализировались самостоятельно. Гистологическое исследование выполнено в рамках совместных исследований с к.б.н. А.А.Жданкиной.

Структура и объем работы Диссертация включает введение, обзор литературы, материалы и методы, результаты, обсуждение, выводы и список цитируемой литературы. Работа изложена на 151 странице, содержит 27 рисунков.

Животные. Работа выполнена на 384 крысах-самцах линий OXYS и Wistar в возрасте от 20 дней до 24 мес. на базе ЦКП «Генофонды экспрериментальных животных» ИЦиГ СО РАН. Животных содержали при естественном освещении и свободном доступе к воде и пище группами по 5 особей в клетках размером 573620 см при температуре 22±20С.

Офтальмологические осмотры проводили с помощью прямого офтальмоскопа "Betta" (Германия) после расширения зрачков 1% раствором тропокамида. Наличие и степень выраженности изменений сетчатки оценивали в соответствии с протоколом Age-Related Eye Disease Study (AREDS) (http://eyephoto.ophth.wisc.edu).

ПЦР в реальном времени. Уровень экспрессии генов исследовали методом ПЦР в реальном времени в присутствии красителя SYBR Green I. В качестве гена сравнения использовали «ген домашнего хозяйства» RPL 30 (белок большой субъединицы рибосомы). Использовались следующие праймеры:

для Rpl30- 5ATGGTGGCTGCAAAGAAGAC3 и 5CAAAGCTGGACAGTTGTTGG3; для Vegfa - 5CTGGCTTTACTGCTGTACCTCCACC3 и 5GGCACACAGGACGGCTTGAA3; для Pedf - 5GATTGCCCAGCTGCCTTTGACA и 5GGGACAGTCAGCACACTT GGATAG3 для Phd2 - 5ATAAAGACTGGGACGCCAAG3 и 5TTCAA CCCTCACACCTTTCTC3. По получаемым стандартным калибровочным кривым определяли относительный уровень кДНК исследуемых генов (Nolan et al., 2006).

Определение содержания белков. Содержания белка PEDF проводили методом вестерн блот анализа и после разделения белков сетчатки в 14% полиакриламидном геле. Качество переноса белков контролировали окрашиванием мембраны раствором PonceauS в 1% уксусной кислоте.

Интенсивность полос белка при окрашивании мембраны использовали для последующей нормализации данных (Romero-Calvo et al., 2010, Aranha et al., 2010). После блокирования 5% обезжиренным молоком, мембрана инкубировалась ночь с антителами против PEDF в 5% обезжиренном молоке (1:200, Santa Cruz) при 40С. Инкубация с вторичными антителами в 5% обезжиренном молоке (1:5000, Santa Cruz) проводилась в течение 2 часов при комнатной температуре. Проявленные пленки сканировались, и интенсивность свечения бендов замерялась с помощью программы ImageJ (http://rsb.info.nih.gov/ij/).

Содержание белка VEGF оценивали иммуноферментным анализом (ELISA), используя набор Rat VEGF ELISA Kit (RayBiotech), согласно рекомендациям производителя.

Гистологический и морфометрический анализ. Заднюю часть глаза фиксировали в 2,5% глютаральдегиде и 2% OsO4, дегитратировали в спиртах возрастающей концентрации и ацетоне, заливали в epon-812. Полутонкие срезы готовили на ультратоме LKB-4 и окрашивали 0,1% толуидиновым синим. Подсчеты проводились на областях от 50 до 250 мкм по 50 полей от каждого животного. Площадь клеток РПЭ и удельная площадь хориоидальных сосудов измеряли с помощью программного обеспечения Axiovision (Zeiss, Thornwood, NY).

Влияние антиоксиданта SkQ1 на развитие ретинопатии у крыс OXYS и экспрессию генов в сетчатке оценивали в двух экспериментах. При оценке профилактического эффекта крысы OXYS и Wistar опытных групп получали ежедневно с кормом по 250 нмоль SkQ1 на кг массы тела с возраста 1,5 до мес., контролем служили интактные животные. При оценке лечебного потенциала крысы OXYS и Wistar с возраста 9 до 12 мес. ежедневно получали SkQ1 в форме глазных капель (250нМ), контрольные - плацебо. До и после начала экспериментов проводились офтальмологические осмотры. По окончании прима препарата забирали образцы сетчатки.

Статистический анализ результатов проводился с помощью программы Statistica 6.0 («Statsoft», США). Использовали факторный дисперсионный анализ (ANOVA) с post-hoc сравнениями групповых средних (Newman-Keul test). Как независимые факторы рассматривали генотип (Wistar, OXYS), возраст и препарат. Для анализа влияния антиоксиданта SkQ1 на состояние сетчатки использовали зависимые парные сравнения состояния сетчатки до и после воздействия антиоксиданта (T-тест). Результаты Western blot анализа оценивали, используя непараметрический U-тест Манна-Уитни. Данные представлены как M±S.Е. Во всех анализах результат считался статистически значимым при р0.05.

Возрастные изменения сетчатки крыс Согласно офтальмоскопическим осмотрам, у крыс Wistar первичные патологические изменения сетчатки выявляются только в возрасте 24 мес. и строго не могут быть классифицированы как ретинопатия. У двадцатидневных крыс OXYS клинические проявления ретинопатии отсутствуют (Рис. 1).

