WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

РОССИЙСКАЯ АКАДЕМИЯ НАУК

ИНСТИТУТ БИОХИМИИ им. А.Н. БАХА РАН

на правах рукописи

СУРОВЦЕВА Елена Владимировна

Методы ДНК-доставки и мониторинга фактора некроза опухолей человека на

животных моделях

Специальности

03.00.04 - «Биохимия»

03.00.03 - «Молекулярная биология»

Автореферат диссертации на соискание ученой степени кандидата биологических наук

Москва 2005

Научный руководитель: кандидат биологических наук А.Б. Шевелев

Официальные оппоненты: доктор биологических наук, проф. Б.С. Народицкий кандидат биологических наук А.В. Жердев

Ведущая организация: ГОУ ВПО Российский государственный медицинский университет Росздрава

Защита состоится 15 ноября 2005 г. в 14 часов на заседании Диссертационного совета К002.247.01 при Институте биохимии им А.Н. Баха РАН по адресу:119071, Москва, Ленинский проспект, д. 33, строение

С диссертацией можно ознакомиться в библиотеке Института биохимии им. А.Н. Баха РАН по адресу:119071, Москва, Ленинский проспект, д.33 строение Автореферат разослан 2005 г.

Ученый секретарь Диссертационного Совета, кандидат биологических наук А.Ф. Орловский

Общая характеристика работы

Актуальность проблемы Секреторные белковые медиаторы большинства важнейших процессов в организме человека и млекопитающих функционируют в очень низких физиологических концентрациях. При этом высокая биологическая активность ростовых факторов и цитокинов в отношении клеток организма, как правило, компенсируется их стремительной деградацией. Высокая скорость распада и синтеза ростовых факторов приводит к формированию квазистационарных концентрационных градиентов вблизи клеток-продуцентов, которые, по-видимому, возникают за счет распределения ростовых и сигнальных факторов в организме.

Создание именно таких устойчивых во времени градиентов является желательным условием тестирования действия лимфокинов и ростовых факторов на животных моделях, однако эта задача не реализуема при введении испытуемых белков в систему в форме готовой субстанции.

Наиболее физиологичным методом доставки ростовых факторов представляется индуцированная экспрессия клеточных медиаторов собственными клетками организма in vivo, которая может быть достигнута при введении в отдельные клетки животного генной конструкции, несущей соответствующий структурный ген. В настоящее время многие проекты, направленные на создание средств борьбы с вирусными и онкологическими заболеваниями, включают введение в организм человека ДНК, несущей ген соответствующего цитокина [Bartlett et al., 2003]. В этом случае уровень экспрессии определяется, прежде всего, силой промотора, а также возможностью доставки ДНК к тканям-мишеням.





Доля клеток, непосредственно подвергающихся трансфекции в результате внутримышечной инъекции неупакованной ДНК, очень невелико (не более 10-5 в непосредственно вблизи точки инъекции), поэтому напрямую оценивать эффективность доставки конструкций по появлению белкового продукта или специфического транскрипта представляется затруднительным. В этой связи наиболее доступными являются косвенные методы оценки на основе измерения уровня продукции специфических антител в ответ на синтезированный in situ рекомбинантный белок. Выявление таких антител, легко доступное в техническом отношении, может служить доказательством факта доставки ДНК в заданный участок ткани-мишени.

Цель и задачи исследования В качестве цели настоящей работы рассматривалась разработка генноинженерных конструкций для доставки растворимого TNF-1 человека в секреторной и внутриклеточной форме в клетки млекопитающих. Эффективность разработанных конструкций оценивалась по критерию появления в крови животного в результате парентерального введения плазмидной ДНК специфических поликлональных антител против TNF- человека.

Для достижения поставленной цели необходимо было решить следующие экспериментальные задачи:

1) создание иммунохимической системы детекции TNF- на основе антител, выработанных при иммунизации кролика рекомбинантным белком;

TNF- – фактор некроза опухолей 2) получение биологически активного стандарта стандарта для разработки тест-системы;

3) характеристика специфичности аффинноочищенных антител против TNFчеловека;

4) создание конструкций для доставки TNF- человека в клетки млекопитающих в секреторной и внутриклеточной форме;

5) изучение свойств полученных конструкций в тестах на животных моделях.

Научная новизна работы Впервые показана возможность доставки TNF- человека на животной модели с помощью свободной ДНК. В нашем случае доставка TNF- человека проведена параллельно на двух видах животных, причем сопоставлена эффективность действия секретируемого и несекретируемого вариантов белков.

Подтверждено ранее высказанное предположение [Chowdhury et al., 2001;

Gardsvoll et al., 2000] о значительных различиях характера ответа на антиген, доставляемый методом ДНК-иммунизации, в случае крысы и кролика. Это проявилось, в частности, в форме двухфазной динамики сероконверсии титра специфических антиткел у кролика.

