WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Анучин Алексей Максимович

РОЛЬ ГИСТОНОПОДОБНОГО БЕЛКА HLP В ПРОЦЕССЕ

ОБРАЗОВАНИЯ И РЕАКТИВАЦИИ ПОКОЯЩИХСЯ ФОРМ

MYCOBACTERIUM SMEGMATIS.

Специальность 03.01.04 – «биохимия»

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

МОСКВА 2010

Работа выполнена в лаборатории биохимии стрессов микроорганизмов Учреждения Российской академии наук Института биохимии им. А. Н. Баха РАН доктор биологических наук,

Научный руководитель:

профессор А. С. Капрельянц доктор биологических наук,

Официальные оппоненты:

профессор Л. И. Воробьева кандидат биологических наук А. С. Воронина Учреждение российской

Ведущая организация:

академии наук Институт биохимии и физиологии микроорганизмов РАН им. Г. К. Скрябина

Защита состоится «2» декабря 2010 г. в «14» часов на заседании диссертационного совета (Д 002.247.01) при Учреждении Российской академии наук Институте биохимии им.

А. Н. Баха РАН по адресу: 119071, Москва, Ленинский проспект, д. 33, строение 2.

С диссертацией можно ознакомиться в Библиотеке биологической литературы РАН по адресу: 119071, Москва, Ленинский проспект, д. 33. стр.1.

Автореферат разослан _ 2010 г.

Ученый секретарь диссертационного совета, кандидат биологических наук А. Ф. Орловский

Общая характеристика работы

Актуальность темы. Микобактерии являются значимой группой микроорганизмов, поскольку включают таких возбудителей инфекционных заболеваний как туберкулез и лепра. По данным ВОЗ, каждый третий человек является носителем латентного туберкулеза, который может переходить в активное состояние, вызывая инфекцию. При этом механизмы возникновения таких латентных форм и пути их реактивации остаются неизвестными. И хотя вовлеченность специализированных покоящихся клеток микобактерий в явление латентного туберкулеза интенсивно обсуждается на протяжении многих лет, вопрос существования таких клеток in vivo остается открытым.





Изучение покоящихся форм микобактерий имеет длительную историю. Согласно работам Хоменко [Khomenko, 1984], имеется большая вероятность того, что в тканях и органах инфицированных животных находятся покоящиеся морфологически дифференцированные формы Mycobacterium tuberculosis. Однако, ни в одной из экспериментальных моделей in vitro, существующих на сегодняшний день, не было продемонстрировано образование подобных форм. Это свидетельствует о, возможно, неглубоком уровне покоя, развиваемого в данных моделях, поэтому они вряд ли могут служить адекватным отражением процессов происходящих in vivo в тканях инфицированных людей. Поэтому экспериментальное доказательство возможности образования морфологически дифференцированных покоящихся форм микобактерий in vitro являлось бы существенным вкладом в решение обсуждаемой проблемы.

При изучении существующих на настоящее время моделей покоя был накоплен большой материал, свидетельствующий о том, что образование покоящихся форм микобактерий, - сложный процесс, включающий множество «игроков», таких, как «гены покоя», соответствующие белки, регуляторные факторы, ферменты, структурные элементы клетки и. т. д. Поскольку, очевидно, переход в покоящееся состояние сопровождается глобальной перестройкой клеточного метаболизма, можно ожидать участие в этом процессе глобальных регуляторов. Одним из таких регуляторов является семейство ДНКсвязывающих белков (гистоноподобные белки), вызывающих изменение архитектуры нуклеоида и регулирующие активность тех или иных оперонов. У микобактерий таким гистоноподобным белком является Hlp. Ряд авторов предполагает, что гистоноподобный белок Hlp принимает участие в стрессовом ответе микобактерий [Shires, 2001]. Имеются также данные о том, что при переходе M. smegmatis в покоящееся (нерепликативное) состояние в микроаэрофильных условиях (модель Wayne) происходит пятикратное увеличение концентрации Hlp в клетках [Lee, 1998]. Однако, очень странным оказался факт, что инактивация гена hlp не приводила к каким-либо изменениям в образовании нерепликативных форм, которые фенотипически не отличались от покоящихся форм дикого типа. Этот факт оставляет открытым вопрос о значимости гистоноподобных белков в образовании покоящихся форм и требует дальнейшего изучения.

На основании изложенных данных были сформулированы следующие цели и задачи.

дифференцированных форм микобактерий in vitro, и изучить роль гистоноподобного белка Hlp в процессе образования и реактивации полученных покоящихся форм M. smegmatis.

Задачи исследования:

-скрининг условий культивирования M. smegmatis, при которых происходит образование морфологически дифференцированных покоящихся форм.

-сравнительное изучение мутантных клеток M. smegmatis с инактивированным геном hlp с клетками дикого типа при переходе в покоящееся состояние и образованных в результате такого перехода покоящихся форм.

-получение рекомбинантного белка Hlp и изучение особенностей его взаимодействия с ДНК.

-изучение продукта немевалонатного пути синтеза изопреноидов (МЭЦ), как возможного регулятора связывания Hlp и ДНК.





Научная новизна работы. В настоящей работе впервые обнаружено образование морфологически дифференцированных форм микобактерий in vitro на примере M. smegmatis при культивировании температура). Такие формы обладали повышенной устойчивостью к действию стрессовых факторов (антибиотики, нагревание, коротковолновое излучение), а также были способны сохранять жизнеспособность в течение длительного времени (более 5 месяцев), что позволяет отнести их к покоящимся формам. Глубокие морфологические изменения клеточной стенки и реорганизация цитоплазмы, позволяют отнести полученные формы к цистоподобным клеткам, характерных для других неспорообразующих бактерий.

Впервые было обнаружено, что гистонопобный белок Hlp определяет обратимость перехода клеток M. smegmatis из некультивируемого состояния в активное состояние, что проявляется в неспособности штамма с инактивированным геном hlp к реактивации в присутствии белка Rpf (resuscitation promoting factor). Однако Hlp не влияет на инициацию перехода клеток в покоящееся состояние.

В ходе настоящей работы впервые была показана значимость гистоноподобного белка Hlp для обеспечения устойчивости полученных покоящихся форм M. smegmatis.

Гистоноподобный белок Hlp участвует в компактизации нуклеоида в процессе перехода M.

smegmatis в покоящееся состояние. По-видимому, повышенная устойчивость покоящихся форм обусловлена такой компактизацией нуклеоида. Одним из регуляторов связывания гистоноподобного белка Hlp с ДНК возможно является МЭЦ, который препятствует такому связыванию in vitro.

Практическая значимость работы. В настоящей работе нам впервые удалось продемонстрировать возможность образования морфологически дифференцированных форм микобактерий in vitro. Полученная модель составляет хороший инструмент для изучения механизмов образования покоящихся форм микобактерий, оценки роли генов вовлеченных в процесс перехода микобактерий в латентное состояние. С другой стороны, полученные покоящиеся клетки микобактерий могут быть использованы в качестве тест-системы для анализа эффективности потенциальных лекарственных агентов против латентных форм микобактериозов, таких как туберкулез и лепра.