мес. у 22% крыс OXYS. Анализ результатов офтальмологических осмотров позволяет выделить два критических периода развития ретинопатии у Рис. 1. Доля глаз крыс OXYS с различимеют патологические изменения ными стадиями ретинопатии в зависимости от возраста. 0-3 –стадии ретино- глазного дна, соответствующие 1-й патии по классификации AREDS мес. – период активного прогрессирования ретинопатии, которая достигает в основном 2-й стадии (большие «мягкие» и твердые друзы с тенденцией к сливанию, отек центральной зоны сетчатки, серозная отслойка пигментного эпителия и нейроретины). К возрасту 24 мес. необратимые изменения сетчатки, соответствующие 3-й стадии ретинопатии (геморрагическая отслойка сетчатки, кровоизлияния в центральную область, формирование новых сосудов – неоваскуляризация – и признаки рубцевания), наблюдались почти у всех крыс OXYS.

Ранее предполагалось, что изменения морфологии сетчатки у крыс OXYS развиваются к возрасту 5 мес., а в 3 мес. отсутствуют. Однако выполненный нами морфометрический анализ показал, что уже в возрасте 20 дней в хориоидее незначительно, но достоверно увеличен процент сосудов с признаками тромбоза и стаза (рис. 2б). При этом у крыс OXYS удельная площадь клеток РПЭ меньше, чем у крыс Wistar (рис. 2а), имеются признаки структурно-функциональных нарушений: наряду с нормально функционирующими клетками выявляются клетки РПЭ с вакуолями в цитоплазме, нарушениями микроворсинок и базальной складчатости, сниженным количеством фагосом.

Согласно современным представлениям, развитие сначала структурнофункциональных нарушений клеток РПЭ, а затем хориокапилляров характерно для сухой формы ВМД. В этой связи можно заключить, что у крыс OXYS ретинопатия соответствует атрофической форме ВМД.

Рисунок 2. (а) Средняя площадь клетки РПЭ в срезе и (б) площадь сосудов хориоидеи со стазом и тромбозом. ^ - по сравнению с предыдущим возрастом; * - по сравнению с крысами Wistar. n= Профиль экспрессии генов Vegfa и Pedf и развитие ретинопатии у крыс OXYS В литературе отсутствуют сведения об экспрессии генов антагонистов Vegfa и Pedf на ранних, а тем более - доклинических стадиях развития ВМД у людей. Более того, к моменту постановки задачей исследования в литературе не было информации о возрастных изменениях экспрессии генов Vegfa и Pedf в сетчатке. Первая работа об изменениях с возрастом экспрессии этих генов в сетчатке здоровых крыс, появилась в 2008 году (Steinle et al.). Наше исследование показывает, что роль фактора VEGF неоднозначна на разных стадиях развития ретинопатии у крыс OXYS и ранние стадии развиваются на фоне сниженной экспрессии генов Vegfa и Pedf, а так же сниженного уровня мРНК гена Phd2.

С возрастом уровень мРНК генов Vegfa и Pedf в сетчатке крыс OXYS и Wistar существенно снижается, начиная с 20-ти дневного возраста (~10 и ~ раз для генов Vegfa и Pedf соответственно, рис. 3а и 4а). Принципиально важно, что у крыс OXYS уровень мРНК значительно снижается уже к возрасту 3 мес., в то время как у крыс Wistar такое снижение происходит лишь к возрасту 12 мес. (рис. 3а и 4а). Отсутствие межлинейных различий в уровне мРНК в возрасте 20 дней косвенно указывает на то, что изменения экспрессии вторичны по отношению к изменениям функционального Рисунок 3. (а) Уровень мРНК гена Vegfa в сетчатке крыс. n=5. (б) Содержания белка VEGF в сетчатке крыс n=4-8. ^ - достоверные различия по сравнению с предыдущим возрастом; * - по сравнению с крысами Wistar состояния клеток РПЭ. В сетчатке оба фактора – VEGF и PEDF – экспрессируются и секретируются именно клетками РПЭ. Можно полагать, что ускоренное снижение их экспрессии на уровне мРНК в сетчатке крыс OXYS происходит из-за нарушений клеток РПЭ и становится отражением снижения их функциональной активности.

Рисунок 4. (а). Уровень мРНК гена Pedf в сетчатке крыс. n=5. (б) Содержания белка PEDF в сетчатке крыс OXYS. Данные представлены как процент к уровню одновозрастных крыс Wistar. n=3-4. ^ - достоверные различия по сравнению с предыдущим возрастом; * достоверные различия по сравнению с крысами Wistar. ^ - достоверные различия по сравнению с предыдущим возрастом Таким образом, у крыс OXYS снижение экспрессии ключевых регуляторов ангиогенеза в сетчатке происходит значительно раньше, чем у крыс Wistar, и по времени оно совпадает с периодом нарушения состояния сосудов и ухудшением состояния клеток РПЭ, а также с периодом активной манифестации клинических проявлений ретинопатии.