Практическая ценность работы В представляемой работе первая часть посвящена получению рекомбинантного TNF- человека, необходимого в дальнейшей работе для иммунобиохимических тестов. Предложен оригинальный дизайн генной конструкции, приводящий к более высокому, по сравнению с ранее использовавшимися [Шингарова и др., 1997] уровню продукции целевого продукта (до 100 мг/л). Разработана оригинальная методика ренатурации TNF- из телец включения. Факт приобретения TNF- нативной конформации в результате ренатурации рекомбинантного белка подтвержден наличием связывания продукта ренатурации с экстраклеточным доменом рецептора TNF 1 типа в тесте in vitro.





Нативный рецептор TNF получен экспрессией в клетках Drosophila melanogaster.

Вторая часть работы посвящена характеристике полученных аффинно очищенных поликлональных антител против TNF- человека. Получены предварительные данные, подтверждающие перспективность использования этих антител при дифференциальной и уточняющей диагностике больных рассеянным склерозом.

Публикации По материалам диссертации опубликованы 3 печатные работы.

Структура и объем диссертации Диссертация изложена на 125 страницах и состоит из введения, литературного обзора, описания материалов и методов, изложения результатов и их обсуждения, выводов и списка литературы (135 наименований). Диссертация содержит рисунков и 1 таблицу.

Апробация работы Материалы работы представлялись на ежегодном конкурсе работ института биохимии им.А.Н. Баха РАН (декабрь 2004) и на конференции “Перспективные направления физико-химической биологии и биотехнологии” (Москва, институт биороганической химии им.М.М. Шемякина и Ю.А. Овчинникова РАН, февраль 2005г).

Методы работы с культурами клеток эукариот Культивирование клеток линии цитотоксических лимфоцитов Линию нормальных цитотоксических лимфоцитов человека CER поддерживали в жидкой среде RPMI 1640 (Invitrogen, Германия) с добавлением 10% инактивированной лошадиной сыворотки при 37C и 8% CО2. Для стимуляции роста CER43 раз в 10 дней в клеточную культуру вносили 10-кратный избыток периферических моноцитов крови человека (PBMC), выделенных центрифугированием в градиенте фиколла.

PBMC выделяли из свежей крови здорового донора. В 50-мл. стерильную пробирку отбирали 35 мл крови. Далее на дно пробирки осторожно наслаивали 10 мл фиколла. После центрифугирования 10 мин 1500g отбирали среднюю фазу.

Процедуру повторяли три раза. Из 35 мл крови выделяли в среднем 50х106клеток.

Культивирование клеток эмбриональной линии Drosophila melanogaster Клетки стандартной лабораторной линии дрозофилы S2 (Invitrogen, Германия) выращивались на очищенной от белка среде Шнейдера Insect-Xpress (Biowhitaker, США) c добавлением 10% инактивированной лошадиной сыворотки при 26C, при качании со скоростью 115 об/мин. Клетки пересевали 2 раза в неделю, стараясь держать в логарифмической фазе роста 5х1051х106клеток/мл.

Генно-нженерное конструирование Получение кДНК из клеток линии CER Суммарную РНК выделяли с использованием Oligotex Direct mRNA Mini Kit (Qiagen, Германия), после чего с использованием ревертазы Mo MuLV (Eppendorf, Германия) и случайных праймеров (N6) получали первую цепь кДНК. Реакцию проводили при 37С в течение 1 ч и останавливали прогревом до 70С в течение 5 мин.

Сборка экспрессионной конструкции для получения TNFR1 в клетках дрозофилы На основании опубликованной нуклеотидной последовательности мPHK TNFR1 (номер доступа в NCBI Gene Bank - NCBI NM_001065) была подобрана пара олигонуклеотидных праймеров:

TNFR1-for (KpnI) (5’)-catagggtaccagcatgggcctctccaccgtgc-3’ TNFR2-rev (AgeI) (5’)-cattcaccggtggtgcacacggtgttctg-3’ В праймер TNFR1-for был введен элемент Козака (agca) и стартовый кодон ATG. С использованием ПЦР на амплификаторе марки (Applied Biosystem, США) был получен фрагмент ДНК ожидаемого размера 500 п.н., кодирующий TNFR1.

ПЦР-амплификат был расщеплен по сайтам KpnI/AgeI и клонирован в вектор pMT/V5-His (Invitrogen, Германия), предварительно линеаризованный теми же рестриктазами. В результате была получена плазмидная конструкция pMT-TNFR1, кодирующая рекомбинантный ed-TNFR1.

Сборка экспрессионных конструкций TNF- человека Праймеры TNF1, TNF2, TNF3 и TNF5 были сконструированы на основе нуклеотидной последовательности [NCBI M26331].

TNF-1 (NdeI) (5’)-ggcatatgatgcgcagcagcaggccgcaaccccgagcgataaa TNF-2 5’)-cgccaccacatgggccaccggtttatcactcggggtgc TNF-3 (BamHI) (5’)-ggggatccgttaacccgcaggctgaggggcagctccagtg TNF-5 (XbaI) (5’)-ggtctagagggcaataatcccaaagtag Для генноинженерного конструирования на базе вектора pET23a (Novagen, США) в работе использовали штамм E. coli BMH 71-18 (thi, supE, F’proAB, laclq ZM15) (Promega, США). Для проведения экспрессии под контролем промотора фага Т7 служил штамм BL21(DE3) (F-, ompT, hsd Sb(rb-, mb-), dcm, gal, (DE3), pLysS, Cmr).

