WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

Pages:   || 2 |

«КОМПЛЕКСНАЯ ОЦЕНКА ВЗАИМОДЕЙСТВИЯ E. FAECALIS И BLASTOCYSTIS SPP. В СИСТЕМЕ АССОЦИАТИВНОГО СИМБИОЗА КИШЕЧНИКА ЧЕЛОВЕКА ...»

-- [ Страница 1 ] --

На правах рукописи

Бугеро Нина Владимировна

КОМПЛЕКСНАЯ ОЦЕНКА ВЗАИМОДЕЙСТВИЯ

E. FAECALIS И BLASTOCYSTIS SPP.

В СИСТЕМЕ АССОЦИАТИВНОГО СИМБИОЗА

КИШЕЧНИКА ЧЕЛОВЕКА

03.02.03 – Микробиология

Автореферат диссертации на соискание ученой степени доктора биологических наук

Оренбург – 2013

Работа выполнена на базе центральной научно-исследовательской лаборатории ФГБОУ ВПО «Ульяновский государственный педагогический университет имени И.Н. Ульянова».

Научный консультант:

доктор медицинских наук, Потатуркина-Нестерова профессор Наталия Иосифовна

Официальные оппоненты:

доктор медицинских наук, Карташова профессор Институт клеточного и внутри- Ольга Львовна клеточного Симбиоза УрО РАН доктор медицинских наук, профессор Жестков ГБОУ ВПО «Самарский государственный Александр Викторович медицинский университет» Министерства РФ доктор биологических наук, Карпунина профессор ФГБОУ ВПО «Саратовский гос- Лидия Владимировна ударственный аграрный университет имени Н.И. Вавилова» Министерства сельского хозяйства РФ

Ведущая организация: Федеральное государственное казенное военное образовательное учреждение высшего профессионального образования «Военномедицинская академия имени С.М. Кирова» МО РФ.

Защита состоится «26» сентября 2013 года в часов на заседании диссертационного совета Д.208.066.03 при Оренбургской государственной медицинской академии по адресу: 460000, г. Оренбург, ул. Советская, д.6, тел.: (3532) 77факс: (3532) 77-24-59; e-mail: ogma_ds1@esoo.ru, официальный сайт:

www.orgma.ru, зал заседаний диссертационного совета.

С диссертацией можно ознакомиться в библиотеке ОрГМА.

Автореферат разослан «»_ 2013 г., автореферат и текст объявления размещен на официальном сайте ВАК Министерства образования и науки Российской Федерации.

Ученый секретарь диссертационного совета доктор медицинских наук, профессор Немцева Наталия Вячеславовна

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. Проблема симбиоза - одна из приоритетных в современной биологической науке. Симбиотические ассоциации представляют собой форму сосуществования неродственных организмов и ключевой вопрос механизмы симбиотических взаимоотношений (Проворов Н.А., 2001;

Игнатов В.В., 2005; Бухарин О.В. и др., 2007; Смит С.Э. и др., 2012).

На современном этапе развития науки отмечено изменение парадигмы симбиоза. На смену представлениям о них как о двухкомпонентных системах в результате уточнения наших знаний об этом феномене приходит понимание симбиозов как многокомпонентных систем, включающих хозяина в качестве макропартнера, стабильный доминантный микросимбионт и минорных ассоциированных микросимбионтов с разнонаправленными воздействиями, определяющими формирование, стабильность существования и эффективное функционирование симбиоза в целом (Бухарин О.В., 2010).

Популяции микроорганизмов, вступая в конкурентные или кооперативные взаимоотношения, при заселении различных органов и тканей формируют его специфический микросимбиоценоз). Известно, что к наиболее сложному по составу микробиоценозу по праву относят микрофлору толстого кишечника (Барановский А.Ю., 2006; Несвижский Ю.В., 2009; Бондаренко В.М., 2008).

До настоящего времени дискутируется вопрос о роли отдельных видов условно-патогенных микроорганизмов в формировании нормальной микрофлоры человека, участии их в этиологии и патогенезе ряда заболеваний (Шендеров Б.А., 2005; Лобзин Ю.В., 2009; Guignard S., 2000).

Анализ направленности межмикробных взаимоотношений позволяет правильно оценить происхождение тех или иных аномалий в структуре микросимбионтов, приводящих к изменению их типичных или проявлению их новых биологических свойств (Бухарин О.В., Усвяцов Б.Я., Хуснутдинова Л.М., 2000;

Миллер Г.Г., 2007).

В последние годы в России официально регистрируется более 1,2 миллионов больных различными паразитоценозами, среди которых отмечается рост заболеваемости кишечными протозоозами (Романенко Н.А. и др., 2000; Онищенко Г.Г., 2007; Козлов С.С., Жоголев Д.Т., 2011). В связи с этим, особую актуальность приобретает широко распространенная протозойная инвазия, обусловленная паразитированием в толстом отделе кишечника простейших Blastocystis spp. (Торопова Н.П., 1998; Красноперова Ю.Ю., 2009; Jard B. et al., 1999; Zierdt C.H. et al., 1999).

Возбудитель бластоцистной инвазии является микроорганизмом, к усилению агрессии которого, с одной стороны, могут приводить факторы, снижающие защитные силы макроорганизма, а с другой - микроорганизмы, входящие в состав симбиоценоза.

Установлено, что, находясь в кишечнике, бластоцисты участвуют в формировании микробиоценоза данного биотопа. Нарушая баланс микроорганизмов, эти возбудители способствуют созданию благоприятных условий для развития патологических процессов (Потатуркина-Нестерова Н.И. и др., 2000, 2004; Ильина Н.А., 2005; Красноперова Ю.Ю., 2009). Однако механизмы, обеспечивающие симбиотические связи в формировании протозойно-бактериальных ассоциаций кишечника человека мало изучены.

Поскольку в последние годы повсеместно отмечается тенденция увеличения ассоциированных инфекций, проведение комплексных исследований, направленных на выявление изменений биологических свойств микросимбионтов в протозойно-бактериальных сообществах является весьма актуальным. С этих позиций значительный интерес представляет собой изучение простейших Blastocystis spp.

Известно, что энтерококки являются одним из наиболее распространенных участников развития анаэробно-аэробных микстинфекций, способных эффективно стимулировать рост облигатно-анаэробных патогенов, усиливая их вирулентный потенциал (Бондаренко В.М., 2004; Бондаренко В.М., Суворов А.Н., 2008, Бухарин О.В., Валышев А.В., 2012). Однако открытым остается вопрос о механизмах межмикробных взаимоотношений данных бактерий с простейшими.

Раскрытие механизмов формирования протозойно-бактериальных ассоциаций, определяющих поддержание микросимбиозов организма хозяина в норме и при патологических состояниях, открывает перспективу решения фундаментальной проблемы микробиологии, направленной на выявление причинноследственных связей формирования патогенных вариантов микросимбионтов в ассоциации с бластоцистами.

Цель и задачи исследования.

Цель исследования - комплексная оценка взаимодействия ассоциативных микросимбионтов Enterococcus faecalis и Blastocystis spp. в системе ассоциативного симбиоза кишечника человека.

Для реализации цели работы были поставлены следующие задачи:

Определить частоту встречаемости в кишечнике обследованных простейших Blastocystis spp. в норме и при дисбиозе и изучить их биологические свойства (антилизоцимную, антилактоферриновую и антигистоновую активности).

Выявить генетические маркеры факторов патогенности бластоцист и на основе рестрикционного анализа ДНК определить зависимость между полиморфизмом длин фрагментов нуклеотидных последовательностей и вирулентностью простейших.

Изучить особенности микросимбиоценоза толстого и тонкого отделов кишечника человека при бластоцистной инвазии в зависимости от патогенного потенциала бластоцист.

Определить характер и направленность изменений биологических свойств Е. faecalis в условиях ассоциативного симбиоза с простейшими бластоцистами.

Провести молекулярно-генетический анализ факторов патогенности Е. faecalis в алгоритме ассоциативного взаимодействия с Blastocystis spp. различной вирулентности.

Новизна исследования. Оценка межмикробных взаимоотношений микрофлоры толстого отдела кишечника человека при паразитарной инвазии, вызванной простейшими Blastocystis spp., с позиции ассоциативного симбиоза выявила снижение доминирования основных симбионтов (Bifidobacterium spp., Lactobacillus spp.) на фоне увеличения частоты встречаемости и повышения вирулентности ассоциативной микробиоты (Staphylococcus spp., Enterococcus spp.

и др.) приводящего к нарушению структуры микросимбиоценоза.

Выявлен феномен избыточного роста бактерий в тонкой кишке на фоне инвазии бластоцистами, характеризующийся экспансией роста микробиоты тонкой кишки и транслокацией фекальной флоры из толстого кишечника в тонкий. У лиц, инвазированных бластоцистами, выявлены функциональные расстройства, сопровождающиеся избыточным количеством в кишечнике обследованных муцина, тканевого и сывороточного белков, органических кислот и аммиака, обладающих раздражающим действием и способствующих усилению слизеобразования, бродильных процессов, повышению проницаемости кишечной стенки для плазменных белков. Полученные материалы свидетельствуют о влиянии простейших Blastocystis spp. на структуру микросимбиоценоза, а также на пищеварительные процессы и химические реакции, протекающие в кишечнике.

Обнаружена прямая корреляционная зависимость между персистентной активностью бластоцист, их вирулентностью и глубиной нарушений микробиоценоза кишечника. Эти материалы позволяют использовать важнейшие биологические свойства выживания микроорганизмов для исследования механизмов формирования микросимбиоценозов в биотопе толстого кишечника и являются теоретической предпосылкой для разработки способа скрининговой диагностики кишечного дисбиоза, основанного на определении АЛА, АЛфА и АГА клинических изолятов бластоцист.

Использование молекулярно-генетического метода - рестрикционного анализа ДНК выявило комбинацию рестриктаз Hae III, Pst I и Hind III, позволяющих определить генетические маркеры вирулентности Blastocystis spp. (приоритетная справка на патент РФ № 2012154112 от 17.12.2012 г.) В опытах in vivo установлено, что показатели вирулентности (LD50/lg) штаммов Е. faecalis, выделенных в консорциуме с высоковирулентными бластоцистами были достоверно выше, чем в ассоциациях с умеренно- и слабовирулентными щтаммами простейших.

При экспериментальном сокультивировании с бластоцистами выявлена взаимосвязь антилизоцимной активности и репродуктивной функции E. faecalis, что может прояснить механизм взаимной адаптации микросимбионтов.

В протозойно-бактериальных ассоциациях обнаружен механизм, способствующий активации процессов взаимоадаптации симбионтов. В результате совместной инкубации высоко- и умеренновирулентных бластоцист с гемолитическими формами Е. faecаlis происходило обоюдное усиление биологической активности взаимодействующих микробов, напротив, после сокультивирования негемолитических энтерококков с бластоцистами выявлено статистически достоверное угнетение активности изучаемых ферментов агрессии, как среди бактерий так и среди Blastocystis spp.

На молекулярно генетическом уровне в условиях симбиотического взаимодействия E. fаecalis с Blastocystis spp. in vitro происходило увеличение показателей частоты встречаемости генетических детерминант факторов патогенности энтерококков (gelE и cpd), что позволяет объективно оценить роль простейших в селекции биоваров с различным уровнем вирулентности и реализации патогенного потенциала ассоциативных микросимбионтов.

Практическая ценность работы. Полученные материалы расширяют представления о характере межмикробных взаимодействий, определяющих формирование и поддержание симбиоценоза кишечника человека, в условиях бластоцистной инвазии и дополняют, учение об ассоциативных симбиозах в целом.