Следует рассмотреть различия возрастных изменений экспрессии генов Vegfa и Pedf у крыс OXYS и Wistar (у последних мы не выявили патологических изменений сетчатки вплоть до 24 мес.). Если уровень мРНК указанных генов у крыс OXYS существенно не меняется с возраста 3 до мес., то у крыс Wistar уже с возраста 12 мес. она начинает повышаться и в мес. (рис. 3а и 4а) достигает половины уровня, свойственного 20-ти дневным крысам этой линии. Мы полагаем, что у крыс Wistar с возрастом из-за снижения экспрессии генов Vegfa и Pedf также постепенно нарушаются связи между клетками РПЭ и хориокапиллярами и развивается гипоксия. Это провоцирует активацию гипоксия-зависимых сигнальных путей и повышение экспрессии гена Vegfa, но одновременно с уровнем экспрессии Vegfa растет и экспрессия гена его ключевого антагониста – Pedf. Известно, что эти факторы регулируют экспрессию друг друга (Ohno-Matsui et al., 2003). В результате у крыс Wistar сохраняется баланс между про- и антиангиогенными факторами и развивается сбалансированный ответ на регуляторные изменения сетчатки, что препятствует развитию патологических изменений вплоть до 24 мес. У крыс OXYS такой компенсаторной реакции мы не наблюдали, и уровень экспрессии генов Vegfa и Pedf оставался низким, на уровне 3-х мес. животных.

Несколько иными оказались возрастные изменения содержания продуктов исследованных нами генов – белков VEGF и PEDF. Содержание белка VEGF в сетчатке крыс обеих линий было одинаковым в возрасте дней (рис. 3б), снижалось к 3 мес., а затем росло и достигало максимальных значений у двухгодовалых животных (рис. 3б). Иначе говоря, снижение уровня мРНК гена Vegfa сопровождалось накоплением его белкового продукта, что может являться важной предпосылкой развития ретинопатии:

как известно, поздние стадии ВМД ассоциированы с повышенным уровнем VEGF. В возрасте 20 дней межлинейных различий в содержании белков VEGF и PEDF выявлено не было (рис. 3б и 4б), а в возрасте 3 мес.

содержание обоих белков у крыс OXYS было ниже, чем у крыс Wistar.

Сниженное содержание VEGF в сетчатке крыс OXYS при сравнении с крысами Wistar сохранялось и в старших возрастных группах. Как отмечалось выше, в возрасте 3 мес. экспрессия генов Vegfa и Pedf на уровне мРНК у крыс OXYS существенно снижена по сравнению с крысами Wistar. Но если на уровне мРНК снижение было 10- и 5-кратным, соответственно, то по содержанию белков VEGF и PEDF межлинейные различия достигали лишь 35% и 30%, соответственно (рис. 3 и 4). Возможно, синтез относительно большого количества белка на меньшем количестве мРНК у крыс OXYS достигается за счет пост-транскрипционной и/или посттрансляционной регуляции.

Как бы то ни было, у крыс OXYS развитие ретинопатии происходит на фоне сниженной как на уровне мРНК, так и на уровне белка экспрессии генов Vegfa и Pedf, что, можно полагать, связано с нарушением кислородного баланса.

Связь системы регуляции кислородного гомеостаза с изменениями экспрессии генов Vegfa и Pedf у крыс OXYS Результаты наших офтальмологических и морфологических исследований свидетельствуют о наличии зон ишемии в сетчатке крыс OXYS, начиная с возраста 3 мес., а нарушений кровотока – с 20 дней.

Подтверждением гипоксического состояния в сетчатке крыс OXYS могут служить данные об экспрессии гена пролил гидроксилазы 2 Phd2. В возрасте 3 и 12 мес. нами обнаружен сниженный уровень мРНК этого гена в сетчатке крыс OXYS по сравнению с крысами Wistar (рис. 5).

Рисунок 5. Уровень мРНК гена Phd2 в гипоксию е косвенного молекулярного сетчатке крыс. * - достоверные различия по сравнению с крысами Wistar. маркера – Vegfa. Такая ситуация n=5- этом у крыс Wistar реакция на гипоксию в возрасте 17 и 24 мес.

присутствовала. Аналогичные результаты получены на двухлетних крысах в работе Steinle и соват. (2008), что указывает на то, что развивающиеся в сетчатке крыс Wistar изменения экспрессии гена Vegfa характерны для физиологического старения.

При исследовании экспрессии гена Phd2 в сетчатке 20-дневных животных установлено, что уровень мРНК гена Phd2 у крыс OXYS был выше, чем у крыс Wistar (рис. 5), что характерно для острой стадии гипоксии.

Экспрессии Phd2 может приводить к подавлению пролиферации эндотелия сосудов (Takeda, 2007b), нарушению формирования микроциркуляторного русла, как это недавно показано при ретинопатии, индуцированной кислородом (Duan et al., 2011).

Таким образом, впервые прослежены изменения экспрессии генов Vegfa и Pedf в сетчатке начиная с возраста 20 дней до 24 месяцев у крыс OXYS и Wistar. Выявлены генетически детерминированные отличия изменений экспрессии генов у крыс OXYS, ассоциированные с развитием ретинопатии.

Связь терапевтических эффектов прима SkQ1 с кормом с влиянием на экспрессию генов Vegfa, Pedf и Phd2 в сетчатке В своей работе, мы подтвердили способность митохондриального антиоксиданта SkQ1 полностью предотвращать развитие ранней ретинопатии у крыс OXYS при его включении в рацион молодых животных (с 1,5 мес.) в период активной манифестации первых клинических признаков заболевания (Табл. 1). Важным является тот факт, что антиоксидант не вызвал побочных эффектов в сетчатке здоровых крыс Wistar.

Опыт SkQ1 с кормом с 1,5 до 3 мес. из рас- SkQ1 в виде глазных капель (250нМ) Осмотры Таблица 1. Влияние SkQ1 на состояние глазного дна крыс OXYS. В таблице представлен процент глаз животных с соответствующей стадией заболевания. 0-2 –стадии ретинопатии, по международной классификации AREDS.