Полученные данные о роли гистоноподобного белка Hlp в процессе образования и реактивации покоящихся форм микобактерий позволяют рассматривать этот белок в качестве потенциальной мишени для лекарственных агентов.

Апробация работы. Основные результаты работы были представлены на следующих научных конференциях: 4 съезд Российского общества биохимиков и молекулярных биологов, Новосибирск, 2008; ICOMID, Пермь, 2009; 4 международная конференция молодых ученых «От молекулы до биосферы», Харьков, 2009.

Публикации. По материалам диссертационной работы опубликовано 7 печатных работ, в том числе 4 статьи в журналах, входящих в Перечень ведущих рецензируемых журналов и изданий ВАК, и 3 тезиса в материалах конференций.

Структура диссертации. Диссертационная работа состоит из введения, обзора литературы, описания материалов и методов исследования, результатов и их обсуждения, списка цитируемой литературы. Работа изложена на страницах машинописного текста, Список сокращений.

МКР – метод конечных разведений МЭЦ -2-С-метил-D-эритритол-2,4-циклопирофосфат НК – «некультивируемые» формы Hlp – histon-like protein MPN – most probable number ROI – reactive oxygen intermediates Rpf – resuscitation promoting factor

СОДЕРЖАНИЕ РАБОТЫ

В обзоре литературы рассматриваются покоящиеся формы бактерий, их физиологические биохимические и структурные характеристики. Особое внимание уделено покоящимся формам микобактерий, подробно рассмотрены существующие модели покоя микобактерий.

Анализируются имеющиеся в литературе данные о структуре и функциях гистоноподобных белков бактерий.

Материалы и методы исследования Штаммы и условия культивирования Таблица 1. Штаммы Mycobacterium smegmatis, использованные в исследовании.

Wt-pMind Штамм MC2 155 (Wt) трансформированный плазмидой Получен в ходе Hlp-0 Штамм Hlp-0 с инактивированным геном hlp путем Lee et al, Hlp-0- Штамм Hlp-0 с плазмидой pAGR, несущей мутантный ген Получен в ходе Hlp-0-pMind- Штамм Hlp-0 с плазмидой, несущей ген hlp Получен в ходе hlp M. smegmatis штамм mc2155 стандартно поддерживали на чашках Петри с твердой агаризованной средой (1.5% агара) NB (Nutrient Broth, HiMedia Laboratories, India). Клетки выращивали в среде NB или стандартной среде Sauton. Трансформированные штаммы (WtpMind, Wt-pAGH, Wt-pAGR, Hlp-0-pMind, Hlp-0-pAGH, Hlp-0-pAGR, Hlp-0-pAGRmut, Hlp-0pMind-hlp), а также штамм Hlp-0 поддерживали на среде NB с 10 мкг мл-1 канамицина.

Таблица 2. Плазмиды, использованные для трансформации.

pAGRmut Плазмида pAGR, несущая мутантный Mukamolova et al, Клонирование и получение рекомбинантных штаммов.

Клонирование проводили с использованием штамма E. coli TG1. Амплификацию гена hlp 5’GTGGATCCTGGAAATCAGTGGTCACAG3’, подчеркнуты). Продукт ПЦР первоначально клонировали в вектор pGEM-T (Promega), затем подвергали расщеплению по сайтам BamHI и PstI, после чего лигировали в вектор pMind, предварительно обработанный теми же рестриктазами. Правильность клонированных нуклеотидных последовательностей подтверждали секвенированием. Трункированный ген rpf (белок RpfSm) был амплифицирован PCR из pET-19b-Rpf с использованием праймеров

GCGAAATTAATACGACTCACTAT и CGACGGATCCTCACTCGGTGGCGTCACGT (сайт

рестрикции BamH1 подчеркнут). Очищенный ПЦР продукт был обработан рестриктазами XbaI и BamH1, лигирован в pET19b вектор и трансформирован в E. coli DH5. Ампицилинустойчивые колонии были проанализированы методом ПЦР на наличие вставки трункированного гена. Конструкция, содержащая трункированный ген rpf (RpfSm), была секвенирована и трансформирована в E. coli HSM174 (DE3).

Получение покоящихся форм Mycobacterium smegmatis Рекомбинантные штаммы M. smegmatis выращивали в условиях, вызывающих образование покоящегося состояния у штамма дикого типа, а именно: культивирование в модифицированной среде Hartman’s-de Bont, лимитированной по K+, при 37C и постоянном перемешивании, в течение 120 часов [Shleeva., 2004].

модифицированной среде SR-1, лимитированной по азоту при 30C и постоянном перемешивании [Anuchin, 2009].

Выделение и очистка рекомбинантных белков Rpf и Hlp Трункированную форму белка, вызывающего оживление (resuscitation-promoting factor) Rpf M. luteus, называемый RpfSm, использовали для оживления покоящихся форм M. smegmatis.

Белки RpfSm и Hlp были выделены из 350 мл культуры продуцента. Индукцию синтеза продукта осуществляли 1 мM IPTG, при комнатной температуре. Клетки собирали центрифугированием и замораживали в Tris-HCl буфере (ВВ). После разрушения клеток ультразвуком, остатки разрушенных клеток удаляли центрифугированием. Супернатант помещали на Ni-sepharose колонку (V = 2 мл) («Sigma», Germany), уравновешенную BB. Для элюции и рефолдинга белков использовалась Biological LP system («Biorad»).

Мягкое выделение ДНК.

Выделение ДНК осуществляли согласно протоколу Genomic DNA Purification Kit, “Fermentas”. Спектр поглощения полученного образца измеряли на спектрофотометре SpecОживление НК клеток Mycobacterium smegmatis.

Оживление некультивируемых клеток, полученных в модифицированной среде SR-1, осуществляли с использованием метода MКР согласно [Downing, 2005]. Для оживления НК клеток, полученных в модифицированной среде Hartman’s-de Bont использовалась модифицированная среда Sauton [Shleeva, 2004] с добавлением RpfSm.

Фракционирование морфологически дистинктных клеток Mycobacterium smegmatis.

Образец культуры покоящихся клеток, полученных в модифицированной среде SR-1, аккуратно наслаивались поверх градиента сахарозы. После центрифугирования полученных образцов фракции со дна пробирок (120 мкл) собирали для последующего определения числа КОЕ и MPN.

Включение радиоактианой метки Для включения использовали L-3H аспарагин или 5,6- H урацил. Включение осуществляли согласно [Чеканова, 2001]. Число импульсов определяли на LS анализаторе (Beckman Instruments).

Проточная цитофотометрия Для измерения красной флуоресценции (650 nm) гомогенизированной путем пропускания через тонкую иглу шприца культуры, использовали FACSCalibur system (Beckton Dickinson). Этот параметр был получен как суммарная величина импульса для 20000 событий при 800-1100 событий в секунду. Флуоресценция измерялась до и после обработки клеточных суспензий Nilse red (4 мкг мл-1). Анализ данных и графики были получены с помощью WinMDI 2.8.