Обнаруженные функциональные расстройства пищеварения у пациентов на фоне инвазии простейшими Blastocystis spp. позволяют расширить представления о характере взаимоотношений в системе паразит-хозяин, понять связь микроэкологических нарушений с интенсивностью инвазии, а также наметить пути поддержания гомеостаза биоценоза толстого кишечника.

Результаты исследования динамики экспрессии факторов персистенции и вирулентности представителями микробного биоценоза кишечника человека в системе протозойно-бактериальной ассоциации может способствовать расшифровке механизмов возникновения инфекционных заболеваний.

Выявленная широкая распространенность факторов персистенции у простейших бластоцист может быть использована в качестве маркеров дисбиотического процесса.

Предложенный в работе способ определения Blastocystis spp. c различной степенью вирулентности с использованием РА ДНК простейших позволил разработать специфические маркеры вирулентности на основе фрагментарного анализа ДНК, отличительной особенностью которого является возможность построения молекулярно-генетических карт микроорганизмов, что при высокой степени воспроизводимости может быть использовано для видовой идентификации бластоцист.

Выявленные биологические и экологические особенности бластоцист позволяют рекомендовать внедрение в работу учреждений практического здравоохранения современных методик по обнаружению данных простейших у больных и носителей.

Внедрение в практику. По материалам диссертационной работы изданы монографии «Простейшие Blastocystis hominis и их влияние на макроорганизм».

СПб.: Наука, 2009 (соавт. Потатуркина-Нестерова Н.И., Квасова Н.А., Нестеров А.С., Фалова О.Е.); «Копрологические исследования толстого кишечника на фоне бластоцистной инвазии». М.: ФЛИНТА: Наука, 2012 (с соавт. Потатуркина-Нестерова Н.И., Ильина Н.А.).

Опубликованы практические рекомендации: «Экологическая характеристика микробиоценоза кишечника», Ульяновск, 2004 (соавт. ПотатуркинаНестерова Н.И., Фалова О.Е., Квасова Н.А., Немова И.С., Кулагина Г.М., Богомолова Л.К.); «Особенности микроэкологии кишечника больных псориазом»

Ульяновск, 2004 (соавт. Потатуркина-Нестерова Н.И., Фалова О.Е., Квасова Н.А., Немова И.С., Кулагина Г.М., Нестеров А.С.); «Копрологическая характеристика кишечника при бластоцистной инвазии», Ульяновск, 2012 (соавт. Потатуркина-Нестерова Н.И., Ильина Н.А., Волгина Т.И.); Руководство к лабораторным занятиям по курсу «Биология». 1, 2 часть, СПб, 2007, 2008; Учебнометодическое пособие для студентов «Споровики: биологические свойства, диагностика вызываемых заболеваний», Ульяновск, 2010 (с соавт. ПотатуркинаНестерова Н.И., Немова И.С.); Микробиология: [учеб.-метод. пособие] (с соавт.

Красноперова Ю.Ю., Ильина Н.А., Касаткина Н.М.). М.: ФЛИНТА: Наука, 2011;

Учебное пособие «Клиническая иммунология», Ульяновск, 2011 (соавт. Потатуркина-Нестерова Н.И., Немова И.С., Нестеров А.С., Мясникова А.В., Ильина Н.А., Красноперова Ю.Ю.). Получена приоритетная справка на патент РФ № 2012154112 от 17.12.2012 г. «Способ определения простейших Blastocystis spp. c различной степенью вирулентности».

Материалы работы используются в диагностической работе клинической и бактериологической лабораторий ГУЗ «Городской клинической больницы №1» г. Ульяновска при диагностике и оценке микробиоценоза кишечника, определении чувствительности микробов к антибиотикам, эффективности терапии пищеварительного тракта по выявлению направленности химических процессов в кишечнике при бластоцистной инвазии (Акт о внедрении от 16.03.2013).

Полученные результаты исследования внедрены в учебно-педагогический процесс ФГБОУ ВПО «Ульяновский государственный педагогический университет имени И.Н. Ульянова» (Акт о внедрении от 17.03.2013), ФГБОУ ВПО «Ульяновский государственный университет» (Акт о внедрении от 12.03.2013).

Положения, выносимые на защиту Бластоцистная инвазия вызывает микроэкологические нарушения, характеризующиеся угнетением доминирования основных симбионтов, повышением показателей частоты встречаемости и вирулентности ассоциативной микрофлоры на фоне изменения внутрикишечной среды.

Простейшие Blastocystis spp. в условиях ассоциативного симбиоза способствуют селективному накоплению генетических детерминант патогенности энтерококков, что может рассматриваться в качестве одного из системных факторов регуляции вирулентности и персистенции бактериальных симбионтов, способствующего реализации адаптационного механизма.

Выявленная комбинация рестриктаз Hae III, Pst I и Hind III, позволяющая определить генетические маркеры вирулентности Blastocystis spp. может служить основой для видовой идентификации и построения молекулярногенетических карт изучаемых простейших.

Апробация работы. Основные положения диссертации доложены и обсуждены на Всероссийской научной конференции молодых ученых с международным участием «Актуальные вопросы инфекционной патологии – (СПб., 2006), Международной научной конференции «Научные исследования высшей школы, научная конференция с международным участием (Испания, 2006), Научно-практической конференции «Естествознание и гуманизм. Современный мир, природа и человек» (Томск, 2007), Международной научной конференции «Современные проблемы науки и образования, III научной международной конференции» (М., 2008), Международной научной конференции «Диагностика, терапия, профилактика социально-значимых заболеваний человека»

(Турция, 2010), V Международной научной конференции «Перспективы развития вузовской науки» (Сочи, 2010), VII Международная научно-техническая конференция «Наука, Образование, производство в решении экологических проблем» (Уфа, 2010), I Международной телеконференции «Фундаментальные медико-биологические науки и практическое здравоохранение» (Томск, 2010), III Международной телеконференции «Фундаментальные науки и практика»

(Томск, 2010), Научно-практической конференции с международным участием «Инфекции и паразитарные болезни в практике клинициста. Антибактериальная, антивирусная, антипаразитарная, иммунотерапия и иммунопрофилактика на догоспитальном и госпитальном этапах» (Харьков, 2010), 4-я Международная телеконференция «Issues and Perspectives in Contemporary Science»

(Томск, 2011), VIII Международной научно-технической конференции «Наука, образование, производство в решении экологических проблем (Экология, 2011) (Уфа, 2011), Международной научной конференции «Актуальные вопросы науки и образования» (М., 2012).

Публикации. По материалам диссертации опубликованы 59 работ, из них 17 статей в рецензируемых научных журналах ВАК; изданы 8 практических пособий и 2 монографии.

Объем и структура диссертации. Текст диссертации изложен на страницах компьютерного набора, содержит введение, обзор литературы, описание материалов и методов исследования, 6 глав результатов собственных исследований, заключение, выводы, список литературы, включающий в себя отечественных и 224 иностранных источников. Иллюстрации представлены таблицами и 63 рисунками.

Основные разделы работы выполнены по плану ЦНИЛ ФГБОУ ВПО «Ульяновский государственный педагогический университет имени И.Н. Ульянова» в рамках темы НИР «Роль условно-патогенных микроорганизмов в патологии человека» (№ гос. регистрации 01201055116).

СОДЕРЖАНИЕ РАБОТЫ

В работе использовали штаммы простейших E. faecalis и Blastocystis spp., выделенные из фекалий 896 пациентов с заболеваниями желудочно-кишечного тракта. Группу сравнения составили 150 практически здоровых лиц, репрезентативных по полу и возрасту. Для определения антилизоцимной активности микроорганизмов в качестве тест-штамма использовали суточную агаровую культуру Micrococcus luteus (штамм № 2665, ГИСК им. Л.А. Тарасевича), при изучении антигистоновой активности – тест-культуру Micrococcus luteus (ГИСК № 211001), колициногенной активности музейный штамм E. fаecalis, Е- ГИСК №240789 (плотность 10 ед. по оптическому стандарту мутности ГИСК Л.А. Тарасевича).

Количественную и качественную оценку микроценоза проводили в соответствии с приказом Минздрава России от 09.06.2003 № 231«Об утверждении отраслевого стандарта «Протокол ведения больных. Дисбактериоз кишечника»

(ОСТ 91500.11.0004-2003) на базе клинической и бактериологической лабораторий ГУЗ «Городская клиническая больница № 1» г. Ульяновска в период с 2006 по 2011 г.

Культуры, выросшие на питательных средах, подвергали групповой (анаэробные, не спорообразующие бактерии), родовой (лактобациллы, бифидобактерии, стафилококки) и видовой идентификации (стафилококки, энтерококки, эшерихии). При оценке степени выраженности нарушений состава микрофлоры толстой кишки использовали классификацию И.Б. Куваевой и К.С. Ладодо (1991).

Выделение и идентификацию анаэробных микроорганизмов проводили в соответствии с руководством «Wadsworth-KTL anaerobic bacteriology manual»

(2002). Все выделенные штаммы идентифицированы общепринятыми методами на основании морфологических, тинкториальных, культуральных свойств (Берджи, 1997). Биохимический профиль изучаемых культур микроорганизмов оценивали с помощью коммерческих тест-систем фирмы «Lachema» (Чехия) и «BioMereux» (Франция).

Определение уровня бактериальной обсемененности проводили с использованием методики Ю.М. Фельдман, А.В. Шапиро. (1984). Изучение биологических свойств: сахаролитической, гемолитической активности осуществляли общепринятыми методами (Биргер М.О., 1982), антагонистическую, колициногенную активности – методом отсроченного антагонизма в агаре (Muriana P.A. и Klaenhammer T.R., 1987), липолитическую активность – чашечным методом (Slifkin M., 2000), ДНК-азную активность – методом D.A. Power, P.J. McCuen (1988), лецитоветилазную активность – чашечным методом (Тец В.В., 2003).

Для выделения энтерококков использовали энтерококк агар (НПЦ, г. Оболенск) с последующим накоплением на Columbia agar (Bio-Rad, Франция) с кровью и идентификацией на среде Diskinson Oxoid (Himedia, Индия).

Синдром избыточного бактериального роста (СИБР) в тонкой кишке выявляли путем бактериологического исследования материала, полученного при эндоскопии гастроэнтерологических больных, инвазированных бластоцистами.

Присутствие бактерий в аспирате тонкой кишки в количестве более 10 5 КОЕ у обследованных свидетельствовало о наличии СИБР (Циммерман Я.С., 2005).

Количество бактерий рассчитывали по числу колоний и перевода их в lg колониеобразующих единиц (КОЕ) на 1 мл аспирата.

Изучение антилизоцимной (АЛА), антилактоферриновой (АЛфА), антигистоновой (АГА) активностей у клинических изолятов Enterococcus fаecalis и Blastocystis spp. проводили фотометрическим методом (Бухарин О.В. с соавт., 1999, 2002, 2004) на базе Института клеточного и внутриклеточного симбиоза УрО РАН (г. Оренбург).

Чувствительность исследуемых штаммов микроорганизмов к антимикробным препаратам (эритромицин, ципрофлоксацин, стрептомицин) производили диско-диффузным методом на агаре Мюллера-Хинтона (Испания) (МУ 4.2.1890-04.2004).

Исследование нуклеотидных последовательностей генов, детерминирующих экспрессию факторов патогенности E. faecalis, проводили при помощи ПЦР (МУ 1.3. 2569-09). Бактериальную ДНК выделяли из культур, выросших на питательных средах методом аффинной сорбции. Выделение ДНК энтерококков проводили по методу Boom et al. (1988) с использованием гуанидинтиоцианата (GuSCN). При подборе праймеров и температуры отжига использовали пакет программ в Gene Runner Version 3.05 и Primer Blast (ресурсы GeneBank) (США). Праймеры энтерококков были синтезированы в «ЗАО Симтол»

(Москва) (табл. 1).