В этом эксперименте экспрессия генов Vegfa и Pedf в сетчатке контрольных крыс OXYS возрасте 3 мес. была ниже, чем у контрольных Рисунок 6. Эффект SkQ1 (а) на уровень мРНК гена возрасте 3 месяцев был Vegfa, n=7 (б) на содержание белка VEGF в сетчатке, ниже, чем у контрольных n=4.. ^ - достоверные различия по сравнению с крыса- крыс Wistar, что ми Wistar; * - эффект препарата.

данным экспериментам по оценке возрастных изменений экспрессии генов Vegf и Pedf (рис. 3, 4, 6, 7). Содержание белков VEGF и PEDF в сетчатке контрольных крыс OXYS также было ниже, чем у крыс Wistar, однако межлинейные различия в этих независимых опытах были сопоставимы.

Различия кратности между результатами двух экспериментов по уровню мРНК могли быть обусловлены неодинаковой выраженностью патологических изменений сетчатки крыс OXYS: процент животных с выраженной (2-й) оценке терапевтического эффекта SkQ1 был ниже, чем в экспрессии генов Vegfa и Pedf Рис. 7. Эффект SkQ1 (с кормом с 1,5 до 3 мес, (17 против 25%). Полученные нмоль/кг) на (а) уровень мРНК гена Pedf. n=8-10, и результаты согласуются с (б) на содержание белка PEDF (вестерн блот) в выявленной нами картиной сетчатке. n=3. * - достоверные межлинейные разразвития заболевания: ранние личия.

стадии ретинопатии протекают на фоне сниженной экспрессией гена Vegfa.

Исследования показали, что профилактический эффект SkQ1 на молекулярном уровне связан с предотвращением снижения уровня мРНК гена Vegfa у крыс OXYS (рис. 6а) и, как следствие, с повышением содержания его белка до уровня контрольных крыс Wistar. Подобные данные еще раз подтверждают связь развития ранней ретинопатии у крыс OXYS с нарушением экспрессии Vegfa.

Как и при оценке возрастных изменений возрастных изменений уровня мРНК гена Phd2, у контрольных крыс OXYS мы выявили сниженный уровень мРНК гена Phd2 (рис. 8а), что указывает на функционирование сетчатки 3-мес. крыс в условиях гипоксии. На фоне прима SkQ1 произошло повышение экспрессии этого гена до уровня крыс Wistar, что предполагает Рисунок 8. Эффект SkQ1 на уровень мРНК гена Phd2. улучшает состояние. ^ - достоверные различия по сравнению с крысами Wistar. n=7-8. (а) SkQ1 с кормом с 1,5 до 3 мес. из рас- сосудов хориоидеи, чета 250 нмоль/кг веса животного. (б) SkQ1 в виде глазных капель (250нМ) с 9 до 12 мес.

экспрессия Vegfa на фоне прима препарата у крыс OXYS возросла как на уровне мРНК, так и на уровне белка (рис. 6 и 7), до уровня, характерного для сетчатки здоровых крыс Wistar, иначе говоря - нормализовалась.

Примечательно, что мы не обнаружили какого-либо эффекта SkQ1 на экспрессию Pedf в сетчатке 3-х мес. животных: как у контрольных, так и у получавших антиоксидант крыс OXYS уровень мРНК Pedf оставался более низким, чем у крыс Wistar (рис. 7). Известно, что PEDF обладает антиангиогенными свойствами и является самым сильным эндогенным ингибитором ангиогенеза. Возможно, сниженный уровень экспрессии Pedf у функционированию сосудов и поддержанию нормального метаболизма в сетчатке.

Таким образом, способность митохондриального антиоксиданта SkQ предупреждать развитие ретинопатии у крыс OXYS связана с его влиянием на уровень экспрессии генов ключевых регуляторов ангиогенеза Vegfa и Pedf и сенсора кислорода - Phd2.

Связь терапевтических эффектов глазных капель SkQ1 с влиянием на экспрессию генов Vegfa, Pedf и Phd2 в сетчатке Капли – наиболее предпочтительная лекарственная форма при лечении глазных заболеваний. После лечения крыс каплями SkQ1 (250 нМ, прим с до 12 мес.) мы обнаружили у крыс OXYS увеличение доли глаз без признаков ретинопатии (Табл. 1), в то время как в контрольной группе заболевание активно прогрессировало. На крыс Wistar антиоксидант не оказал побочных эффектов.

Мы показали, что лечебный эффект антиоксиданта, как и профилактический, сопряжен с его влиянием на экспрессию генов Vegfa и Pedf и Phd2 в сетчатке крыс OXYS. Как и ранее, у контрольных крыс OXYS в возрасте 12 мес. уровень мРНК Vegfa был таким же, как у крыс Wistar, а уровень белка даже снижен (рис. 3 и 9).

Рисунок 9. Эффект капель SkQ1 (250 нМ, с 9 до 12 мес.) (а) на уровень мРНК гена Vegfa. n=8-10 (б) на содержание белка VEGF в сетчатке. n=4 (в) на уровень мРНК гена Pedf. n=8-10 ^ -по сравнению с крысами Wistar;*-эффект препарата.