Световая и флуоресцентная микроскопия.

Клеточные суспензии исследовали с помощью микроскопа Eclipse E4000 (Nicon, Japan) в фазовоконтрастном и эпифлуоресцентном режиме после обработки йодидом пропидиума (PI, 3 мкМ) для определения интактности клеточной стенки; бромидом этидия (EtBr, 5µM), для определения ДНК содержащих клеток; Nile red (4 мкг мл-1) для визуализации липидных включений; DAPI (2 мкг мл-1) для визуализации двухцепочечной ДНК. Для образцов обработанных PI, EtBr, Nile red возбуждение составляло 510 нм, эмиссия, - 560 нм; для образцов обработанных DAPI возбуждение - 330 нм, эмиссия - нм.

Конфокальная микроскопия.

Клетки инкубировали в течение 15 мин при 37 С с бромидом этидия (EtBr, 5мкM) для визуализации нуклеоида и фиксировали парами формалина на покровных стеклах 24 мм мм. Препараты просматривали в конфокально-лазерном микроскопе LSM-510 Meta (Carl Zeiss AG, Германия) с иммерсионным объективом 63 Plan-Apochromat. Флуоресценцию возбуждали He–Ne лазером при = 543 нм, эмиссию регистрировали с помощью фильтра 650–710 нм; плотность эмиссионной энергии 35 Дж/см2. Изображения регистрировали и обрабатывали с помощью программного обеспечения Zeiss LSM 510Meta Software release 3.2.

Электронная микроскопия Клетки инкубировались с 1.5% глутаральдегида в 0.05 М какодилатном буфере (pH 7.2) при 4С в течение 1 часа. После трехкратной отмывки этим буфером, материал был фиксирован в 1% OsO4 в 0.05 M какодилатном буфере при 20 С в течение 3 часов. После дегидратации материал был помещен в эпоксидную смолу Epon 812 и разрезан на секции микротомом LKB 3. Срезы были помещены на медные решетки и контрастированы 3% уранилацетатом в 70% этаноле в течение 30 мин. Срезы просматривали в электронном микроскопе JEM-100B (JEOL), при 60 кВ.

Выделение липидов и их анализ Выделение липидов и их анализ осуществляли согласно [Dobson, 1985]. Хроматограммы были отсканированы и изображения были обработаны с помощью TotalLab 2.01.

Чувствительность клеток к действию стрессовых факторов Образцы клеток, взятые из стационарных культур и культур покоящихся клеток M.

smegmatis инкубировали с различными концентрациями антибиотика в течение суток при 37 С и перемешивании или нагревали при 60-80 С в течение 10 мин или помещались на чашки Петри с 4 мл жидкой среды NB с последующей обработкой ультрафиолетовым излучением (лампа БУФ-30, длина волны 254 нм) согласно [Воробъева, 1994]. Для определения числа КОЕ клетки высевались на твердую среду NB. Число PI позитивных и негативных клеток подсчитывалось в камере Хелбера с использованием эпифлуоресцентного микроскопа.

Измерение кругового дихроизма Спектры регистрировали на дихрографе Mark 5, в интервале 198-320 нм, использовали кюветы с длиной оптического пути 1 мм. Спектры снимали 3 раза, усредняли и вычитали спектр буфера.

Основные результаты и их обсуждение I. Морфологически дифференцированные покоящиеся клетки микобактерий 1.1. Получение покоящихся форм Mycobacterium smegmatis с использованием модифицированной среды SR-1.

Поскольку образование покоящихся форм является, как полагают, ответом клетки на стрессовую ситуацию для нахождения условий для образования морфологическидифференцированных покоящихся форм был применен скрининг неоптимальных условий культивирования.

Для скрининга мы выбрали базовую среду SR-1, созданную для культивирования актинобактерий [Красильников. 1950]. В результате скрининга различных модификаций среды SR-1 были подобраны условия, оптимальные для формирования покоящихся форм M.

smegmatis. Такими условиями оказались пятикратное уменьшение концентрации азота в среде, культивирование клеток при перемешивании в течение 3 суток при пониженной температуре и последующее хранение при комнатной температуре.

Периодическое изучение такой культуры в фазово-контрастном микроскопе показало постепенное накопление атипичных клеток со значительно измененной морфологией. После 14 суток инкубирования, 10-20% клеток в популяции имели форму палочек с хорошо выраженными утолщениями на конце клеток. Во время дальнейшей инкубации клетки стали ракеткоподобными, и после 1.5 месяцев 50-70% популяции было представлено овоидными клетками с центральной высоко рефрактерной областью (Рис. 1). Процентное содержание овоидных клеток в популяции не менялось значительно в течение хранения 5 месяцев и более. Отношение длины овоидных клеток к диаметру составляло 1.0-1.4 (средний диаметр клеток 0.8-1.4 мкм), в то время как для стационарных клеток данный показатель составляет 5-7. Овоидные клетки окрашивались реагентом Циля-Нильсена аналогично палочковидным клеткам стационарной фазы. Образование овоидных клеток очень сильно зависело от условий культивирования: замена N-лимитированной среды SR-1 на среду Sauton в различных модификациях с различными лимитами, или на нормальную нелимитированную среду SR-1 не приводило к формированию овоидных клеток в постстационарной фазе.

Количество овоидных клеток в культуре также очень зависело возраста используемого инокулята. Максимальный выход получался при использовании суточного инокулята.

Анализ последовательности 16S rRNA клеток после оживления подтвердил 100% идентичность исходного дикого типа M. smegmatis и клеток в культуре модифицированной SR-1. Таким образом, на основании полученных данных, можно сделать вывод о способности M. smegmatis образовывать необычные морфологически отличные от вегетативных (овоидные) формы in vitro.

Рис. 1. Световая микроскопия овоидных клеток M. smegmatis.

Культивирование клеток осуществляли на лимитированной по азоту среде SR-1, после чего клетки хранились при комнатной температуре 2, 3 и 4 недели (фотографии a, b, c соответственно). Чистая фракция овоидных клеток (фотография d) была получена путем центрифугирования 5-ти месячной культуры в градиенте сахарозы. Масштаб – 6 микрон.

1.2. Электронная микроскопия овоидных клеток Электронная микроскопия тонких срезов показала значительные различия между клетками стационарной фазы и овоидными клетками, полученными в модифицированной среде SR-1 (Рис. 2). У клеток стационарной фазы, выращенных в среде Sauton в клеточной стенке виден электронно-плотный слой муреина и нечеткий наружный слой малой электронной плотности (Рис. 2с). Цитоплазма этих клеток электронно-плотная, гомогенная и содержит небольшие электронно-прозрачные тела, а также многочисленные электронноплотные включения похожие на полифосфатные гранулы. Нуклеоид с сетеподобными структурированными электронно-плотными нитями легко различим в цитоплазме клеток стационарной фазы (Рис. 2с). Похожие ультраструктурные черты были характерны для клеток стационарной фазы, выращенных в модифицированной среде SR-1.