Синтез ДНК осуществляли на программируемом амплификаторе «Терцик» (ДНК Технология, г. Москва). Для проведения амплификации была использована коммерческая стандартная лиофилизованная реакционная смесь с оптимизированной для классической схемы ПЦР буферной системой (ООО «ИзоГен», г. Москва), «Набор реагентов для проведения ПЦР-РВ с Taq-ДНКполимеразой и ингибирующими активность фермента антителами» в присутствии красителя SYBR Green I (Компания «Синтол», Москва).

Таблица 1 – Использованные в работе праймеры cpd (бактериCGCGTGAAGAACAAATGGCCGC 3' оциногенность) 5' CCCCGTGCCGGGGTGCCTGGACCTG 3' Изучение паразитоценоза проводили в соответствии с Методическим указанием МУК 4.2.735-99 «Паразитологические методы лабораторной диагностики гельминтозов и протозоозов», утвержденных главным государственным санитарным врачом РФ 25.02.1999. Анализ паразитоценоза кишечника проводили микроскопическими (световая 1040, атомно-силовая микроскопия) и культуральными методами (Clark C.G., Diamond L.S., 2002) с использованием среды Suresh СЕМ (Сахарова Т.В., Гордеева Л.М., Сергиев В.П., 1997).

Вирулентность бластоцист определяли методом полиморфизма длин рестрикционных фрагментов (ПДРФ) ДНК с применением рестрикцирующих эндонуклеаз (рестриктаз): EcoR I, BamH I, Hae III, Hind III, Pst I (производство НПО «СибЭнзим», г. Новосибирск) с использованием способа определения простейших Blastocystis spp. c различной степенью вирулентности (приоритетная справка на патент РФ № 2012154112 от 17.12.2012 г.), а также с помощью биопробы.

Выделение ДНК Blastocystis spp. проводили с использованием фенольнохлороформной методики выделения согласно инструкции по применению комплекта реагентов для выделения ДНК (Приказ Росздравнадзора от 30 июня 2008г. № 5008-Пр/08, регистрационное удостоверение МЗ СР РФ № ФСР 2008/02938) с применением наборов «ВекторДНК-экстракция» (ЗАО «ВекторБест», пос. Кольцево Новосибирской обл.). Для определения длины фрагментов ДНК использовали маркеры молекулярного веса ДНК: М1–маркер молекулярного веса–100–1000 п.н., М2–маркер молекулярного веса–300–10000 п.н. (НПО «СибЭнзим»). Определение длин полученных рестриктов осуществляли с помощью компьютерной программы Gel Pro Analyzer (версия 4.0.00.001). Процент идентичности длин фрагментов рассчитывали для каждой пары микроорганизмов, сравнивая картины рестрикции отдельно по каждой рестриктазе. При сравнении длин рестриктов идентичными считали фрагменты ДНК, длина которых различалась не более чем на 5 %.

Направленность химических процессов в кишечнике определяли по результатам биохимической реакции испражнений (Каторкин Е.Н., 1969). Содержание в фекалиях органических кислот и аммиака проводили по методу Гуаффона, Ру (Кондракова О.А. с соавт., 2005; Goiffon R., 1991), сывороточного и тканевого белков (Дорофейчук В.Г., 1979, в модификации Вишняковой И.Е., 1988) и летучих жирных кислот по методу Лаббе и Ларю (Кондракова О.А. с соавт., 2003). Количественное определение жиров и их фракций осуществляли методом Гольта, Куртье и Фалеса (Михайлова Н.Д., 1962), нуклеопротеидов (тканевый белок) и муцина – пробой Трибуле–Вишнякова (Вотчал Б.Е., 1932; Аминев А.М., 1977).

При определении репродуктивной функции E. faecalis в ходе ассоциативного взаимодействия с Blastocystis spp. анализировали фазы роста, величину и время наступления максимального насыщения среды (Мтах, у. е. и Tmin, ч), высчитывали прирост биомассы за 1–5 ч (Vl–V5, у. е.), удельную скорость роста µ1–µ3, ч-1 и минимальное время удвоения биомассы (tmin, мин). Кроме того, замеряли диаметр колоний (ДК, мм) при высеве взвеси микробов с 20–30 КОЕ на МПА с инкубацией 72 ч при 37 °С (Перт С., 1978).

Статистическую обработку результатов проводили на персональной ЭВМ типа IBM Pentium-IV, графическая обработка материалов выполнена с помощью пакета статистической обработки Statistika 6. Данные по видовому составу и биологическим свойствам микрофлоры кишечника были подвергнуты статистической обработке в компьютерной оболочке Windows с помощью процессора электронных таблиц Microsoft Office Excel 7.0 и программы «Биостат»

(Гланц С., 1999). Были использованы методы параметрической (t-критерий Фишера–Стьюдента) и непараметрической статистики (U-критерий Манна–Уитни). Разница между сравниваемыми величинами считалась достоверной при значении р0,05. Данные двух независимых величин подвергались корреляционному анализу по методу Спирмена (r).

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЯ

Определение частоты встречаемости простейших Blastocystis spp. и изучение их биологических свойств Исследования показали, что в паразитоценозе толстой кишки доминирующее положение по частоте встречаемости занимали простейшие Blastocystis spp. (62,00±5,4%), Lamblia intestinalis (36,72±3,2%) и Entamoeba coli (16,34±1,3%). Из 1380 обследованных у 851 (61,67±7,4%) в фекалиях были обнаружены простейшие Blastocystis spp. В группе сравнения этот показательнее не превышал 5,3±0,2%.

В исследуемом материале были обнаружены две морфологические формы Blastocystis spp.: вакуолярная (71,97±4,3%) и гранулярная (9,98±0,3%), у 19,03±2,8% обследованных встречались обе формы. Бластоцисты амебоидной формы были обнаружены только при культивировании простейших на питательных средах, при длительном хранении культур количество амебоидных форм увеличивалось.

Обнаружено, что инвазированность Blastocystis spp. среди гастроэнтерологических больных была неодинаковой при различных нозологических формах заболеваний. Наибольшее количество простейших обнаружено в фекалиях больных язвенной болезнью – 53,28±6,7% (268 человек). Из них в 30,22±3,8% случаев бластоцисты были выделены у лиц, с ЯБД и в 23,06±2,3% с ЯБЖ.

Для аргументации этиологической значимости бластоцист в развитии патологического процесса определяли их вирулентность in vivo. Проведенные исследования показали, что из 503 клинических изолятов простейших, выделенных у больных только 420 (83,50±5,6%) давали положительную пробу. Уровень LD50 /lg этих штаммов варьировал от 1,2±0,4 до 6,4±0,5. Изоляты бластоцист, выделенные у здоровых лиц в своем большинстве 87,50±6,3% были авирулентны.

Изучение персистирующих свойств бластоцист, направленных на деградацию механизмов резистентности хозяина, выявило широкое распространение факторов персистенции у простейших, частота их встречаемости убывала в ряду АЛфА (84,50±3,7%) АЛА (64,81±5,7%) АГА (48,11 2,3%) (рис. 1).

АЛфА была самым распространенным признаком персистенции у Blastocystis spp. (84,50±3,7%). Выраженность АЛфА Blastocystis spp. составила от до 289 нг/мл Анализ количественных отношений изучаемой характеристики, показал, что почти половина штаммов простейших (42,65±2,3%) обладала средней величиной признака, которые находились в пределах 162–223±30,7 нг/мл.

Высокие (224–289±49,3 нг/мл) и низкие (65–161±22,2 нг/мл) значения регистрировались в одинаковых количествах и составили 26,58±3,7% и 27,76±2,7% исследуемых культур соответственно.

штаммы бластоцист, не обладающие изучаемым признаком штаммы бластоцист, обладающие изучаемым признаком Рис. 1. Частота встречаемости, АЛфА, АЛА и АГА у штаммов бластоцист Проведенные исследования показали, что более 90% штаммов Blastocystis spp., выделенных из фекалий больных ЯБЖ, ЯБД и ХГ обладали АЛфА и характеризовались высокими значениями признака, которые составили в среднем 289 32,2; 263 36,6 и 207 27,3 нг/мл соответственно.

Уровень АЛА у 75,78±5,6% штаммов бластоцист был средним (3– мкг/мл) и низким (до 2 мкг/мл). В 24,23±1,7% случаях АЛА характеризовалась высокими значениями признака (5 мкг/мл и более). У Blastocystis spp., изолированных от больных с ЯБЖ и ЯБД это свойство регистрировалось у 100% и 80% пациентов соответственно. При других заболеваниях ЖКТ АЛ признак выявлялся реже.

Антигистоновая активность была отмечена у 242 (48,11±2,3%) исследуемых изолятов бластоцист. Значения АГА колебались в диапазоне 1,3-12,8 нг/мл, у 85,54±3,9% штаммов простейших определялись низкие (1,3–5,3±0,9) и средние (5,7–9,1 4,3 нг/мл) значения изучаемого признака. Штаммы простейших, выделенные у пациентов с ЯБД в абсолютном большинстве (100%) обладали способностью к инактивации белков-гистонов. При других нозологических формах заболеваний частота встречаемости АГА у Blastocystis spp. была более низкой. Так, например, при ЯБЖ она составила 46,71 4,3%, при ХХ, ЖКБ и ХГ – 38,09 3,7%; 35,48 2,4% и 22,02 2,2% соответственно.

Показана сильная корреляционная зависимость всего комплекса факторов персистенции с вирулентностью Blastocystis spp. Установлено, что персистентная активность простейших была более выражена у высоковирулентных штаммов бластоцист. При усилении вирулентности простейших бластоцист в среднем cо значений lg LD50 с 2,3±1,3 до 5,7±1,1 статистически достоверно увеличивалось количество штаммов, характеризующихся средними и высокими значениями АЛфА, АЛА и АГА.

Так, из 420 изолятов простейших, обладающих АЛфА, 63,76 3,7% характеризовались высоким уровнем изучаемого признака и проявляли максимальные значения вирулентности. Из 65 слабовирулентных штаммов бластоцист АЛфА более чем у половины отсутствовала, а 40,09 2,7% обладали слабо выраженным персистентным свойством. Таким образом, при усилении вирулентности бластоцист увеличивалось количество штаммов простейших, характеризующихся средними и высокими значениями АЛфА. Коэффициенты корреляции (r) составили 0,9 и 0,8 соответственно.

Сравнительный анализ частоты встречаемости и степени выраженности АЛА с показателями вирулентности бластоцист показал аналогичную тенденцию. Доля штаммов, проявляющих максимальную АЛА (более 5 мкг/мл) составила 94,20 6,2% культур, 1/3 бластоцист характеризовались умеренно и слабовирулентными свойствами, которые коррелировали со средними (3– мкг/мл) и низкими (до 2 мкг/мл) значениями АЛА. Коэффициенты корреляции (r) составили 0,7 и 0,9 соответственно.

Изучение зависимости показателей АГА простейших от степени вирулентности бластоцист так же, как и в предыдущих случаях, показал увеличение количества штаммов простейших, характеризующихся средними и высокими значениями АГА. Коэффициенты корреляции (r) составили 0,7 и 0,9 соответственно. Однако установлено, что из 138 высоковирулентных штаммов Blastocystis spp. лишь 1/3 культур характеризовалась высокими значениями АГА, что значительно ниже таковых показателей в группах простейших, обладающих АЛфА и АЛА.