Прим капель SkQ1 вызвал у крыс OXYS снижение экспрессии гена Vegfa и на уровне мРНК, и на уровне белка, а также повышение уровня мРНК гена Pedf (рис. 9в) по сравнению с контрольными животными. На экспрессию гена Phd2 в сетчатке крыс OXYS антиоксидант никак не повлиял (рис. 8б). У крыс Wistar эффект капель SkQ1 на экспрессию генов оказался противоположным: SkQ1 повысил мРНК и белок гена Vegfa (рис. 9а, б) и снизил, по сравнению с контролем, уровень мРНК генов Pedf и Phd2 в сетчатке (рис. 8б и 9в). Можно полагать, межлинейные различия в реакции на SkQ1 связаны с особенностями состояния сетчатки годовалых животных. У крыс OXYS к этому возрасту развиваются выраженные стадии заболевания.

В такой ситуации снижение уровня VEGF способно предотвратить вызываемые повышенными концентрациями этого фактора нарушения проницаемости сосудов и отеки, неоваскуляризацию.

У крыс Wistar признаки ретинопатии при офтальмоскопических осмотрах не выявляются как в возрасте 12 мес., так и в старших возрастных группах. Тем не менее, у годовалых крыс Wistar на молекулярном уровне появляются молекулярные предпосылки, которые в дальнейшем и приводят к органическим изменениям. SkQ1 создает молекулярные условия для поддержания сосудов хориоидеи в сетчатке через повышение экспрессии Vegfa и снижение Pedf, что препятствует развитию ретинопатии. При этом ответ на SkQ1 включал в себя снижение экспрессии гена Phd2 и повышение экспрессии гена VEGF, что, скорее всего, опосредованно у крыс Wistar HIFсигнальным путм.

Сходные изменения уровня мРНК гена Vegfa после приема SkQ1 с кормом наблюдались у крыс OXYS в возрасте 3 мес., когда у них происходит активная манифестация ретинопатии. И хотя для крыс Wistar не характерно развитие патологических изменений, предпосылки для этого, можно полагать, у годовалых животных уже формируются. Примечательно, что характер изменения - снижение количества белка VEGF у крыс Wistar в возрасте 25 мес. в ответ на SkQ1 (рис. 10) - соответствовал реакции годовалых крыс OXYS. То есть и в этом случае мы видим однонаправленные Рисунок 10. Эффект SkQ1 на соизменения экспрессии генов под влиянием держание белка VEGF в сетчатантиоксиданта у крыс OXYS и Wistar, но в ке в 25 мес. ^ -по сравнению с разные возрастные периоды. В этой связи крысами Wistar; * - эффект препредставляется закономерным отсутствие парата. n= изменений на уровне белка VEGF у крыс OXYS в ответ на воздействие SkQ в возрасте 25 мес. (рис. 10). К этому возрасту в сетчатке крыс OXYS развивается практически полный фиброз хориоидеи и атрофия слоя РПЭ.

Таким образом, терапевтическая способность SkQ1 снижать выраженность уже развитых признаков ретинопатии у крыс OXYS связана так же связана с нормализацией экспрессии генов Vegfa и Pedf. У крыс Wistar в ответ на SkQ1 наблюдалось изменение экспрессии генов Vegfa, Pedf и Phd2, которое качественно соответствовало изменению экспрессии генов у крыс OXYS при профилактике ранней ретинопатии.

1. Впервые проведено сравнение возрастных изменений экспрессии генов Vegfa, Pedf и Phd-2 в сетчатке крыс Wistar и OXYS и выявлены различия, ассоциированные с развитием ретинопатии, нарушением регуляции кислородного гомеостаза и ответа на развивающуюся сетчатке крыс OXYS гипоксию.

2. Установлено, что в развитии у крыс OXYS ретинопатии участвуют те же структуры сетчатки и молекулярно-генетические факторы, что и при возрастной макулярной дегенерации у людей, однако направленность изменений экспрессии генов Vegfa, Pedf и Phd-2 и их вклад в развитие патологических изменений зависит от стадии заболевания.

3. При отсутствии клинических проявлений ретинопатии у крыс OXYS в возрасте 20 дней выявлено характерное для острой гипоксии увеличение уровня мРНК гена Phd-2 и снижение площади клеток ретинального пигментного эпителия при не отличающихся от крыс Wistar уровнях мРНК и белков генов Vegfa и Pedf.

4. Развитие ранних стадий ретинопатии у крыс OXYS происходит к возрасту 3-х месяцев на фоне значительного снижения уровня мРНК генов Vegfa и Pedf и содержания их белковых продуктов и характерного для хронической гипоксии снижения уровня мРНК гена Phd- 5. Развитие выраженных стадий ретинопатии у крыс OXYS происходит с месяцев на фоне не отличающегося от крыс Wistar уровня мРНК генов Vegfa и Pedf, а содержание белка Vegfa и уровень мРНК гена Phd-2. снижены, что указывает на нарушение регуляции кислородного гомеостаза и ответа на развивающуюся в сетчатке крыс OXYS гипоксию.

6. Показано, что характер изменения профиля экспрессии генов Vegfa, Pedf и Phd-2 в сетчатке под влиянием митохондриального антиоксиданта SkQ1 у крыс Wistar и OXYS различен; при этом масштабы и направленность его изменений зависят от возраста животных, а терапевтический эффект в отношении ретинопатии у крыс OXYS ассоциирован с нормализацией экспрессии этих генов.