Ультраструктура овоидных клеток значительно отличалась от таковой клеток стационарной фазы. Клеточная стенка овоидных клеток обладала дополнительным слоем, более нижние слои видоизменены, внутренний слой клеточной стенки электронно-плотный (Рис 2b). Некоторые овоидные клетки обладали электронно-плотной похожей на хвост структурой, окруженной наружным слоем клеточной стенки. Цитоплазма овоидных клеток гетерогенна, гранулирована и содержит большие везикулярные и полигональные электронно-прозрачные тела, а также небольшие электронно-плотные гранулы. В некоторых клетках эти гранулы занимали большую часть клеток. В клетках также обнаруживались длинные фибриллы неизвестного состава (Рис. 2d). Нуклеоид был слабо заметен в овоидных клетках.

Рис 2. Электронная микроскопия клеток стационарной фазы и овоидных клеток M.

smegmatis.

Фотографии а и с, - клетки стационарной фазы, выращенные в стандартной среде Sauton при низком и высоком разрешении; фотографии b и d, - овоидные клетки после 5 месяцев хранения при комнатной температуре при низком и высоком разрешении. OL – наружный слой клеточной стенки, M – муреиновый слой, CM – цитоплазматическая мембрана. Pp – электронно-плотные гранулы, N – нуклеоид, FT – нити фибриллярной структуры, LB – электронно-плотные липидные тела. Масштаб: a, b – 2 микрона; c, d – 0.1 микрон.

1.3. Флуоресцентная микроскопия и проточная цитофотометрия После пяти месяцев хранения клеточная стенка овоидных клеток оставалась интактной (клетки не окрашивались PI), в то время как палочковидные клетки, которые все еще оставались в культуре (9%) оказались PI положительными. Чтобы выяснить природу рефрактерного центрального региона овоидных клеток, они были обработаны Nilse red, которую широко используют для идентификации липидных включений [Garton, 2002].

Врезка на рисунке 3 демонстрирует, что гранулы в большинстве овоидных клеток, обработанных Nilse red, обладают интенсивной флуоресценцией. Согласно данным проточной цитофотометрии, 45±17% клеток обладают значительно более интенсивноq флуоресценцией, чем стационарные клетки, выращенные на среде Sauton (Рис. 3).

Повышенное содержание триглицеридов в покоящейся культуре было также подтверждено методом тонкослойной хроматографии (См. таблицу 3).

Рис. 3. Проточная цитофотометрия клеток стационарной фазы и овоидных клеток M.

smegmatis.

Клетки, выращенные на среде Sauton (3 сут), и клетки, выращенные в модифицированной среде SR-1 с последующим хранением 2.5 месяцев. окрашивали Nilse red (4 мкг мл-1) и анализировали на проточном цитофотометре согласно «Материалам и методам». Эксперимент повторялся 6 раз, на рисунке представлен типичный результат. 1 – необработанные клетки, 2клетки стационарной фазы, 3 – овоидные клетки после 2.5 месяцев хранения. На врезке – фазовоконрастная (A) и флуоресцентная микроскопия после окрашивания Nile red (B) овоидных клеток.

Количество клеток, способных образовывать колонии на твердой агаризованной среде, постепенно снижалось с течением времени при хранении культуры, выращенной на лимитированной по азоту среде SR-1, в то время как число МPN было значительно выше, чем КОЕ. Это различие было более выраженным в старых культурах, что свидетельствовало о накоплении в культуре НК1 клеток, характеризующихся неспособностью образовывать колонии на стандартных твердых средах. Для реактивации НК клеток требовалась специальная процедура оживления в жидкой среде.

1.4. Оживление овоидных клеток Mycobacterium smegmatis предшественники нуклеиновых кислот и белков, что соответствует покоящемуся статусу.

Однако, наблюдалось постепенно возрастание включения радиоактивных предшественников в процессе оживления таких клеток в свежей, модифицированной среде Sauton между 0 и В случае неспорулирующих бактерий, переход в покоящееся состояние может сопровождаться потерей культивируемости (как полной, так и частичной) – неспособностью бактерий расти в условиях, оптимальных для нормальных, живых клеток («некультивируемость»). Такие клетки получили название «некультивируемые» (НК). Реактивация способности к активному росту («оживление») зачастую сопряжена с необходимостью подбора специальных условий для такой реактивации [Kaprelyants, 1993] часами, предшествующими восстановлению способности к делению (Рис. 4а). После часов инкубации клетки начинали делиться, возрастало число КОЕ и уровень включения радиоактивных предшественников. Время удвоения, посчитанное по показателям КОЕ в период между 25-32 часами, составляло 1 час, тогда как время удвоения (деления) в данной среде составляет 4±0.4 часа. Эта разница свидетельствует об оживлении клеток, сопровождающемся ростом культуры, связанным непосредственно с делением. Поскольку максимальное восстановление числа КОЕ в результате оживления не может превышать MPN (2.0 107 мл-1) для той же культуры, период оживления составляет не более 4 часов. Тем не менее, первые 20 часов инкубации (между 2 и 24) также должны рассматриваться как начальный этап оживления.

Рис. 4. Оживление овоидных форм M. smegmatis в модифицированной среде Sauton.

Популяцию овоидных клеток, полученных согласно «Материалам и методам», отмывали и инокулировали в свежую модифицированную среду Sauton, с последующим перемешиванием при 37 0С. (а) c. f. u. ( ) и CPM ( - 5,6- H урацил, - L- H аспарагин), фиксировали каждые 4 часа. Концентрация клеток (КОЕ) после инокуляции составляла 6*105 мл-1. Этот эксперимент повторялся 3 раза, на рисунке представлены результаты типичного эксперимента. Каждая точка для КОЕ и CPM представляет значение 5 и 3 повторностей, соответственно, разброс показывает SD. Фотографии (b) были сделаны во время оживления, было подсчитано процентное содержание овоидных клеток. Концентрация клеток (КОЕ) после инокуляции составляла 3.6*106 мл-1. A -0 часов, B – 5 часов, С - 16 часов, D – 20 часов, Е – 24 часа.

Процентное содержание овоидных клеток составляло 57±9 % до 20 часов оживления, оно составляло 44±10 % в 20 часов, и 21±6 в 24 часа. После 25 часов оживления не было обнаружено ни одной овоидной клетки.

соответствовали результатам микроскопии, подтвердившим переход овоидных клеток к нормальному палочковидному состоянию (Рис. 4).

1.5. Чувствительность покоящихся клеток Mycobacterium smegmatis, полученных в модифицированной среде SR-1, к стрессовым воздействиям.

Поскольку, дормантные клетки обладают повышенной устойчивостью к стрессовым воздействиям, была изучена устойчивость вегетативных и овоидных клеток к действию повышенной температуры и антибиотикам. Оказалось, что по сравнению с 48-часовыми стационарными клетками, овоидные клетки были более устойчивыми к повышенной температуре в диапазоне 60-80С, а также к бактерицидному действию гигромицина и доксициклина (См. таблицу 3, выделено синим). Таким образом, полученные овоидные формы полностью соответствуют всем критериям покоящихся форм.