Обобщая полученные экспериментальные данные, следует отметить, что штаммы бластоцист, выделенные из фекалий гастроэнтерологических больных способны к инактивации отдельных факторов естественной противоинфекционной резистентности макроорганизма (АЛА, АЛфА и АГА). Данные признаки могут способствовать колонизации слизистых оболочек кишечника простейшими Blastocystis spp. и служить предпосылкой для понимания некоторых механизмов формирования микросимбиоценоза изучаемого биотопа.

Ассоциативно-симбионтные взаимоотношения кишечного сообщества на фоне бластоцистной инвазии Проведенные исследования ассоциативного симбиоза толстого отдела кишечника у больных с заболеваниями ЖКТ выявили значительные изменения микробиоты обследованных на фоне бластоцистной инвазии (табл. 2).

Отмечалось максимальное снижение количественных показателей бифидобактерий и уменьшение частоты встречаемости других представителей доминантной микрофлоры, таких как кишечная палочка с нормальной ферментативной активностью, лактобациллы и бактероиды (р0,05).

На фоне снижения микробной обсемененности доминантных представителей выявлено значительное повышение частоты встречаемости ассоциативных симбионтов родов: Enterococcus spp., Staphylococcus spp., Clostridium spp., Klebsiella spp., Proteus spp., а также грибов рода Candida.

Исследования также показали, что инвазия простейшими бластоцистами сопровождалась появлением в кишечнике штаммов Escherichia coli, обладающих гемолитической и лактозонегативной активностями.

Изучение ассоциативного симбиоза толстого отдела кишечника при различных нозологических формах гастроэнтерологических заболеваний показало, что наиболее выраженные изменения доминантных симбионтов наблюдались при ЯБЖ и ЯБД. Максимальное снижение количественных показателей при указанных заболеваниях отмечалось в отношении бифидобактерий и лактобацилл (рис. 3).

Таблица 2 – Показатели микросимбиоценоза толстого отдела кишечника обследованных Escherichia coli лак.

Escherichia coli лак.

Escherichia coli гем.

Примечание.* – достоверность различий показателей с группой сравнения (р0,05).

Группа сравнения Рис. 2. Показатели плотности колонизации ассоциативных симбионтов в толстом кишечнике у гастроэнтерологических больных Максимальное изменение количественных показателей ассоциативных симбионтов, таких как Enterococcus spp., Staphylococcus spp., Clostridium spp., Klebsiella spp. и грибов рода Candida spp., также были выявлены у больных ЯБЖ, ЯБД и ХГ (рис. 2).

Установлена корреляционная зависимость показателей микробного сообщества толстого отдела кишечника в зависимости от уровня вирулентности Blastocystis spp.

Выявлено, что при усилении вирулентности простейших происходит снижение показателей обсемененности бактерий рода Bifidobacterium spp. и Lactobacillus spp. со значений lg 9,0±0,4, 8,4±0,3 КОЕ/г до lg 5,8±0,3, 4,7±0, КОЕ/г соответственно (р0,001) ( r=-0,9 и r=-0,8 соответственно), что находит свое подтверждение в исследованиях Ю.Ю. Красноперовой (2009).

Оценка зависимости обсемененности кишечника от степени вирулентности бластоцист показала противоположную направленность для бактерий родов Enterococcus spp., Clostridium spp., Staphylococcus spp. и Candida spp. Результаты количественных изменений для представителей родов Proteus spp. и Klebsiella spp., также носили корреляционных характер, но были менее выраженными (r=0,5 и r=0,7 соответственно).

Изучение зависимости количественных показателей микробных ассоциаций толстой кишки от вирулентности бластоцист выявило положительную корреляционную связь между степенью дисбиотических изменений кишечника гастроэнтерологических больных и вирулентностью Blastocystis spp. Корреляционный анализ показал, что по мере усиления вирулентности простейших возрастало количество пациентов с дисбактериозом III и VI степени тяжести. Коэффициенты корреляции (r) составили 0,8 и 0,8 соответственно. Дисбактериоз кишечника I и II степени тяжести наблюдался у инвазированных слабовирулентными и умеренновирулентными штаммами бластоцист (r=0,7, р0,05; r=0,9, p0,01).

Исследователями (Бондаренко В.М., 1999, 2000; Воробьев А.А., Лыкова Е.А., 1999) установлено, что многие бактерии, такие как клебсиеллы, стафилококки, клостридии, обладая факторами персистенции, определяют тяжесть и течение дисбиотических нарушений кишечника. В связи с этим огромный интерес вызывает исследование комплекса персистентных признаков бластоцист, выделенных у гастроэнтерологических больных, имеющих дисбиотические нарушения микрофлоры кишечника и влияние этих свойств на состояние кишечной флоры.

I II III IV

Рис. 3. Связь выраженности персистентных признаков бластоцист со степенью дисбиоза кишечника (штаммы простейших с высоким уровнем выраженности признака) По оси абсцисс – степень дисбиоза кишечника Установлено, что при III и особенно IV степени дисбиоза распространенность штаммов бластоцист с высоким уровнем признаков значительно возрастала: с 97,7% до 100% для штаммов с АЛА, с 89,8% до 96,4% для бластоцист с АЛфА и с 32,1% до 41,5%, обладающих АГА (рис. 3). В то время как штаммы бластоцист, выделенные у лиц с дисбиотическими нарушениями кишечника I и II степени тяжести характеризовались низким и средним уровнем персистентных свойств.

Характер состояния толстого отдела кишечника лиц инвазированных Blastocystis spp. было бы не полным без оценки направленности химических процессов в толстой кишке. Согласно современным представлениям, патологический процесс в кишечнике отрицательно влияет на течение физиологических процессов, сопровождающихся нарушением обычного химизма, которое не может оставаться безразличным для организма.

В связи с этим далее проводили оценку функционального состояния кишечника при бластоцистной инвазии в ходе химического анализа фекалий. Количественное содержание муцина в испражнениях составило 3,1±0,2 у.е. (в контроле 1,2±0,4 у.е.; р0,05), что свидетельствует о значительном раздражении толстой кишки при инвазии простейшими Blastocystis spp.

Уровень сывороточного белка в фекалиях больных определялся как 3,4±0,3 у.е. (в группе сравнения 1,36±0,5 у.е.; р0,05) и сопровождался сдвигом кислотно-щелочного равновесия в кислую сторону до 6,2±0,1 у.е. (в группе сравнения 7,2±0,2 у.е.; р0,05). Также наблюдалось повышенное содержание органических кислот, показатели которого составили 19,60±0,1 у.е. (в группе сравнения 14,60±0,2 у.е.; р0,05). Наличие в испражнениях лиц, инвазированных бластоцистами муцина и растворимых белков, дает основание считать, что эти патогены способствуют раздражению слизистой оболочки кишечника и могут служить причиной воспалительных реакций в организме.

Результаты исследования показали достоверно высокое количественное содержание аммиака у лиц с бластоцистной инвазией (р0,05) средняя величина которого составила 4,9±0,2 у.е., что является достоверным признаком выраженности процессов гниения в нем (Михайлова В.М., 1962).

Таким образом, проведенные впервые копрологические исследования позволили обнаружить деструктивные процессы в кишечнике лиц, инвазированных бластоцистами, проявляющиеся усилением слизеобразования, увеличением бродильных процессов, повышенной проницаемостью кишечной стенки для плазменных белков. Все это позволяет расширить представления о сущности патогенеза бластоцистоза, понять связь микроэкологических нарушений с интенсивностью инвазии, а также наметить пути комплексной коррекции развившихся нарушений.

Полученные результаты изучения ассоциативно-симбионтных взаимоотношений кишечного сообщества на фоне бластоцистной инвазии позволяют оценить роль простейших в формировании симбиоценоза кишечника человека, приводящие к значительному повышению частоты встречаемости и плотности колонизации условно-патогенных микроорганизмов. Однако было бы неправильно думать об однонаправленном действии бластоцист в нарушении работы кишечника. Кроме Blastocystis spp. в формировании патологического процесса могут участвовать и другие микроорганизмы, повышение вирулентности которых усиливают тяжесть течения патологических состояний микробиоценоза и пищеварительной системы целом. Это позволяет предположить, что при реализации своего патогенного потенциала бластоцисты могут быть кофактором развития патологического процесса.

Оценка направленности изменений биологических свойств участников протозойно-бактериального симбиоценоза Известно, что энтерококки являются одним из наиболее распространенных участников развития анаэробно-аэробных микстинфекций. Являясь факультативными аэробами, энтерококки способны эффективно стимулировать рост облигатно-анаэробных патогенов, усиливая их вирулентный потенциал (Бондаренко В.М., 2004; Бондаренко В.М., Суворов А.Н., 2008). В связи с этим значительный интерес представляет изучение направленности изменений биологических свойств энтерококков в симбиозе с простейшими бластоцистами.

Показано, что в составе микроценоза кишечника были выделены два вида энтерококков E. faecium (у 61,30 3,2% обследованных) и E.faecalis (у 32,93 1,7% пациентов). Поскольку наибольшие показатели частоты встречаемости были выявлены у представителей вида E. faecalis, все дальнейшие исследования были направлены на изучение биологических свойств данного симбионта.

Изучение частоты встречаемости Е. faecalis у больных позволило выявить существенные различия (рис. 4).

Рис. 4. Частота выделения Е.faecalis у обследованных (%) Обсемененность энтерококками была значительно выше у больных с бластоцистозом (7,6 0,2 lg KOE/мл) по сравнению с пациентами без бластоцистной инвазии (4,7 0,4 lg KOE/мл). В контрольной группе плотность колонизации энтерококками не превышала 2,5 0,3 lg KOE/мл (р0,05).

Изучение вирулентности изолятов Е. faecalis показало, что только 76,44±3,6% из них давали положительную пробу, показатель LD50/lg этих штаммов варьировал от 3,6±0,1 до 5,7±0,6. Наибольшее количество изолятов (48,95±2,3%) обладало умеренно выраженной степенью вирулентностью.

У клинических изолятов Е. faecalis выявлено широкое распространение факторов персистенции (АЛА, АЛфА и АГА). В ходе сравнительного анализа персистентных признаков энтерококков был обнаружен разнонаправленный характер их проявления (рис. 5). Наиболее выраженной оказалось АЛфА. Она обнаружена у 96,66±7,3% штаммов.

Рис. 5. Частота встречаемости АЛА, АЛфА и АГА штаммов Е. faecаlis, выделенных у лиц инвазированных бластоцистами Оценена информативность свойств персистенции энтерококков с определенными значениями признаков. Уровень АЛА энтерококков в среднем составил 2,4±0,02 мкг/мл. На долю штаммов с высокими значениями признака (2,7±0,05 мкг/мл) приходилось 26,38±2,3% изолятов, со средними и низкими значениями (2,1±0,02 и 1,7±0,03мкг/мл) 34,72±1,7% и 38,90±1,3% штаммов соответственно.

Сравнительный анализ уровней АЛфА показал, что более 50% энтерококков проявляли высокий уровень персистентного свойства (94–121±0,03 нг/мл).

При изучении степени выраженности АГА энтерококков большая часть штаммов имела средние и низкие значения, их величина составила 3,4±0, мкг/мл (36,36±2,9%) и 2,3±0,05 мкг/мл – (47,28±2,1%) соответственно. У здоровых людей превалировали штаммы с набором слабовыраженных признаков персистенции.

Далее были изучены биологические свойства и изменение патогенного потенциала клинических изолятов энтерококков при ассоциативном симбиотическом взаимодействии с Blastocystis spp. in vivo и при их сокультивировании in vitro.

На первом этапе исследования проанализировано изменение персистентных свойств (АЛА, АЛфА и АГА) E. faecalis, при сокультивировании с бластоцистами,.