Список работ, опубликованных по теме диссертации:

Статьи:

1. Марковец А.М., Колосова Н.Г. Обзор. Возрастная макулярная дегенерация и участие фактора роста сосудистого эндотелия в е патогенезе // Российский офтальмологический журнал. – 2009. - Т. 2. - № 3. - С. 51Марковец А.М., Жданкина А.А., Фурсова А.Ж. Возрастные изменения экспрессии генов VEGF и PEDFи развитие клинико-морфологических проявлений хориоретинальной дегенерации у крыс OXYS// Сборник научных трудов Российского офтальмологического форума. - М. – 2009.

– Т. 2. - С. 184-188.

3. Markovets AM, Saprunova VB, Zhdankina AA, FursovaAZn, Bakeeva LE, Kolosova NG. Alterations of retinal pigment epithelium cause AMD-like retinopathy in senescence-accelerated OXYS rats // Aging (Albany NY). – 2011.

– Vol. 3(1). – P. 44-54.

4. Markovets AM, FursovaAZn, KolosovaNG.Therapeutic Action of the Mitochondria-Targeted Antioxidant SkQ1 on Retinopathy in OXYS Rats Linked with Improvement of VEGF and PEDF Gene Expression // PLoSOne – 2011.

– Vol. 6(7):e21682. Epub 2011 Jul 5.

Тезисы конференций:

5. Марковец А.М. Экспрессия гена VEGF в тканях глазного дна при развитии дистрофии сетчатки у крыс OXYS. // Материалы XLVI Международной научной студенческой конференции «Студент и научнотехнический прогресс»: Биология. – Новосиб. гос. ун-т. – Новосибирск – 2008. – с. 114- 6. Марковец А.М., Фурсова А.Ж., Колосова Н.Г.Экспрессия гена VEGF-A в сетчатке крыс OXYS при развитии дистрофии сетчатки в лечении митохондриально-направленным антиоксидантом SkQ 1// Тезисы научнопрактической конференции «Фундаментальные науки – медицине». – Новосибирск. – 2008. – С. 40.

А.М. Марковец, А.А. Жданкина, А.Ж.Фурсова, Н.Г. Колосова. Связь дистрофии сетчатки крыс OXYS с экспрессией генов VEGF и PEDF.

Эффекты митохондриально-направленного антиоксиданта SkQ1. // Материалы Пятого съезда вавиловского общества генетиков и селекционеров. – Москва. – 2009. – Ч. 1. – с. 8. Markovets A.M., Zhdankina A.A., Fursova A.J., Kolosova N.G. OXYS rat as animal model of age-related macular degeneration: potential for pathogenesis approach and elevation of treatment // XIXth IAGG World Congress of Gerontology and Geriatrics. - J Nutrition, Health &Aging. – 2009. – V. 13, Suppl. 1. – 2009. P. S Марковец А.М., Жданкина А.А. Перспективы использования митохондриально адресованного антиоксиданта SkQl в лечении дистрофических заболеваний сетчатки и связь его эффектов с нормализацией функций пигментного эпителия// Тезисы 4 Всероссийской научно-практической конференции «Фундаментальные аспекты компенсаторноприспособительных процессов». - Новосибирск. – 2009. – С. 144- Марковец А.М. Сравнение возрастных профилей экспрессии генов 10.

VEGF и PEDF в сетчатке крыс OXYS и Wistar // Материалы XLVIII Международной научной студенческой конференции «Студент и научно-технический прогресс»: Биология. – Новосиб. гос. ун-т. – Новосибирск – 2010. 10-14 апреля – с. 11. Markovets AM, Zhdankina AA. Pigment epithelium-derived factor (PEDF) and vascular endothelial growth factor (VEGF) expression and morphological changes during normal aging and development of retinopathy in Wistar and OXYS rat`s retina // The seventh international conference of bioinformatics of genome regulation and structure\system biology, 2010, June 20-27, Novosibirsk, p. 178.

12. Kozhevnikova OS, Efimov VM, Markovets AM, Kolosova NG. The transcriptional profile of retinal pigment epithelium/choroid of OXYS rat as a background for the retinopathy development // The seventh international conference of bioinformatics of genome regulation and structure\system biology, 2010, June 20-27, Novosibirsk, p. 141.

Марковец АМ, Колосова НГ. Молекулярные эффекты антиоксиданта 13.

SkQ1 при лечении возрастной дегенерации сетчатки // Сборник тезисов ежегодной научной конференции «Фундаментальные науки – медицине», 2010, 7-10 сентября, Новосибирск, С. Марковец А.М.,Жданкина А.А. Механизмы терапевтического эффекта 14.

митохондриального антиоксиданта SkQ1 при лечении дегенерации сетчатки у крыс OXYS // Сборник тезисов Шестой международной крымской конференции «Окислительный стресс и свободнорадикальные патологии», 2010, 20-29 сентября, г.Судак, Украина, С.

 
Похожие работы:

«Крюкова Мария Викторовна ФЛОРА НИЖНЕГО ПРИАМУРЬЯ: СОСТАВ, ЭКОЛОГО-ГЕОГРАФИЧЕСКАЯ СТРУКТУРА, СОВРЕМЕННОЕ СОСТОЯНИЕ 03.02.01 - Ботаника Автореферат диссертации на соискание ученой степени доктора биологических наук Владивосток 2013 Работа выполнена в лаборатории экологии растительности Федерального государственного бюджетного учреждения науки Институт водных и экологических проблем Дальневосточного отделения Российской академии наук Научный консультант : доктор биологических...»