Таблица 3. Результаты экспериментального изучения физиолого-биохимических свойств овоидных форм, полученных в модифицированной среде SR-1.

плотность (в сахарозе) активность (восстановление СТС) после прогрева при 80С Концентрация клеток в каждом эксперименте составляла 5 107/мл Выживаемость антибиотиков Сохранение интакности клеток II. Роль гистоноподобного белка Hlp в процессе образования и реактивации покоящихся форм Mycobacterium smegmatis Ранее в нашей лаборатории было продемонстрировано, что после культивирования в течение 68-70 часов в модифицированной среде Hartman-de-Bont в условиях недостатка К+ клетки M. smegmatis переходят в состояние покоя с потерей культивируемости на твердых средах, но способны к оживлению в жидкой среде, содержащей Rpf (resuscitation growth factor). Аналогично, штамм Wt-pAGR, несущий плазмиду, содержащую ген rpf M. luteus, также образовывал NC формы, однако такие формы были способны к переходу в вегетативное состояние в жидкой среде без добавления белка Rpf [Shleeva, 2004]. Этот подход к получению и оживлению покоящихся форм, а также подход с использованием модифицированной среды SR-1 был применен для изучения штамма M. smegmatis с инактивированным геном hlp (Hlp-0).

2.1 Динамика перехода в покоящееся состояние различных штаммов M.

smegmatis Было установлено, что скорость роста клеток данного штамма и клеток штаммов, производных от него, растут в модифицированной среде Hartman-de-Bont или в среде NB с той же скоростью, что и штамм дикого типа. Однако, время перехода в NC состояние штамма Hlp-0 (0 КОЕ) при культивировании в модифицированной среде Hartman-de-Bont отличается от штамма Wt-pMind (90-96 часов vs 68-70 часов) (Рис.5а) или дикого типа [Shleeva, 2004]. Комплементированный штамм Hlp-0-hlp, несущий ген hlp в плазмиде, переходил в некультивируемое состояние на 2 часа позже, чем штамм Wt-pMind. Однако, скорость образования покоящихся форм штаммами Hlp-0 и Wt-pMind в модифицированной среде SR-1 была одинаковой (данные не представлены).

Рис. 5. Переход в некультивируемое состояние штаммов M. smegmatis в модифицированной среде Hartman-de Bont.

- штамм Wt-pMind, (зеленый) - Hlp-0-pMind (A), – Hlp-0-AGR, (зеленый) – Wt-AGR, - Hlp-0-AGRmut (Б). Эксперименты A и В повторяли 11 раз, на рисунке представлен результат типичного эксперимента. Каждая точка КОЕ представляет средний результат повторностей. Разброс показывает SD.

2.2. Способность покоящихся форм штамма Hlp-0 к оживлению.

НК клетки штаммов Hlp-0 и Wt-pMind были протестированы на их способность к оживлению в присутствии рекомбинантного белка M. luteus RpfSm, который оказался более активным и стабильным во время хранения, чем полноразмерный белок Rpf (данные неопубликованы). В противоположность Wt-pMind, NC клетки штамма Hlp-0 оказались неспособными к оживлению в жидкой среде с RpfSm (Рис. 6).

Рис. 6. Оживление NC клеток M. smegmatis обусловленное Rpf.

NC клетки M. smegmatis штаммов Wt-pMind, Hlp-0-pMind а также комплементированного штамма Hlp-0-pMind-Hlp были помещены в жидкую среду Sauton с добавлением RpfSm (5 ng ml-1) (серые колонки) или без него (белые колонки). MPN анализ был выполнен путем последовательного разведения клеточных суспензий в трех повторностях для каждого эксперимента. На рисунке представлен средний результат по 3 независимым экспериментам.

Разброс показывает SD. Число КОЕ в культурах перед оживлением составляло 1* 102 – 6.9*103.

Клетки штамма Hlp-0-pMind-Hlp, несущего ген hlp в плазмиде, частично оживлялись RpfSm (Рис. 6). Это доказывает, что неспособность штамма с инактивированным геном гистоноподобного белка «оживать» под действием RpfSm связяна именно с отсутствием гистоноподобного белка Hlp. Таким образом, недостаток Hlp проявляется в переходе микобактериальных клеток в необратимо некультивируемое (или умирающее) состояние при данных условиях (недостаток К+), а не в переходе к NC покою. На основании этих данных можно заключить, что Hlp не влияет на запуск процесса перехода в некультивируемое состояние, но является необходимым для жизнеспособности клеток на поздних стадиях покоя.

Примечательно, что штамм Hlp-0-pAGR с инактивированным геном hlp и несущим плазмиду с геном rpf культивируемым в модифицированной среде Hartman-de-Bont. В частности, клетки Hlp-0pAGR оставались способными образовывать колонии даже после 180 часов культивирования - в противоположность штаммам Hlp-0 и Hlp-0-pAGH (Рис. 5в). Таким образом, комбинированное действие понижения уровня Hlp и повышение уровня Rpf радикально продлило способность клеток M. smegmatis переживать недостаток питательных веществ в полностью культивируемом состоянии, выявляя противоположных эффект этих двух белков остающихся культивируемыми клеток в умирающей популяции клеток Hlp-0, как уже отмечалось для культур M. smegmatis [Shleeva, 2004]. Аналогично, отсрочка в переходе к NC состоянию у штамма Wt-pAGR, несущего ген rpf (Рис. 5в), может отражать Rpfобусловленную стимуляцию роста некоторых клеток в общей популяции. Значительные отличия в поведении штаммов Hlp-0-pAGR и Hlp-0 может обсуждаться исходя из двойного эффекта действия Rpf: поддержание роста ослабленных популяций (как в случае со штаммом Hlp-0), и, собственно, эффекта оживления покоящихся форм штаммов Wt или Hlp-0-pAGR. Это является еще одним доказательством того, что штаммы Wt и Hlp- находятся в разном физиологическом состоянии. Таким образом, данные результаты свидетельствуют о том, что Hlp играет роль в адаптации обратимого NC в клетках M.

smegmatis на поздних стадиях культивирования в соответствующей среде.

2.3. Устойчивость покоящихся форм штамма Hlp-0 к стрессовым воздействиям.

В следующей группе экспериментов была изучена устойчивость морфологически измененных (овоидных) форм к стрессовым воздействиям. Морфологически измененные формы дикого типа оказались более устойчивы к действию повышенной температуры. Так, например, при прогревании овоидных форм, полученных в модифицированной среде SR-1, 800С 10 мин, количество живых клеток штамма Hlp-0 было в 100 раз меньше, чем дикого типа. Аналогичные результаты были получены при обработке овоидных форм ультрафиолетовым излучением.

На основании полученных результатов можно заключить, что несмотря на способность микобактерий с инактивированным геном hlp продуцировать овоидные формы, Hlp обеспечивает их устойчивость к стрессовым условиям. Возможно, что гистоноподобные белки являются общим звеном антистресового механизма. Так, было продемострировано, что концентрация Hlp в клетках M. smegmatis значительно возрастает в ответ на холодовой шок (00С); кроме того, штамм с инактивированным геном hlp неспособен к росту при 100С [Shires, 2001].