Показано. что при соинкубировании с Blastocystis spp. антилизоцимная активность Е. faecalis составила в среднем 3,2±0,02 мкг/мл (р0,01) (до сокультивирования 2,2±0,02 мкг/мл). В 72,22±6,3% (52 штамма) наблюдалось повышение свойства в среднем в 2,8 раза, снижение способности в 1,8 раза к инактивации лизоцима проявилось у 20 культур (27,78±1,7%) энтерококков от исходного уровня (р0,05).

Анализ динамики изменения АЛА энтерококков в ходе сокультивирования с простейшими показал, что в первые 30 мин уровень персистентного свойства штаммов бактерий вырос с 2,4±0,02 до 2,6±0,03 мкг/мл. На 6-е сутки эксперимента показатель АЛА Е.faecalis достиг максимума и составил 3,5±0, мкг/мл. В последующие сроки АЛ признак бактерий достоверно не изменялся.

В контрольных образцах в течение всего эксперимента АЛА находилась в пределах 2,1±0,02–2,4±0,02 мкг/мл (р0,05).

Изучение изменения уровней АЛфА энтерококков в ходе экспериментального сокультивирования с бластоцистами показал, что у 80,46±4,3% штаммов показатели АЛфА увеличивались, а 19,54±1,9% не изменяли активность.

Уменьшение показателей АЛфА не наблюдалось ни в одном случае. При сокультивировании энтерококков с бластоцистами в течение первых 6 суток эксперимента не было выявлено заметного увеличения изучаемого свойства у бактерий (рис. 6). Следует предположить, что данная тенденция объяснялась адаптацией популяции энтерококков к цитопатогенному действию штаммов бластоцист, устойчивых к АЛф признаку.

Однако начиная с 7-х суток, и в течение последующих 6 дней соинкубирования у энтерококков в 2 раза увеличились показатели АЛфА со значений 65±0,02 до 126±0,03 нг/мл.

Антигистоновая активность Е.faecalis в ходе экспериментального сокультивирования с бластоцистами повышалась до 4,3±0,05 мкг/мл (до сокультивирования показатель был равен 3,2±0,02 мкг/мл; р0,05).

Рис. 6. Динамика изменения АЛфА Е.faecalis после сокультивирования с бластоцистами Проведенный сравнительный анализ изменения персистентных свойств простейших Blastocystis spp. при сокультивировании c бактериями Е. faecalis показал, что в отсутствие энтерококков выраженность АЛА бластоцист составляла 2,1±0, мкг/мл, а при сокультивировании с бактериями Е. faecаlis выросла почти в 2 раза и составила 4,8±0,08 мкг/мл (р0,05).

Изучение динамики изменения АЛА бластоцист после сокультивирования с энтерококками показало два значительных подъема показателей АЛА, регистрируемых на 3–6 сутки и на 16–20-е сутки эксперимента. АЛА выросла с 2,5±0,03 мкг/мл до 3,3±0,05 мкг/мл в первый подъем и с 3,9±0,03 мкг/мл до 4,8±0,01 мкг/мл во второй подъем соответственно.

Выявлено значительное влияние штаммов Е.faecаlis на антилактоферриновую активность бластоцист при их совместном культивировании. Уровень АЛф признака простейших составил 118 нг/мл до начала эксперимента и нг/мл – в присутствии Е. faecаlis (р0,01). В контроле АЛфА бластоцист не превышала 74 нг/мл (р0,01).

Установлено также угнетающее действие Е. faecаlis на персистентные свойства бластоцист. Так, в отсутствие энтерококков уровень АГА бластоцист составлял 6,5 мкг/мл, а при их совместном культивировании она снижалась до 2,7±0,04 мкг/мл (р0,01). Естественно предположить, что при взаимодействии типа эукариот-прокариот бактерии, скорее всего, эволюционно приспособились к бактерицидному действию гистонов, проявляя антигистоноваую активность и понижая значения этого признака у простейших бластоцист.

Далее было проведено изучение патогенного потенциала изолятов E. faecalis как механизма адаптации к ассоциативному симбиотическому взаимодействию с простейшими Blastocystis spp. in vivo и при их сокультивировании in vitro.

Показатели вирулентности штаммов E. faecalis, изолированных из ассоциативных симбиозов с высоковирулентными бластоцистами были самыми высокими LD50/lg 6,4±0,3 – 7,2±0,5. Для энтерококков, выделенных из консорциума с умеренновирулентыми и слабовирулентными Blastocystis spp., LD50/lg составила 4,6±0,5 – 6,3±0,3 и 1,3±0,2 – 3,4±0,2 соответственно (в контроле 1,1±0,2 –1,3±0, LD50/lg).

Изучение репродуктивной функции энтерококков в зависимости от их антилизоцимной активности выявило наличие взаимосвязи между экспрессией признака и фазностью популяционного роста бактерий в присутствии бластоцист.

Е. faecаlis с высоким уровнем АЛА (5 мкг/мл) развивались значительно медленнее, чем штаммы с низкой АЛА (2 мкг/мл), что проявлялось уменьшением прироста биомассы бактерий, особенно на начальных этапах культивирования (р0,05). Максимальное насыщение среды у штаммов Е. faecalis с высокой АЛА было равно 73,59±0,02 мин, в то время как у культур Е. faecаlis с низкой АЛА оно составило 15,48±0,01 мин соответственно (р0,01).

Для решения вопроса о хронологической сопряженности между динамикой антилизоцимного секрета и репродуктивной функцией у всех тестируемых культур Е.faecаlis при сокультивировании in vitro была прослежена почасовая экспрессия признака (рис. 7, 8).

Анализ результатов свидетельствует о том, что у культур Е. faecаlis с высокими значениями АЛА при совместном культивировании с бластоцистами наблюдалось постепенное нарастание персистентного признака, характеризующееся двумя подъемами. Первое нарастание АЛА происходило в первые 6 ч культивирования (фаза физиологического адаптирования). Затем был зафиксирован второй подъем уровня АЛА активности штаммов бактерий (6–10 ч) – логарифмическая фаза. К 10–24 ч отмечено некоторое уменьшение признака (стационарная фаза).

Рис. 7. Сравнение экспрессии АЛА и кинетики роста штаммов Е. faecalis в динамике с высокой АЛА Рис. 8. Сравнение экспрессии АЛА и кинетики роста штаммов Е. faecalis в динамике с низкой АЛА Установлено, что при росте на МПА у штаммов с низкой АЛА средний диаметр колоний был на 22% больше (7,4 против 5,8 мм) по сравнению с таковыми, обладающими высокой АЛА.

Экспериментально установленная зависимость между экспрессией персистентного признака и фазностью популяционного роста бактерий в присутствии бластоцист может объяснить механизм взаимоадаптации микроорганизмов в протозойно-бактериальных ассоциациях кишечника человека, направленной на создание условий для совместного длительного существования в макроорганизме.

Следующим этапом исследования явилось изучение биологических свойств: сахаролитической, гемолитической, колициногенной активности и антибиотикорезистентности у бактерий Е. faecalis и гемолитической, ДНК-азной, лецитоветилазной и липолитической активности простейших Blastocystis spp.

до и после совместного культивирования.

Проведенный сравнительный анализ контакта гемолитических форм E.

fаecalis с высоко- и умеренновирулентными бластоцистами показал статистически достоверное усиление биологической активности взаимодействующих микросимбионтов, а именно гемолитической, колициногенной активностей и антибиотикорезистентности со стороны бактерий, также гемолитической, ДНКазной, лецитоветилазной, липолитической активностей со стороны простейших.

Оценка изменения биологических свойств негемолитических форм E.fаecalis, а также высоко- и умеренновирулентных бластоцист продемонстрировала усилении гемолитической активности и антибиотикорезистентности на фоне снижения уровня колициногенной и сахаролитической активностей энтерококков, а также снижение всех изучаемых видов активностей простейших.

Проведенные исследования демонстрируют нестабильность ассоциативных микросимбиоценозов, участниками которых являются гемолитические и негемолитические формы энтерококков, а также высоко- и умеренновирулентные простейшие бластоцисты и позволяют предположить механизм, способствующий активации процессов взаимоадаптации симбионтов в протозойнобактериальных ассоциациях кишечника.

При взаимодействии гемолитических форм энтерококков с бластоцистами, проявляющих слабовирулентные свойства не было выявлено статистически достоверных различий в изменении активности изучаемых ферментов со стороны бактерий.

Взаимодействие негемолитических форм Е. faecаlis и бластоцист со слабовирулентными свойствами характеризовалось индифферентностью в отношении всех изучаемых видов активностей, что позволяет рассматривать сообщества данных видов ассоциантов как наиболее стабильные.

Выявление генетических маркеров вирулентности бластоцист Молекулярно-генетичекие методы в микробиологии применяются сравнительно недавно, однако в настоящее время они занимают ведущие позиции при индикации и идентификации бактерий и вирусов (Албертс Б., 1994; Овчинников Ю.А., 2006; Roberts R.J., 2005).

Для уточнения результатов определения вирулентности бластоцист, полученных биологическим методом в работе предложен способ выявления генетических маркеров вирулентности изучаемых микроорганизмов методом рестрикционного анализа (РА) основанного на изучении полиморфизма длин фрагментов рестрикции (ПДФР) ДНК простейших Blastocystis spp. с использованием рестриктаз: EcoR I, BamH I, Hae III, Hind III, Pst I.

Результаты анализа продукта длиной 10 000 пар нуклеотидов, полученного при выделении ДНК простейших показал, что применение рестриктазы Hae III позволяет дифференцировать авирулентные штаммы бластоцист на основе наличия фрагментов размером 850 п.н. и вирулентные на основе отсутствия или наличия фрагментов ДНК размером от 550 до 10 000 п.н. (рис. 9).

Рис. 9. Электрофореграмма рестрикционных фрагментов ДНК штаммов бластоцист с использованием рестриктазы Hae III.

Штаммы бластоцист: 1,2 – авирулентные, 3,4 – слабовирулентные, 5,6 – умеренновирулентные, 7,8 – высоковирулентные.

М1 – маркер молекулярного веса 100 – 1000 п.н., М2 –маркер молекулярного веса 300 – 10 000 п.н.

Рис. 10. Электрофореграмма рестрикционных фрагментов ДНК штаммов бластоцист с использованием рестриказы Hind III.

Штаммы бластоцист: 1,2 – авирулентные, 3,4 – слабовирулентные, 5,6 – умеренновирулентные, 7,8 – высоковирулентные.

М1 – маркер молекулярного веса 100 – 1000 п.н., М2 –маркер молекулярного веса 300 – 10 000 п.н.

8 В эксперименте с применением рестриктазы Hind III, было произведено типирование бластоцист со слабовыраженной вирулентностью на основе фрагментов ДНК, размером 700 п.н., а также высоковирулентных штаммов бластоцист на основе наличия фрагментов ДНК, размеров 380 и 600 п.н. (рис. 10).

Рис. 11. Электрофореграмма рестрикционных фрагментов ДНК штаммов бластоцист с использвоанием рестриказы Pst I.

Штаммы бластоцист: 1,2 – авирулентные, 3,4 – слабовирулентные, 5,6 – умеренновирулентные, 7,8 – высоковирулентные.

М2–маркер молекулярного веса 300 – 10 000 п.н.

Использование рестриктаз BamH I, EcoR I не позволило типировать бластоцисты с различной вирулентностью. При помощи рестриктазы Pst I произведено типирование бластоцист с умеренно выраженной вирулентностью на основе наличия фрагментов ДНК размером около 900 п.н. (рис. 11).

В таблице 3 представлены результаты определения величины фрагментов ДНК бластоцист с различной степенью вирулентности, полученные методом рестрикционного анализа ДНК простейших с использованием рестрицирующих эндонуклеаз (рестриктаз).