«ГЕНДРИКСОН Ольга Дмитриевна ИЗУЧЕНИЕ КОЛИЧЕСТВЕННЫХ ЗАКОНОМЕРНОСТЕЙ ВЗАИМОДЕЙСТВИЯ АНТИТЕЛ С НИЗКОМОЛЕКУЛЯРНЫМИ АНТИГЕНАМИ, ИММОБИЛИЗОВАННЫМИ НА ПОВЕРХНОСТИ ЛИПОСОМ 03.00.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук Москва – 2003 Работа выполнена в лаборатории иммунобиохимии Института биохимии им. А.Н. Баха РАН. Научные руководители: доктор химических наук, профессор Б.Б. Дзантиев, кандидат биологических наук А.В. Жердев....»

«МЕФЁД Кирилл Михайлович НОВЫЙ СПОРОВЫЙ ПРОБИОТИК ИРИЛИС И ЕГО ИСПОЛЬЗОВАНИЕ В ВЕТЕРИНАРНОЙ ПРАКТИКЕ 03.00.07 –микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва 2007 Работа выполнена на кафедре микробиологии медицинского факультета Государственного образовательного учреждения высшего профессионального образования Российского университета дружбы народов Научный руководитель : доктор биологических наук Осипова Ирина Григорьевна...»

«БОЛДАРЕВА ЕКАТЕРИНА НИКОЛАЕВНА АЭРОБНЫЕ АНОКСИГЕННЫЕ ФОТОТРОФНЫЕ БАКТЕРИИ ЩЕЛОЧНЫХ МЕСТООБИТАНИЙ Специальность 03.00.07 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва, 2008 2 Работа выполнена в Институте микробиологии им. С.Н. Виноградского РАН доктор биологических наук Научный руководитель : В.М. Горленко доктор биологических наук Официальные оппоненты : Л.М. Герасименко доктор биологических наук Р.Н. Ивановский...»

«МАНУХОВ Илья Владимирович СТРУКТУРА LUX-ОПЕРОНОВ И МЕХАНИЗМЫ РЕГУЛЯЦИИ ТИПА QUORUM SENSING У МОРСКИХ БАКТЕРИЙ. (03.02.07 – Генетика) Автореферат диссертации на соискание ученой степени доктора биологических наук Москва – 2011 2 Работа выполнена в лаборатории генетики бактерий ФГУП Государственного научноисследовательского института генетики и селекции промышленных микроорганизмов (ФГУП ГосНИИгенетика) Научный консультант доктор биологических наук, профессор Завильгельский...»

«ЗИГАНШИН АЙРАТ МАНСУРОВИЧ ВОССТАНОВЛЕНИЕ АРОМАТИЧЕСКОГО КОЛЬЦА 2,4,6-ТРИНИТРОТОЛУОЛА КАК ПУТЬ ЕГО ДЕГРАДАЦИИ 03.00.07 – микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Казань-2007 Работа выполнена на кафедре микробиологии Казанского государственного университета им. В. И. Ульянова-Ленина Научный руководитель : доктор биологических наук, профессор Наумова Римма Павловна Официальные оппоненты : доктор ветеринарных наук, профессор...»

«Русанов Александр Леонидович СПЕКТРАЛЬНО-ФЛУОРЕСЦЕНТНЫЕ СВОЙСТВА KFP И ИСПОЛЬЗОВАНИЕ ЭТОГО БЕЛКА ДЛЯ СОЗДАНИЯ СЕНСОРОВ, ОСНОВАННЫХ НА ИНДУКТИВНОРЕЗОНАНСНОМ ПЕРЕНОСЕ ЭНЕРГИИ Специальность 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата химических наук МОСКВА 2010 Работа выполнена в лаборатории физической биохимии Учреждения Российской академии наук Института биохимии им. А.Н. Баха РАН и на кафедре химической энзимологии Химического факультета...»

«Репина Екатерина Николаевна Функциональное состояние лейкоцитов крови лабораторных животных при экспериментальной анемии и влиянии фитоэкдистероидов serratula coronata l. 03.00.13 – физиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Ярославль 2007 Работа выполнена на кафедре физиологии человека и животных ГОУ ВПО Сыктывкарский государственный университет Научные руководители кандидат биологических наук, доцент Мойсеенко Н.А. доктор...»

«ПОСЕВИНА Юлия Михайловна Палиноэкологический мониторинг атмосферного воздуха г. Рязани 03.02.08 – экология (биологические наук и) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2011 Работа выполнена на кафедре экологии и природопользования естественногеографического факультета Рязанского государственного университета имени С.А.Есенина и на кафедре высших растений биологического факультета Московского государственного университета...»

«Иметхенова Оксана Васильевна SPIRAEA AQUILEGIFOLIA PALL. В РАСТИТЕЛЬНОСТИ СЕЛЕНГИНСКОГО СРЕДНЕГОРЬЯ (ЗАПАДНОЕ ЗАБАЙКАЛЬЕ) 03.00.05 Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ 2008 Работа выполнена в Бурятском государственном университете Научный руководитель : доктор биологических наук, профессор Намзалов Бимба-Цырен Батомункуевич Официальные оппоненты : доктор биологических наук, профессор Дулепова Бэлла Ивановна...»

«Вазагова Залина Мировна Трихинеллез в природных биоценозах и основные направления противотрихинеллезных профилактических мероприятий в условиях Северо-Кавказского региона 03.02.11 – паразитология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2012 Работа выполнена на биолог-технологическом факультете в ФПБОУ ВПО Северо-Осетинский государственный университет имени К.Л. Хетагурова Научный руководитель : доктор биологических наук,...»