2.4. Роль гистоноподобного белка Hlp в архитектуре нуклеоида.

Хотя механизм, с помощью которого Hlp осуществляет свою антистрессорную функцию, остается неясным, можно было предположить, что Hlp функционирует как физический щит против стрессовых факторов, действие которых приводит к повреждению ДНК, аналогично другому гистон-подобному белку Lrs2 M. tuberculosis, который защищает ДНК от ROI in vitro и во время инфекции [Colangeli et al., 2009]. Изучение в эпифлуоресцентном микроскопе овоидных клеток, полученных в модифицированной среде SR-1, обработанных DAPI, выявило четко различимые области компактизованной ДНК в покоящихся клетках штамма Wt-pMind, отсутствующих в штамме Hlp-0-pMind (Рис. 7).

Спектроскопия образцов комлексов ДНК и белка, выделенных из овоидных форм штаммов дикого типа и штамма Hlp-0 показала, что с ДНК овоидных форм штамма дикого типа связано на 34% белка больше, чем с ДНК штамма с инактивированным геном hlp (данные не представлены), что может служить косвенным подтверждение возможной роли Hlp как протекторного щита.

Рис. 7. Световая микроскопия покоящихся форм M. smegmatis, полученных в модифицированной среде SR-1.

Образцы из культур овоидных клеток, полученных после культивирования в модифицированной среде SR-1 (4.5 мес) штаммов Wt (A, B), Hlp-0 (C, D) и Hlp-0-hlp (E,F) обрабатывали DAPI (2 мкг мл-1) и изучали в фазовоконтрастном (A, C, E) и эпифлуоресцентном режиме (B, D, F).

III. Взаимодействие гистоноподобного белка и ДНК in vitro.

3.1. Изменения вторичной структуры ДНК при связывании Hlp.

Для изучения характера изменений во вторичной структуре ДНК, вызываемых связыванием с Hlp, был использован метод кругового дихроизма. Спектры КД, снятые для отдельно ДНК (плазмиды), белка Hlp и их смеси выявили различие во вторичной структуре ДНК при связывании с белком (Рис. 8).

Рис. 8. Изменения в КД спектре ДНК при связывании Hlp in vitro Синим цветом показан спетр КД рекомбинантного белка Hlp в концентрации 4.5 мкг/мл, розовым цветом, - спектр кольцевой плазмиды в концентрации 1.12 мкг/мл, желтым, - спектр их комплекса. Спектры снимали 3 раза, усредняли и вычитали спектр буфера.

Для более детального изучения изменений вызываемых взаимодействием Hlp и ДНК KД спектры были математически обработаны с использованием метода разностных спектров. А именно, были построены спектры разности математической суммы спектров ДНК и белка и спектров их взаимодействия (Рис. 9). Как видно, такая обработка выявила отклонение спектров от нулевой линии в области 270 и 220 нм. Изменения спектра в области 270 нм свидетельствует о связывании рекомбинантного белка Hlp c ДНК, изменения в области 220 нм - об образовании областей суперскручивания [Каргов, 2008]. Эти изменения позволяют сделать вывод об индукции суперспирализации ДНК при связывании белка Hlp.

Рис. 9. Разностные спектры математической суммы спектров ДНК и гистона минус спектр смеси ДНК и гистона в реакционной среде.

Концентрация ДНК в каждой реакции составляла 1.12 мкг/мкл. Синим цветом показан спектр с участием 1.35 мкг/мкл Hlp, розовым - 2.025 мкг/мкл, желтым - 2.475 мкг/мкл, зеленым - 4. мкг/мкл. Спектры снимали 3 раза, усредняли и вычитали спектр буфера 3.2. МЭЦ как возможный регулятор связывания Hlp с ДНК.

Согласно ранее полученным данным [Grieshaber, 2006], один из компонентов гистоноподобного белка стафилококка Lsr2 с нуклеоидом. Мы предположили, что связывание Hlp с нуклеоидом у микобактерий может регулироваться аналогичным образом.

Для проверки данного предположения в реакционную смесь гистон-ДНК был добавлен МЭЦ в концентрации 8.8 мкг/мл (Рис. 10), после чего был записан спектр КД.

Рис. 10. МЭЦ предотвращает связывание ДНК и гистноподобного белка Hlp.

Синим цветом показан разностный спектр КД математической суммы спектров ДНК и гистона минус спектр смеси ДНК и гистона в реакционной среде, оранжевым - разностный спектр математической суммы спектров (ДНК + гистон + МЭЦ) минус спектр смеси (ДНК + гистон + МЭЦ в реакционной среде), розовым - разностный спектр математической суммы спектров (ДНК + гистон + пирофосфат) минус спектр смеси (ДНК + гистон + пирофосфат в реакционной среде). Спектры снимали 3 раза, усредняли и вычитали спектр буфера.

Как видно из рис.10, МЭЦ препятствует связыванию Hlp и ДНК (разностный спектр математической суммы спектров (ДНК + гистон + МЭЦ) минус спектр смеси (ДНК + гистон + МЭЦ в реакционной среде) дают нулевую линию). Такое воздействие очевидно фосфатсодержащего соединения – пирофосфата не приводило ни к каким изменениям во взаимодействии гистоноподобного белка и ДНК (совпадение с разностным спектром математической суммы спектров (ДНК + гистон) минус спектр смеси (ДНК + гистон в реакционной среде) (Рис. 10).

Выводы 1. Культивирование M. smegmatis в условиях недостатка азота и пониженной температуры M. smegmatis приводит к формированию морфологически дифференцированных овоидных покоящихся форм.

2. Полученные формы обладают повышенной устойчивостью к стрессовым воздействиям (антибиотики, УФ или повышенная температура).

3. Гистоноподобный белок Hlp определяет обратимость перехода клеток из покоящегося и некультивируемого состояния в активное состояние. Инактивация гена hlp M. smegmatis приводит к гибели клеток в условиях перехода клеток в покоящееся состояние.

4. Гистоноподобный белок Hlp в покоящихся клетках обеспечивает их повышенную устойчивость к стрессовым воздействиям (повышенная температура, УФ, антибиотики), которая, по-видимому, связана с обусловленной Hlp компактизацией нуклеоида.

5. Связывание Hlp с бактериальной ДНК вызывает суперспирализацию ДНК in vitro.

циклопирофосфат (МЭЦ) препятствует взаимодействию Hlp с ДНК.

Список публикаций.

Статьи 1. Anuchin AM, Mulyukin AL, Suzina NE, Duda VI, El-Registan GI, Kaprelyants AS. Dormant forms of Mycobacterium smegmatis with distinct morphology. Microbiology SGM. 2009, 155, pp.

1071-1079.

2. Anuchin A. M., Goncharenko A. V., Demina G. R., Mulyukin A. L.,Ostrovsky D. N., Kaprelyants A. S. The role of histone-like protein, Hlp, in Myсobacterium smegmatis dormancy.