Таблица 3 – Величина фрагментов ДНК бластоцист с различным уровнем Штаммы бластоцист Таблица 4 – Частота встречаемости бластоцист с различным уровнем вирулентности, выявленной биопробой и РА ДНК (%) Группы штаммов Примечание.* – достоверность различия результатов, полученных биологическим методом и РА ДНК (р0,05) Установлено, что использование РА ДНК Blastocystis spp. выявило вирулентность у 90,85±7,3% штаммов простейших, выделенных у обследованных, в то время как биопробой только у 83,50±5,6% (табл. 4).

Анализируя показатели частоты встречаемости бластоцист с различной степенью вирулентности, выявленные биологическим методом и методом ПДФР, показало значительное увеличение количества высоковирулентных штаммов простейших при использовании молекулярно-генетического метода исследования (табл. 5).

Таблица 5 – Результаты определения частоты встречаемости штаммов бластоцист с различной степенью вирулентности Таким образом, полученные результаты показывают, что предложенная комбинация эндонуклеаз рестрикции (Hae III, Pst I и Hind III) для определения вирулентности Blastocystis spp. может служить достоверным и универсальным способом идентификации простейших в зависимости от степени выраженности вирулентных свойств.

Предложенный в работе способ определения бластоцист c различной степенью вирулентности с использованием РА ДНК простейших позволил разработать специфические маркеры вирулентности на основе фрагментарного анализа ДНК, отличительной особенностью которого является возможность построения молекулярно-генетических карт микроорганизмов, что при высокой степени воспроизводимости может быть использован для видовой идентификации бластоцист.

Патогенность является полидетерминантным признаком, поэтому у энтерококков, выделенных у пациентов с заболеваниями ЖКТ, производили выявление следующих генетических детерминант: gelE (желатиназа) и cpd (бактериоцитогенность).

Для проведения ПЦР был произведен подбор праймеров с целью выявления генов патогенности энтерококков, а также оптимизация условий и режима проведения ПЦР в режиме «реального времени», позволяющих одновременно совмещать амплификацию и детекцию.

Таблица 6 – Частота встречаемости фрагментов гена gelE и cpd у культур E. fаecalis в общей биомассе до и после сокультивирования деленные в аскультивирование социации с лентными рулентными лентными E. fаecalis (n=67), выде- сокультивирования ленные в виде после 3-х суток монокультур сокультивирования Примечание.* – показатель достоверности различия между уровнем частоты встречаемости фрагмента гена gelE и cpd у культур E. fаecalis в общей биомассе до и после их сокультивирования с Blastocystis spp. (р0,05).

С целью изучения механизмов формирования протозойно-бактериальных ассоциаций, а также взаимоадаптаций микроорганизмов-ассоциантов в кишечном биотопе и оценки значения ассоциативной микрофлоры у обследованных изучали взаимное влияние микросимбионтов на их патогенный потенциал.

Выявление генетических детерминант патогенности E. fаecalis проводили до и после их сокультивирования с Blastocystis spp. Для проведения данной серии эксперимента были отобраны штаммы E. faecalis (n=132), выделенные у обследуемых с заболеваниями ЖКТ, в ассоциативном симбиозе которого участвовали бластоцисты с различной степенью вирулентности (табл.6). Кроме того, были изучены штаммы энтерококков, выделенные из ассоциаций, где простейшие отсутствовали (n=67).

Из 132 тестируемых штамма E. fаecalis с праймерами к гену gelE, до сокультивирования с бластоцистами, положительный сигнал был получен только с 27 культурами (20,45±2,4%), в то время как после соинкубирования он составил 65,15±3,6% (86 культур).

Распространенность нуклеотидной последовательности gelE гена как правило возрастала после сокультивирования бактерий с бластоцистами. Наибольшая частота встречаемости фрагментов гена, контролирующего синтез желатиназы E. faecalis была отмечена после 3 сут соинкубирования с простейшими.

Молекулярно-генетический анализ выявил заметный рост числа положительных реакций среди штаммов энтерококков соответствующими системами праймеров, специфичными к gelE гену в зависимости от вирулентности Blastocystis spp. Частота встречаемости искомых фрагментов гена, контролирующих синтез желатиназы, возрастала с 5,56±0,6% при соикубировании со слабовирулентными бластоцистами до 25,92±2,1% с высокой степенью патогенности.

Установлена корреляционная зависимость между частотой обнаружения изучаемых ампликонов и вирулентностью ассоциантов Blastocystis spp. (r=0,72). По нашему мнению, это может свидетельствовать о мобилизации защитных механизмов, проявляющихся в увеличении числа особей, содержащих в своем генотипе фрагменты изучаемого гена gelE и его фенотипической экспрессии.

С целью подтверждения полученных результатов мы также изучили распространенность нуклеотидных последовательностей cpd гена. Исследования показали, что частота встречаемости гена cpd у штаммов E. faecalis, выделенных из ассоциации с бластоцистами, составила 61,36±4,7% (81 культура), изолированных без простейших – 31,34±3,2% – 21 штамм.

Обращает на себя внимание достоверно увеличение количества бактериальных клеток с наличием искомого гена также как и в предыдущем случае после 3 сут сокультивирования с бластоцистами по сравнению с данными, полученными до сокультивирования. При инкубации из общего числа бактерий со слабовирулентными простейшими частота встречаемости гена cpd была выявлена у 3,7±0,5% штаммов, в то время как с высоковирулентыми возросла до 20,98±2,5%. Отмечена зависимость роста числа положительных сигналов с праймерами, специфичными к cpd гену от вирулентности бластоцист (r=0,87), как до сокультивирования, так и после (р0,05).

В группе энтероккоков, выделенных из симбиотических сообществ, не содержащих бластоцисты, частота встречаемости генетических детерминант gelE и cpd после совместного культивирования с бластоцистами достоверно не изменялась (р0,05).

Таким образом, показано, что в результате взаимной адаптации E. fаecalis и Blastocystis spp. с различной степенью вирулентности происходило увеличение численности бактерий, в генотипе которых локализованы gelE и cpd гены, что может служить объяснением механизмов формирования протозойнобактериальных ассоциаций кишечника человека и взаимоадаптацией симбионтов к изменяющимся условиям среды.

В заключение можно выделить три основных момента.

Бластоцистная инвазия сопровождается изменением микросимбиоценоза кишечника на фоне повышения вирулентности простейших, проявляющихся увеличением показателей частоты встречаемости и микробной обсемененности ассоциативной микрофлоры на фоне снижения доминирования основных симбионтов.

Простейшие Blastocystis spp. способствуют изменению вирулентности, персистирующей и репродуктивной активности E. faecalis в условиях совместного культивирования in vitro, что может рассматривать их как один из системных факторов влияющих на формирование микросимбиоценоза и выживание микросимбионтов в ассоциативном симбиозе кишечника человека.

Рестрикционный анализ ДНК Blastocystis spp. позволил выявить комбинацию рестриктаз для определения генетических маркеров вирулентности бластоцист посредством, которого можно проводить видовую идентификацию простейших и построение молекулярно-генетических карт изучаемых паразитов.

ВЫВОДЫ

1. У обследованных лиц выявлена высокая частота встречаемости простейших Blastocystis spp. (62,00±5,4%). Установлено, что 83,50±5,6% клинических изолятов простейших обладают вирулентностью (1,2±0,4 – 6,4±0,5 LD50/lg) и высокой персистирующей активностью (антилизоцимная, антилактоферриновая, антигистоновая), между которыми выявлена корреляционная зависимость. Ведущим персистентным признаком является антилактоферриновая активность, которая регистрируется с частотой 84,50±3,7%.

2. Бластоцистная инвазия сопровождалась угнетением доминантного компонента ассоциативного симбиоза толстого кишечника (Lactobacillus spp., Bifidobacterium spp.) на фоне повышения частоты встречаемости и плотности колонизации ассоциативных симбионтов, таких как Staphylococcus spp., Streptococcus spp., грибов рода Candida spp. Максимальное увеличение показателей частоты встречаемости в кишечном биотопе (82,70 4,2%) и колонизационной активности (7,6±0,2 l g КО Е/ м л ) отмечалось у ассоцианта Е. faecalis.

У 81,30% обследованных выявлен феномен избыточного роста бактерий в тонкой кишке, проявляющийся увеличением значения общего микробного числа в среднем до 6,2 lg КОЕ/мл, что в 2,5 раза превышало значения в группе сравнения. Этот показатель характеризовался экспансией роста микробиоты тонкой кишки и транслокацией фекальной флоры из толстого отдела кишечника.

Установлено, что нарушение стабильности ассоциативного симбиоза при бластоцистной инвазии коррелировало с вирулентностью Blastocystis spp. и степенью выраженности дисбиоза кишечника. При усилении вирулентности бластоцист выявлено заметное снижение плотности колонизации Bifidobacterium spp. и Lactobacillus spp. (r=-0,9 и r=-0,8 соответственно) и увеличение показателей обсемененности ассоциантов Enterococcus spp., Clostridium spp., Staphylococcus spp. и грибов рода Candida (r=0,7; 0,9; 0,8 и 0,8 соответственно).

Выявлено изменение вирулентности, персистирующей и репродуктивной активности E. faecalis в условиях симбиоценоза с простейшими Blastocystis spp. in vitro. Показатель вирулентности штаммов энтерококков, выделенных из ассоциативных микросимбиоценозов с высоковирулентными бластоцистами в 1,3 и 2,5 раза был выше, чем с умеренно- и слабовирулентными простейшими соответственно. При сокультивировании энтерококков с бластоцистами происходило увеличение уровней АЛА, АЛфА и АГА изолятов в среднем в 2,8; 2,6 и 1,8 раза соответственно. У E. faecalis в присутствии Blastocystis spp. установлено наличие взаимосвязи между экспрессией АЛА и фазностью популяционного роста.

В результате совместного культивирования высоко- и умеренновирулентных бластоцист с гемолитическими формами Е. faecаlis обнаружено статистически достоверное усиление активности взаимодействующих микробов (сахаролитической, гемолитической, колициногенной активностей и антибиотикорезистентности) со стороны бактерий при одновременном усилении гемолитической, ДНК-азной, лецитоветилазной, липолитической активностей со стороны простейших. Напротив, при сокультивировании негемолитических энтерококков выявлено статистически достоверное угнетение активности изучаемых ферментов как среди бактерий, так и у Blastocystis spp., что свидетельствуют об активных процессах взаимоадаптации и селекции биоваров с различным уровнем вирулентности.

7. На основании анализа полиморфизма длин фрагментов рестрикции (ПДФР) ПЦР-продукта, полученного при выделении ДНК Blastocystis spp. выявлена комбинация рестриктаз Hae III, Pst I и Hind III позволяющая определить генетические маркеры вирулентности простейших, посредством которой можно проводить видовую идентификацию бластоцист и построение молекулярно-генетических карт изучаемых паразитов.

8. Показано, что простейшие Blastocystis spp. вызывали увеличение показателей частоты встречаемости нуклеотидных последовательностей генов gelE и cpd энтерококков после их совместного культивирования, что является свидетельством влияния на способность реализации патогенного потенциала ассоциативных симбионтов. В группе энтерококков, выделенных из микробных ассоциаций, в которых отсутствовали бластоцисты, частота встречаемости генетических детерминант достоверно не изменялась, что служит одним из факторов объяснения активизации механизмов группового отбора.

СПИСОК РАБОТ, ОПУБЛИКОВАНЫХ ПО ТЕМЕ ДИССЕРТАЦИИ:

1. Простейшие Blastocystis hominis и их влияние на макроорганизм (монография). / Под ред. Н.И. Потатуркиной-Нестеровой. // Наука. СПб., 2009. 148 с.