«Волкович Марк Габриэлевич ЖУКИ-ЗЛАТКИ ПОДСЕМЕЙСТВА POLYCESTINAE (COLEOPTERA, BUPRESTIDAE): МОРФОЛОГИЯ, ФИЛОГЕНИЯ, КЛАССИФИКАЦИЯ 03.02.05 – энтомология Автореферат диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург – 2012 2 Работа выполнена в лаборатории систематики насекомых Федерального государственного бюджетного учреждения науки Зоологический институт Российской академии наук Официальные оппоненты : доктор биологических наук, профессор,...»

«ГРИЗАНОВА Екатерина Валерьевна ИММУННЫЙ ОТВЕТ, СОСТОЯНИЕ АНТИОКСИДАНТНОЙ И ДЕТОКСИЦИРУЮЩЕЙ СИСТЕМ ЛИЧИНОК БОЛЬШОЙ ВОЩИННОЙ ОГНЕВКИ GALLERIA MELLONELLA L. (LEPIDOPTERA, PYRALIDAE) ПРИ БАКТЕРИОЗАХ, ВЫЗВАННЫХ BACILLUS THURINGIENSIS 03.02.05 – энтомология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Новосибирск - 2012 Работа выполнена в лаборатории патологии насекомых Федерального государственного бюджетного учреждения науки Института...»

«ТРОФИМЧУК МИХАИЛ МИХАЙЛОВИЧ ЗАКОНОМЕРНОСТИ ФУНКЦИОНИРОВАНИЯ ВОДНЫХ МОДЕЛЬНЫХ ЭКОСИСТЕМ ПРИ ВОЗДЕЙСТВИИ ТОКСИЧЕСКИХ ФАКТОРОВ 03.02.08 – экология (биологические наук и) Автореферат диссертации на соискание ученой степени кандидата биологических наук Ростов – на – Дону, 2011 Работа выполнена в федеральном государственном бюджетном учреждении Гидрохимический институт Федеральной службы по гидрометеорологии и мониторингу окружающей среды Научный руководитель : доктор...»

«Кхатаб Зозк Сардар ЭКОЛОГО-ГЕНЕТИЧЕСКАЯ ОЦЕНКА КАЧЕСТВА ВОДЫ РОДНИКОВ Г. РОСТОВА-НА-ДОНУ МЕТОДОМ БИОТЕСТИРОВАНИЯ С ИСПОЛЬЗОВАНИЕМ СВЕТЯЩИХСЯ БАКТЕРИЙ 03.02.08 – экология (биологические наук и) 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону - 2013 2 Работа выполнена в Федеральном государственном автономном образовательном учреждении высшего профессионального образования Южный федеральный университет (г....»

«ШУЙСКАЯ Елена Александровна СИНАНТРОПНАЯ ФЛОРА ЮЖНОЙ КАРЕЛИИ 03.00.05 – ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук 2 Сыктывкар – 2009 3 Работа выполнена на кафедре ботаники и физиологии растений эколого-биологического факультета ГОУ ВПО Петрозаводский государственный университет Научный руководитель : доктор биологических наук Антипина Галина Станиславовна Официальные оппоненты : доктор биологических наук, старший научный...»

«АЛЕКСАНДРОВА Алина Витальевна ПОЧВООБИТАЮЩИЕ МИКРОСКОПИЧЕСКИЕ ГРИБЫ: ГЕОГРАФИЯ И ЭКОЛОГИЯ Специальность 03.02.12 – Микология Автореферат диссертации на соискание ученой степени доктора биологических наук Москва – 2013 Работа выполнена на кафедре микологии и альгологии Биологического факультета Московского государственного университета имени М.В.Ломоносова Научный консультант : Ирина Ивановна...»

«ХАЛИЛЬ ИСМАИЛ МОХАММАД ПРИРОДНО-КЛИМАТИЧЕСКИЕ И ПОЧВЕННЫЕ ИНДИКАТОРЫ ОПУСТЫНИВАНИЯ В ИОРДАНИИ 03.00.27 – почвоведение 03.00.16 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону 2009 2 Работа выполнена на кафедре промышленной экологии и безопасности жизнедеятельности Волгоградского государственного технического университета Научный руководитель доктор биологических наук, доцент Околелова Алла Ароновна Официальные...»

«АЛФРЕДО ЭЛДЕР ПОЛУЧЕНИЕ АНТИГЕНОВ MYCOBACTERIUM TUBERCULOSIS И ВЫЯВЛЕНИЕ НАИБОЛЕЕ ЗНАЧИМЫХ ИЗ НИХ ДЛЯ ДИАГНОСТИКИ ТУБЕРКУЛЕЗА 03.02.03 – Микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Казань-2013 Работа выполнена на кафедре микробиологии Института фундаментальной медицины и биологии Казанского (Приволжского) федерального университета и в лаборатории молекулярно – биологических исследований Республиканского центра по профилактике...»

«Лысак Людмила Вячеславовна Бактериальные сообщества городских почв Специальность 03.02.03 – микробиология АВТОРЕФЕРАТ на соискание ученой степени доктора биологических наук Москва 2010 Работа выполнена на кафедре биологии почв факультета почвоведения Московского государственного университета имени М.В. Ломоносова Научный консультант : доктор биологических наук, профессор Звягинцев Дмитрий Григорьевич Официальные оппоненты : доктор биологических наук Карпачевский Лев Оскарович...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.