FEMS Microbiol Lett., 2010, 308, рр. 101-107.

3. А. М. Анучин, А. В. Гончаренко, И. В. Галон, О. И. Демиденок, Ю. К. Кудыкина, М. М.

Мойсенович, А. Л. Мулюкин, А. С. Капрельянц. Модель покоящихся форм микобактерий для тестирования химиопрепаратов против латентных форм туберкулеза. Прикладная биохимия и микробиология, 2010, 3, стр. 28-34.

4. А.Л. Мулюкин, Ю.К. Кудыкина, М.О. Шлеева, А.М. Анучин, Н.Е. Сузина, В.Н.

Данилевич, В.И. Дуда, А.С. Капрельянц, Г.И. Эль-Регистан. Внутривидовое разнообразие покоящихся форм Mycobacterium smegmatis. Микробиология, 2010, 79, стр.486-497.

Тезисы конференций 1. Гончаренко А. В., Галон И. А., Анучин А. М., Островский Д. Н., Капрельянц А. С.

Влияние инактивации гена гистон-подобного белка на образование покоящихся «некультивируемых» форм Mycobacterium smegmatis. 4й съезд Российского общества биохимиков и молекулярных биологов, Новосибирск, 2008, стр. 162.

2. Анучин А. М., Гончаренко А. В., Демиденок О. И., Капрельянц А. С. Новая модель образования покоящихся форм Mycobacterium smegmatis. Роль гистоноподобного белка Hlp в процессе образования покоящихся форм. 4я международная конференция молодых ученых «От молекулы до биосферы», Харьков, 2009, стр.163.

3. Gonchrenko A. V., Demidenok O. I., Anuchin A. M., Galon I. A., Ostrovsky D. N., Kaprelyants A. S. A new toxin-antytoxin gene family (TA), a global regulator of the physiological state in Mycobacterium: from dormancy to a programmed cell death. ICOMID 2009, p. 151.



 
Похожие работы:

«Работа выполнена в Зоологическом институте РАН и Мурманском морском биологическом институте КНЦ РАН ДЕНИСЕНКО Официальные оппоненты : доктор биологических наук, Станислав Григорьевич профессор Бергер В.Я. доктор биологических наук, профессор МАКРОЗООБЕНТОС БАРЕНЦЕВА МОРЯ Брязгин В.Ф. В УСЛОВИЯХ МЕНЯЮЩЕГОСЯ КЛИМАТА И АНТРОПОГЕННОГО ВОЗДЕЙСТВИЯ доктор биологических наук Гебрук А.В. Специальность 03.00.18 – гидробиология Ведущая организация : Всероссийский...»

«Каюкова Светлана Николаевна ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ВИДОВ РОДА OROSTACHYS FISCH. В ВОСТОЧНОМ ЗАБАЙКАЛЬЕ 03.00.05 - ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ 2009 Работа выполнена в Забайкальском государственном гуманитарнопедагогическом университете им. Н.Г. Чернышевского доктор биологических наук, профессор Научный руководитель : Бэлла Иванова Дулепова Официальные оппоненты : Татьяна Петровна Анцупова, доктор...»

«СОМОВА РЕГИНА ШАМИЛЕВНА МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЕ ИССЛЕДОВАНИЕ ДОЛГОЛЕТИЯ И СТАРЕНИЯ НА МОДЕЛЬНЫХ ЛИНИЯХ Musca domestica L. И В ПОПУЛЯЦИИ ЧЕЛОВЕКА 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Уфа 2013 Работа выполнена в лаборатории физиологической генетики Федерального государственного бюджетного учреждения науки Института биохимии и генетики Уфимского научного центра Российской академии наук Научный руководитель :...»

«ШОСТАЛЬ ОЛЬГА АНДРЕЕВНА ВЛИЯНИЕ УСЛОВИЙ ОСВЕЩЕНИЯ НА ПРОДОЛЖИТЕЛЬНОСТЬ ЖИЗНИ DROSOPHILA MELANOGASTER Специальность 03.02.08 – Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Сыктывкар 2010 1 Работа выполнена в Учреждении Российской академии наук Институте биологии Коми научного центра Уральского отделения Российской академии наук. Научный руководитель : доктор биологических наук, доцент Москалев Алексей Александрович Официальные...»

«Жмылёва Александра Павловна Влияние экологических факторов на время зацветания лесных растений средней полосы России 03.00.16 – Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2009 2 Диссертационная работа выполнена на кафедре системной экологии экологического факультета Российского университета дружбы народов Научный руководитель : кандидат биологических наук, доцент Карпухина Е.А. Официальные оппоненты : доктор...»

«СУСЛОВА Мария Юрьевна РАСПРОСТРАНЕНИЕ И РАЗНООБРАЗИЕ СПОРООБРАЗУЮЩИХ БАКТЕРИЙ РОДА BACILLUS В ВОДНЫХ ЭКОСИСТЕМАХ 03.00.16 – экология 03.00.07 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ, 2007 Работа выполнена в лаборатории водной микробиологии Лимнологического института СО РАН, г. Иркутск Научный кандидат биологических наук руководитель: ст.н.с. Парфенова Валентина Владимировна Официальные Доктор биологических наук...»

«Селина Екатерина Евгеньевна ОЦЕНКА ВЛИЯНИЯ ТЕХНОГЕННОГО ЗАГРЯЗНЕНИЯ НА СОСТОЯНИЕ РАСТЕНИЙ В ДОЛИНАХ МАЛЫХ РЕК 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Саратов – 2011 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Пензенский государственный университет на кафедре Экология и безопасность жизнедеятельности Научный руководитель доктор биологических наук, профессор...»

«Щеголев Алексей Юрьевич Потенцирование NO-зависимой активации растворимой гуанилатциклазы 03.01.04 – биохимия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Москва 2010 Работа выполнена в Учреждении Российской академии медицинских наук Научно-исследовательском институте биомедицинской химии имени В.Н.Ореховича РАМН, Москва Научный руководитель доктор биологических наук И. С. Северина Официальные оппоненты : доктор медицинских наук, заслуженный...»

«КОМАРОВА ЕЛЕНА МИХАЙЛОВНА АЛЛЕЛОПАТИЧЕСКИЕ СВОЙСТВА РАСТИТЕЛЬНЫХ ДОМИНАНТ В ОПТИМИЗИРОВАННЫХ ВЫСОКОПРОДУКТИВНЫХ ЛУГОВЫХ АГРОЦЕНОЗАХ НИЖНЕГО ДОНА 03.00.16 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону - 2006 2 Работа выполнена на кафедре ботаники и в Ботаническом саду Ростовского государственного университета Научные руководители: доктор биологических наук, профессор Сидоренко Владимир Гаврилович кандидат...»

«Ганеева Лилия Ахатовна ОЦЕНКА УРОВНЯ АНТИОКИСЛИТЕЛЬНЫХ ФЕРМЕНТОВ И ЖЕЛЕЗА, МЕДИ, МАРГАНЦА В КЛЕТКАХ КАРТОФЕЛЯ, ИНФИЦИРОВАННЫХ PHYTOPHTHORA INFESTANS. 03.00.07 – микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Казань - 2009 2 Работа выполнена в ТТГПУ, г. Казань и в Институте проблем экологии и недропользования академии наук РТ, г.Казань. Научный руководитель : доктор биологических наук, профессор Морозов Николай Васильевич...»