ISBN 978-5-02-025421-3.

2. Копрологические исследования толстого кишечника на фоне бластоцистной инвазии (монография) / Бугеро Н.В., Потатуркина-Нестерова Н.И., Ильина Н.А.

// М.: ФЛИНТА, Наука, 2012. 108 с. ISBN 978-5-02-037864- Статьи, опубликованные в журналах, рекомендованных ВАК 3. Влияние микробиоценоза кишечника на формирования и тяжесть течения экспериментальной язвы желудка, ассоциированной бластоцистозом / Красноперова Ю.Ю., Потатуркина-Нестерова Н.И., Бугеро Н.В., Зубкова Е.А. // Вестник Саратовского государственного аграрного университета им. Н.И. Вавилова.

2005. № 1. С. 17–19.

4. Факторы персистенции простейших Blastosystis hominis / Бугеро Н.В // Известия самарского научного центра РАН. 2004. № 3. С. 43–48.

5. Антиинтерфероновая активность простейших Blastocystis hominis / Квасова Н.А., Бугеро Н.В., Потатуркина-Нестерова Н.И., Красноперова Ю.Ю. // Вестник Саратовского государственного аграрного университета им. Н.И. Вавилова.

2005. № 2. С. 7–9.

6. Паразитофауна кишечника гастроэнтерологических больных / Квасова Н.А., Бугеро Н.В. // Вестник Саратовского государственного аграрного университета им. Н.И. Вавилова. 2005. № 1. С. 11–13.

7. Биологические свойства простейших Blastocystis hominis, выделенных у жителей топодемов г. Санкт-Петербурга с различной экологией / Бугеро Н.В. // Вестник Оренбургского государственного университета. 2010. № 2. С. 119–123.

8. Антилактоферриновая активность простейших Blastocystis hominis, выделенных у гастроэнтерологических больных, проживающих в северо-западном регионе России / Бугеро Н.В., Потатуркина-Нестерова Н.И. // Журнал Проблемы региональной экологии. 2010. № 5. С. 112–117.

9. Микроэкология кишечника жителей г. Санкт-Петербурга при бластоцистной инвазии / Бугеро Н.В., Потатуркина-Нестерова Н.И., Немова И.С. // Проблемы региональной экологии. 2010. № 1. С. 240–245.

10. Факторы персистенции простейших фекальной флоры при дисбиозе кишечника / Бугеро Н.В., Немова И.С., Потатуркина-Нестерова Н.И. // Вестник Новых медицинских технологий. 2011. № 3. С. 28–31.

11. Изменение факторов персистенции энтерококков при сокультивировании с простейшими Blastocystis hominis / Бугеро Н.В. // Вестник Новых медицинских технологий. 2012. № 2. С. 65–69.

12. Направленность химических процессов испражнений при бластоцистной инвазии жителей г. Санкт-Петербурга / Бугеро Н.В. // Экология урбанизированных территорий. 2012. № 1. С. 21–24.

13. Некоторые биологические свойства энтерококков и Blastocystis hominis в алгоритме ассоциативного симбиотического взаимодействия до и после сокультивирования / Бугеро Н.В., Потатуркина-Нестерова Н.И. // Фундаментальные исследования. 2012. № 9 (1).С. 13–16.

14. Обоснование взаимосвязи антилизоцимной активности и репродуктивной функции энтерококков при сокультивировании с простейшими Blastocystis hominis / Бугеро Н.В. // Современные проблемы науки и образования. 2012. № (Электронный журнал).

15. Генетические детерминанты патогенности микросимбионта E.faecalis, в ассоциации с простейшими B. hominis in vitro / Бугеро Н.В. // Вестник Новых медицинских технологий. 2012. № 4. С. 186–188.

16. Степень выраженности патогенных свойств E.faecalis, полученных в ходе совместного культивирования с простейшими Blastocystis spp. in vivo / Бугеро Н.В., Потатуркина-Нестерова Н.И. // Современные проблемы науки и образования. 2012. № 6 (Электронный журнал) 17. Результаты определения вирулентности Вlastocystis spp. методом рестрикционного анализа бактериальной ДНК простейших / Бугеро Н.В., ПотатуркинаНестерова Н.И. // Фундаментальные исследования. 2012. № 11(5). С. 1059–1062.

18. Изменение биологических свойств энтерококков в условиях межмикробного взаимодействия с простейшими бластоцистами / Бугеро Н.В., ПотатуркинаНестерова Н.И. // Современные проблемы науки и образования. 2013. № 1.

(Электронный журнал).

19. Молекулярно-генетический анализ взаимодействий E. faecalis в ассоциации с Blastocystis spp. in vitro / Бугеро Н.В. // Фундаментальные исследования. 2013.

№ (1). С. 32–36.

20. Реализация потенциала патогенности простейших Blastocystis hominis в условиях пониженной резистентности макроорганизма / ПотатуркинаНестерова Н.И., Фалова О.Е., Красноперова Ю.Ю., Кудрова В.М., Бугеро Н.В. с соавт. // Материалы региональной научно-практич. конференции молодых ученных «Актуальные проблемы современного здравоохранения и экологии». Ульяновск, 2003. С.64–65.

21. Бластоцистная инвазия у гастроэнтерологических больных / ПотатуркинаНестерова Н.И., Квасова Н.А., Бугеро Н.В. и соавт. // Медлайн-экспресс.

Москва, 2003. № 12. С. 3–5.

22. Роль бластоцист в изменении микробиоценоза кишечника / ПотатуркинаНестерова Н.И., Бугеро Н.В., Фалова О.Е., Квасова Н.А., Исаева И.Н. // Материалы II Международной научно-практической конференции. «Медицинская экология». Пенза, 2003. С. 81–84.

23. Экологическое ранжирование эндофлоры кишечника населения Ульяновской области / Потатуркина-Нестерова Н.И., Бугеро Н.В., Фалова О.Е., Квасова Н.А. с соавт. // Успехи современного естествознания. М., 2004. № 3. С. 28–29.

24. Влияние микробиоценоза кишечника на формирование и тяжесть течения экспериментальной язвы желудка ассоциированной с бластоцистозом / Красноперова Ю.Ю., Квасова Н.А., Бугеро Н.В., Кудрова Н.В. // Сборник статей НИИ Кардиологии ТНЦ СО РАМН «Науки о человеке». Томск, 2004. С. 147–148.

25. Некоторые показатели клеточного иммунитета при экпериментальной язве желудка на фоне инвазии простейших Blastocystis hominis / Красноперова Ю.Ю., Квасова Н.А., Бугеро Н.В. с соавт. // Материалы XI межрегиональной научно-практической конференции молодых ученых и соискателей «Актуальные вопросы диагностики, лечения и реабилитации больных». Пенза, 2004. С.

112–113.

26. Распространенность простейших Blastocystis hominis у гастроэнтерологических больных / Потатуркина-Нестерова Н.И., Красноперова Ю.Ю., Фалова О.Е., Бугеро Н.В. с соавт. // Материалы выездного пленума НОГР «Новые горизонты гастроэнтерологии». Новосибирск, 2004. С. 318–319.

27. Способ получения чистой культуры Blastocystis hominis на питательной среде / Потатуркина-Нестерова Н.И., Бугеро Н.В., Квасова Н.А., Фалова О.Е. с соавт. // Приоритетная справка на патент РФ. 2004. № 2003135444.

28. Активность нейтрофильных гранулоцитов при экспериментальной язве желудка на фоне Blastocystis hominis / Красноперова Ю.Ю, ПотатуркинаНестерова Н.И., Квасова Н.А., Евдокимова В.М., Бугеро Н.В., Фалова О.Е. с соавт. // Материалы выездного пленума НОГР «Новые горизонты гастроэнтерологии». Новосибирск, 2004. С. 63–64.

29. Изучение энтеротоксигенной активности бластоцист / ПотатуркинаНестерова Н.И., Бугеро Н.В., Красноперова Ю.Ю., Квасова Н.А., Фалова О.Е., Нестеров А.С. // Материалы выездного пленума НОГР «Новые горизонты гастроэнтерологии». Новосибирск, 2004. С. 148–149.

30. Некоторые показатели микробиоценоза кишечника при бластоцистозной инвазии / Красноперова Ю.Ю., Потатуркина-Нестерова Н.И., Квасова Н.А., Фалова О.Е., Бугеро Н.В., Немова И.С. // Материалы выездного пленума НОГР «Новые горизонты гастроэнтерологии». Новосибирск, 2004. С. 142–143.

31. Патогенные свойства штаммов Blastocystis hominis / Красноперова Ю.Ю., Потатуркина-Нестерова Н.И., Бугеро Н.В., Квасова Н.А., Фалова О.Е., Немова И.С., Бурганова Р.Ф. // Материалы выездного пленума НОГР «Новые горизонты гастроэнтерологии». Новосибирск, 2004. С. 303–304.

32. Влияние микробиоценоза кишечника на особенности формирования и тяжесть течения экспериментальной язвы, отягощенной бластоцистозом / Красноперова Ю.Ю., Немова И.С., Потатуркина-Нестерова Н.И., Бугеро Н.В., Нестеров А.С. с соавт. // Современные наукоемкие технологии. Москва. 2004. № 5. С.

62.

33. Бластоцистная инвазия у лиц с заболеваниями пищеварительной системы / Бугеро Н.В., Потатуркина-Нестерова Н.И. // Материалы международной конференции 125-летию К.И. Скрябина и 60-летию основания Лаборатории гельминтологии АН СССР – Института паразитологии РАН «Основные достижения и перспективы развития паразитологии. 2004. С. 239–241.

34. Биологическое значение антиинтерфероновой активности простейших Blastocystis hominis / Бугеро Н.В., Квасова Н.А., Красноперова Ю.Ю. // Материалы конгресса молодых ученых и специалистов НИИ кардиологии ТНЦ СО РАМН Совет молодых ученных «Науки о человека». Томск. 2004, С.134-135.

35. Чувствительность к антибиотикам как показатель вирулентности штаммов Blastocystis hominis / Фалова О.Е., Бугеро Н.В. // Материалы конгресса молодых ученых и специалистов НИИ кардиологии ТНЦ СО РАМН Совет молодых ученых «Науки о человеке». Томск, 2004. С. 164–165.

36. Формирование язвы желудка на фоне инвазии простейших Blastocystis hominis / Красноперова Ю.Ю., Потатуркина-Нестерова Н.И., Бугеро Н.В., Квасова Н.А., Немова И.С. // Материалы международной конференции 125-летию К.И. Скрябина и 60-летию основания Лаборатории гельминтологии АН СССР – Института паразитологии РАН «Основные достижения и перспективы развития паразитологии. Москва. 2004. С. 146–148.

37. Значение антиинтерфероновой активности Blastocystis hominis в формировании особого паразитоценоза кишечника человека / Бугеро Н.В., Квасова Н.А.

// Материалы ХI межрегиональной научно-практической конференции молодых ученных и соискателей «Актуальные вопросы диагностики, лечения и реабилитации больных». Пенза, 2004. С. 23–26.

38. The diagnostic value of disclocing, Blastocystis at colitis hatients / Krasnoperova Y.Y., Potaturkina-Nesterova N.I., Bugero N.V., Nesterov A.S. // Falk Symposium № 147. «Соlitis:Diagnosis and Therapeutic Strategies» Birmenghem UK. May 6–7.

2005. P. 56.

39. Бактериально-грибковые ассоциации кожи в условиях воздействия дестабилизирующих факторов / Немова И.С., Потатуркина-Нестерова Н.И., Бугеро Н.В., Овсяник М.С. // Журнал естествознание и гуманизм. Сборник научных работ «Современный мир, природа и человек». Томск. 2007. С. 111.