«Баландина Алевтина Власовна МИКРОБНАЯ РЕМЕДИАЦИЯ НЕФТЕЗАГРЯЗНЕННЫХ АГРОДЕРНОВО-КАРБОНАТНЫХ ПОЧВ И ТЕХНОГЕННЫХ ПОВЕРХНОСТНЫХ ОБРАЗОВАНИЙ В ПОДЗОНЕ ЮЖНОЙ ТАЙГИ 03.02.08 – экология (биология) Автореферат диссертации на соискание ученой степени кандидата биологических наук Пермь - 2013 Работа выполнена на кафедре физиологии растений и микроорганизмов в ФГБОУ ВПО Пермский государственный национальный исследовательский университет и на кафедре микробиологии ГБОУ ВПО Пермская...»

«БОРОДИН Всеволод Игоревич ЭКОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ПРЕДСТАВИТЕЛЕЙ РОДА ВЁШЕНКА (PLEUROTUS (FR.) P. KUMM.) ГОРНО-ЛЕСНЫХ ФИТОЦЕНОЗОВ СЕВЕРО-ЗАПАДНОГО КАВКАЗА 03.02.08 Экология (Биологические наук и) АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Краснодар – 2013 Работа выполнена на кафедре биологии и экологии растений ФГБОУ ВПО Кубанский государственный университет. доктор биологических наук, профессор Научный руководитель : Криворотов Сергей...»

«Памирский Игорь Эдуардович АНАЛИЗ СТЕПЕНИ СТРУКТУРНОЙ И ФУНКЦИОНАЛЬНОЙ ОДНОТИПНОСТИ ПОЛИВАЛЕНТНОГО ИНГИБИТОРА ПРОТЕАЗ, СОДЕРЖАЩЕГОСЯ В ПОДЖЕЛУДОЧНОЙ ЖЕЛЕЗЕ ЖИВОТНЫХ, И СОЕВОГО ИНГИБИТОРА ТРИПСИНА 03.00.13 – физиология 03.00.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Благовещенск – 2009 2 Работа выполнена на кафедре биологической химии ГОУ ВПО Амурская государственная медицинская академия Министерства здравоохранения и...»

«ЭБЕЛЬ Александр Леонович ФЛОРА СЕВЕРО-ЗАПАДНОЙ ЧАСТИ АЛТАЕ-САЯНСКОЙ ПРОВИНЦИИ: СОСТАВ, СТРУКТУРА, ПРОИСХОЖДЕНИЕ, АНТРОПОГЕННАЯ ТРАНСФОРМАЦИЯ 03.02.01 – Ботаника Автореферат диссертации на соискание ученой степени доктора биологических наук Томск 2011 Работа выполнена на кафедре ботаники ФГБОУ ВПО Национальный исследовательский Томский государственный университет Научный консультант : доктор биологических наук, профессор Ревушкин Александр Сергеевич Официальные оппоненты :...»

«Диркс Марина Николаевна ФЛОРА МОЛОДЫХ МОРЕН ЛЕДНИКОВ ЦЕНТРАЛЬНОГО АЛТАЯ 03.00.05 – Ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Томск – 2006 Работа выполнена в группе динамики и устойчивости экосистем Института мониторинга климатических и экологических систем СО РАН Научный руководитель : доктор биологических наук, Е.Е. Тимошок Официальные оппоненты : доктор биологических наук, А.И. Пяк доктор биологических наук, Н.А. Некратова...»

«Трошева Татьяна Дмитриевна АНТИФУНГАЛЬНЫЕ СРЕДСТВА И ФАКТОРЫ ПАТОГЕННОСТИ ОППОРТУНИСТИЧЕСКИХ ГРИБОВ 03.01.06 – Биотехнология (в том числе бионанотехнологии) 03.02.03 – Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Санкт-Петербургский научно-исследовательский центр экологической безопасности Российской академии наук (НИЦЭБ РАН) в...»

«МАТВЕЕВА Анжелика Рафиковна СЕКРЕТИРУЕМЫЕ ПРОТЕАЗЫ НЕКОТОРЫХ МИЦЕЛИАЛЬНЫХ ГРИБОВ: ВЫДЕЛЕНИЕ, ОЧИСТКА И ХАРАКТЕРИСТИКА ФИЗИКО-ХИМИЧЕСКИХ И ФУНКЦИОНАЛЬНЫХ СВОЙСТВ 03.00.24-микология 03.00.04-биохимия АВТОРЕФЕРАТ на соискание ученой степени кандидата биологических наук Москва 2008 Работа выполнена на кафедре микологии и альгологии биологического факультета и в отделе функциональной биохимии...»

«Воронкова Валерия Николаевна ОЦЕНКА ГЕНЕТИЧЕСКОГО РАЗНООБРАЗИЯ ЛОШАДЕЙ САЯНО-АЛТАЙСКОГО РЕГИОНА С ИСПОЛЬЗОВАНИЕМ ЯДЕРНЫХ И МИТОХОНДРИАЛЬНЫХ ДНК МАРКЕРОВ 03.02.07 – генетика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва, 2012г. Работа выполнена в лаборатории сравнительной генетики животных Федерального государственного бюджетного учреждения науки Института общей генетики им. Н.И. Вавилова Российской академии наук, г. Москва Научный...»

«Ахмадуллина Юлия Рафисовна РАДИОЧУВСТВИТЕЛЬНОСТЬ Т-ЛИМФОЦИТОВ ПЕРИФЕРИЧЕСКОЙ КРОВИ У ПОТОМКОВ ПЕРВОГО ПОКОЛЕНИЯ, ОТЦЫ КОТОРЫХ ПОДВЕРГЛИСЬ ХРОНИЧЕСКОМУ РАДИАЦИОННОМУ ВОЗДЕЙСТВИЮ 03.01.01 – радиобиология Автореферат диссертация на соискание ученой степени кандидата биологических наук Москва-2014 1 Работа выполнена на базе Федерального государственного учреждения науки Уральского научно-практического центра радиационной медицины Федерального медико-биологического агентства...»

«КОЛЕСОВА Наталья Сергеевна ВИДОВОЕ РАЗНООБРАЗИЕ И СТРУКТУРА НАСЕЛЕНИЯ ШМЕЛЕЙ (HYMENOPTERA, APIDAE: BOMBUS, PSITHYRUS) ТРАНСФОРМИРОВАННЫХ ТАЕЖНЫХ ЭКОСИСТЕМ ВОЛОГОДСКОЙ ОБЛАСТИ 03.02.08 – экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Сыктывкар – 2010 Работа выполнена на кафедре зоологии и экологии ГОУ ВПО Вологодского государственного педагогического университета Научный руководитель : доктор биологических наук, профессор БОЛОТОВА...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.