40. Экологическое ранжирование эндофлоры кишечника населения г. СанктПетербурга / Бугеро Н.В. // Успехи современного естествознания. М., 2008. № 5.

С. 54–55.



Pages:   || 2 |
 


Похожие работы:

«Никитина Оксана Викторовна ВНЕКЛЕТОЧНЫЕ ОКСИДОРЕДУКТАЗЫ ЛИГНИНОЛИТИЧЕСКОГО КОМПЛЕКСА БАЗИДИАЛЬНОГО ГРИБА TRAMETES PUBESCENS (SCHUMACH.) PILT Специальность 03.00.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва-2006 Работа выполнена в лаборатории химической энзимологии Института биохимии им. А.Н. Баха РАН Научный руководитель кандидат биологических наук, С. В. Шлеев Официальные оппоненты : доктор биологических наук,...»

«Козлов Константин Сергеевич ВЛИЯНИЕ ЗАГРЯЗНЕНИЯ ПОЧВЫ НЕФТЕПРОДУКТАМИ НА ДОЖДЕВЫХ ЧЕРВЕЙ 03.00.16 - Экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2003 Работа выполнена на кафедре радиотехнологий и экологического мониторинга Томского государственного университета систем управления и радиоэлектроники Научный руководитель : доктор биологических наук, профессор Карташев Александр Георгиевич Официальные оппоненты : доктор...»

«Панарина Вероника Игоревна ЭНДО- И ЭКЗОГЕННЫЕ ФАКТОРЫ РЕГУЛЯЦИИ ПЛОДО- И СЕМЯОБРАЗОВАНИЯ У СОВРЕМЕННЫХ СОРТОВ ГОРОХА 03.01.05 – физиология и биохимия растений АВТОРЕФЕРАТ диссертации на соискание учной степени кандидата сельскохозяйственных наук Орл – 2011 Работа выполнена в Федеральном государственном образовательном учреждении высшего профессионального образования Орловский государственный аграрный Университет доктор сельскохозяйственных наук Научный руководитель : Амелин...»

«Паршина Евгения Константиновна ДЕСТРУКЦИЯ РАСТИТЕЛЬНОГО ВЕЩЕСТВА В БОЛОТНЫХ ЭКОСИСТЕМАХ ТАЕЖНОЙ И ЛЕСОТУНДРОВОЙ ЗОН ЗАПАДНОЙ СИБИРИ 03.00.05 – ботаника 03.00.27 – почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск 2009 Работа выполнена в лаборатории биогеоценологии Института почвоведения и агрохимии СО РАН Научный руководитель : кандидат биологических наук Миронычева-Токарева Нина Петровна Официальные оппоненты : доктор...»

«Данченко Александр Владимирович СИСТЕМАТИКА И ФИЛОГЕНИЯ ГОЛУБЯНОК РОДА AGRODIAETUS (LEPIDOPTERA, LYCAENIDAE) РОССИИ И СОПРЕДЕЛЬНЫХ СТРАН 03.02.05 – энтомология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук научный руководитель доктор биологических наук Владимир Александрович Лухтанов Санкт-Петербург   Работа выполнена на Кафедре энтомологии Санкт-Петербургского государственного университета....»

«Аникеенок Марина Олеговна ИНДУКЦИЯ ATM/ATR СИГНАЛЬНОГО КАСКАДА В ОТВЕТ НА ДНК – ПОВРЕЖДАЮЩЕЕ ДЕЙСТВИЕ HELICOBACTER PYLORI 03.00.07 - Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Казань – 2009 Работа выполнена на кафедре микробиологии биолого-почвенного факультета Казанского государственного университета им. В.И.УльяноваЛенина. Научный руководитель : доктор биологических наук, профессор Ильинская Ольга Николаевна Официальные...»

«Махонина Галина Ивановна НАЧАЛЬНЫЕ ПРОЦЕССЫ ПОЧВООБРАЗОВАНИЯ В ТЕХНОГЕННЫХ ЭКОСИСТЕМАХ УРАЛА Специальность 03.00.27. – почвоведение Автореферат диссертации на соискание ученой степени доктора биологических наук Томск-2004 -3 Работа выполнена в Уральском государственном университете им. А.М. Горького Официальные оппоненты : доктор биологических наук Арчегова И.Б. доктор биологических наук, профессор Капелькина Л.П. доктор биологических наук, профессор Дергачева М.И. Ведущая...»

«БАИШЕВА ЭЛЬВИРА ЗАКИРЬЯНОВНА ЭКОЛОГО-ФИТОЦЕНОТИЧЕСКАЯ СТРУКТУРА БРИОКОМПОНЕНТА ЛЕСНОЙ РАСТИТЕЛЬНОСТИ РЕСПУБЛИКИ БАШКОРТОСТАН Специальность 03.02.01 – ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук УФА – 2010 Работа выполнена в Лаборатории геоботаники и охраны растительности Учреждения РАН Института биологии Уфимского научного центра РАН Научный консультант Миркин Борис Михайлович доктор биологических наук, профессор Официальные...»

«НЕЧАЕВА ОЛЬГА ВИКТОРОВНА ХАРАКТЕРИСТИКА БИОЛОГИЧЕСКОГО ДЕЙСТВИЯ ПОЛИМЕРНЫХ И ГЕТЕРОЦИКЛИЧЕСКИХ СОЕДИНЕНИЙ, УГЛЕРОДНЫХ НАНОТРУБОК НА МИКРООРГАНИЗМЫ И РАЗРАБОТКА ТЕХНОЛОГИИ СОЗДАНИЯ НА ИХ ОСНОВЕ ИННОВАЦИОННЫХ ПРЕПАРАТОВ 03.02.03 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Саратов 2013 2 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Саратовский...»

«Веженкова Ирина Владимировна ВЫЖИВАНИЕ И ГИБЕЛЬ КАРДИОМИОЦИТОВ ПРИ ГЕНЕТИЧЕСКИ ОБУСЛОВЛЕННОЙ МИОДИСТРОФИИ МЫШЕЙ MDX 03.00.25 – гистология, цитология, клеточная биология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург 2008 Работа выполнена в Институте цитологии РАН Научный руководитель : доктор биологических наук, профессор Михайлов Вячеслав Михайлович Институт цитологии РАН Официальные оппоненты : доктор биологических наук,...»

«ЕНУЩЕНКО Илья Валерьевич Триба Овсовых злаков (Poaceae: Aveneae) в Байкальской Сибири 03.02.01 – Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2010 Работа выполнена на кафедре ботаники и генетики в ГОУ ВПО Иркутский государственный университет Научный руководитель : кандидат биологических наук, доцент Чепинога Виктор Владимирович Официальные оппоненты : доктор биологическах наук, профессор Олонова Марина Владимировна...»

«ЯРОСЛАВЦЕВА Ольга Николаевна ИММУННАЯ И ДЕТОКСИЦИРУЮЩАЯ СИСТЕМЫ НАСЕКОМЫХ ПРИ РАЗВИТИИ РАЗЛИЧНЫХ ТИПОВ МИКОЗОВ 03.02.05 – энтомология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Новосибирск – 2012 Работа выполнена в лаборатории патологии насекомых Института систематики и экологии животных СО РАН Научный руководитель : доктор биологических наук, профессор Глупов Виктор Вячеславович (Институт систематики и экологии Животных СО РАН, г....»

«Цыренов Баир Солбонович Сезонные изменения физико-химических условий и активности микробного сообщества в содовом озере Белое (Западное Забайкалье) 03.00.16 - экология 03.00.07 - микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ 2010 Работа выполнена в Институте общей и экспериментальной биологии СО РАН Научный руководитель : кандидат биологических наук Абидуева Елена Юрьевна Научный консультант : кандидат биологических...»

«МАЛИНИН МИХАИЛ ЛЕОНИДОВИЧ ВЗАИМОСВЯЗЬ МЕТАБОЛИЧЕСКИХ ПРОЦЕССОВ И УСТОЙЧИВОСТИ К БАКТЕРИАЛЬНЫМ ИНФЕКЦИЯМ У ЖИВОТНЫХ НА ФОНЕ ДЕЙСТВИЯ ВОЗБУДИТЕЛЕЙ, ИХ АНТИГЕНОВ И ПРЕПАРАТОВ НА ОСНОВЕ НАНОЧАСТИЦ 03.02.03 – микробиология 03.01.06 – биотехнология (в том числе бионанотехнологии) АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Саратов 2013 2 Работа выполнена в Государственном научном учреждении Саратовский научноисследовательский ветеринарный институт...»

«Минич Александр Сергеевич ЭКОЛОГИЧЕСКИЕ И МОРФОФИЗИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ПРОДУКТИВНОСТИ РАСТЕНИЙ ПОД ФЛУОРЕСЦЕНТНЫМИ ПЛЕНКАМИ Специальность 03.02.08 – Экология (биологические наук и) Автореферат диссертации на соискание ученой степени доктора биологических наук Томск – 2011 2 Работа выполнена на кафедрах ботаники и органической химии биологохимического факультета ФГБОУ ВПО Томский государственный педагогический университет Научный консультант : доктор биологических наук,...»

«ИЛЬИЧЕВА Екатерина Юрьевна МЕХАНИЗМЫ ВЛИЯНИЯ ИОНОВ СЕРЕБРА НА МЕТАБОЛИЗМ МЕДИ МЛЕКОПИТАЮЩИХ 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург, 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Научно-исследовательский институт экспериментальной медицины СевероЗападного отделения Российской академии медицинских наук Научный руководитель : Доктор биологических наук, профессор Цымбаленко...»

«Демин Илья Николаевич Участие 12-ацил-липидной десатуразы в формировании устойчивости растений картофеля к гипотермии 03.01.05 – физиология и биохимия растений АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2010 Работа выполнена в лаборатории зимостойкости Учреждения Российской академии наук Института физиологии растений им. К.А. Тимирязева РАН НАУЧНЫЙ РУКОВОДИТЕЛЬ: доктор биологических наук, профессор Трунова Тамара Ильинична...»

«Ялышева Елена Николаевна Видовой состав и распределение основных групп зообентоса (Oligohaeta, Hirudinea, Molluska, Chironomidae) в озерах Тувы 03.00.08 – Зоология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск 2008 Работа выполнена на кафедре общей биологии и экологии Томского государственного педагогического университета Научный руководитель : доктор биологических наук Долгин Владимир Николаевич Официальные оппоненты : доктор...»

«БОЧКОВ Андрей Владимирович АКАРИФОРМНЫЕ КЛЕЩИ, ПОСТОЯННО ПАРАЗИТИРУЮЩИЕ НА МЛЕКОПИТАЮЩИХ: ФИЛОГЕНИЯ, СИСТЕМАТИКА И ПАРАЗИТО-ХОЗЯИННЫЕ СВЯЗИ 03.02.11 – паразитология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург – 2011 2 Работа выполнена в Учреждении Российской академии наук Зоологический институт РАН Научный консультант доктор биологических наук Миронов Сергей Валентинович Официальные оппоненты : доктор биологических наук,...»

«Синицына Марина Вячеславовна ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ФЛОРЫ МАЛЫХ ИСКУССТВЕННЫХ ВОДОЕМОВ САРАТОВСКОЙ ОБЛАСТИ 03.02.01 – ботаника 03.02.08 – экология (биология) Автореферат диссертации на соискание ученой степени кандидата биологических наук Саратов – 2013 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Саратовский государственный университет им. Н.Г. Чернышевского на кафедре ботаники и экологии...»














 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.