ПЦР с геномной ДНК человека и праймерами TNF3 и TNF5 осуществлялась на термоциклере Tercyc MC-16 (ДНК-технология, Россия). При проведении ПЦР использовали ДНК-полимеразу Taq (Бионем, Россия). Геномную ДНК-матрицу вносили в реакционную смесь до конечной концентрации 0.01 мкг/мкл. ПЦР проводили в следующих условиях: 94°С -1 мин, 54°С – 45 с, 72°С -15 с, 30 циклов.

Получение генноинженерных конструкций для ДНК-иммунизации против TNFчеловека Фрагмент ДНК для клонирования был получен ПЦР с использованием Т стандартного праймера (MBI Fermentas, Литва) и праймера TNF5 на матрице pTNF5.

На базе системы прямого клонирования ПЦР-продуктов pGem-T-Easy (Promega, США) была получена промежуточная конструкция pGem-TNF2.

Фрагмент ДНК, кодирующий зрелый TNF- человека, был получен рестрикцией плазмиды pGem-TNF2 по сайтам NotI и SpeI и клонирован в предварительно линеаризованный по сайтам NotI и XbaI вектор pC-DNA3.

Полученная плазмидная конструкция pCD-TNF3 использовалась далее для иммунизации животных.

Для получения конструкции pCD-TNF4 был синтезирован праймер:

TNF7(HindIII) (5’)-aaaagcttgatgcggatcctggagctggccgagga ПЦР-амплификат размером 1.8 т.п.н. был получен на матрице геномной ДНК человека с использованием праймеров TNF7 и TNF5. Далее этот амплификат был расщеплен рестриктазами HindIII/XbaI pC-DNA3, предварительно лианеризованный этими же рестриктазами. Полученная конструкция pCD-TNF была использована для иммунизации животных.

Иммунизация животных Иммунизация крыс рекомбинантным белком в виде телец включения и получение сыворотки против TNF- человека Иммунизацию 2-х крыс породы Wistar проводили подкожно 3 раза с интервалом 10 дней в присутствии при первой иммунизации полного, а в 2-х последующих неполного адъюванта Фрейнда. Для однократного введения одному животному использовали 500 мкг рекомбинантного TNF- в виде телец включения в суспензии в физиологическом растворе объемом 300 мкл. Кровь отбирали из хвостовой вены. Для дальнейшего анализа использовали цельную сыворотку, образовавшуюся после отделения естественного фибринового сгустка.

ДНК-имунизация В настоящее время не существует общепринятого протокола иммунизации животных ДНК. В нашей работе для решения этой задачи использовалась следующая экспериментальная методика:

ДНК-иммунизация крыс Крысы были проиммунизированы внутримышечно 3 раза с интервалом дней. При однократной инъекции одному животному вводили 300 мкг ДНК, растворенной в 300 мкл физиологического раствора. Кровь отбирали из хвостовой вены. Для анализов использовали цельную сыворотку.

ДНК-иммунизация кролика Кролик был проиммунизирован внутримышечно 3 раза конструкцией pCDTNF3 и 4 раза конструкцией pCD-TNF4 c интервалом 14 дней. При однократной инъекции животному вводили 1 мг ДНК, растворенной в 1 мл физиологического раствора. Кровь отбирали из ушной вены.

Получение TNF- и тестирование его активности in vitro TNF- человека был получен в результате экспрессии в E. coli. Метод получения рекомбинантных белков в E. coli технически прост и экономически доступен. Для получения биологически активного продукта рекомбинантный белок, предварительно полученный в виде телец включения, подвергают процедуре ренатурации.

В качестве теста, позволяющего оценивать корректность фолдинга при ренатурации TNF- in vitro была использована его способность к связыванию с экстраклеточным доменом рецептора TNFR1.

Получение экспрессионных конструкций TNFЭкзон-интронная структура человеческого гена TNF- была исследована на основании последовательности, депонированной в банке генов NCBI. Первичный транскрипт TNF-, кодируемый локусом в составе 6-ой хромосомы человека, содержит 4 экзона. Лидерная последовательность кодируется экзоном 1 и частью экзона 2, зрелый TNF- кодируется 3 экзонами, из которых первые 2 имеют незначительную длину, кодируя в сумме лишь 19 аминокислот. Сходную экзонинтронную структуру имеют многие другие гены секреторных белков эукариот, в том числе ростовые факторы GM-CSF [NCBI X03020], фоллистатин [NCBI AH001463], инсулиноподобный фактор роста IGF1Еа [NCBI E01351].

Сборку гена, кодирующего зрелую форму TNF-, проводили, комбинируя клонирование ПЦР-амплификата и сборку ДНК из синтетических олигонуклеотидов. Для клонирования ПЦР-фрагмента кодирующей области, соответствующего экзону 3 геномного гена TNF-, была подобрана пара праймеров TNF3 и TNF5. Продукт ПЦР, полученный с использованием этой пары праймеров на матрице геномной ДНК человека, имел размер 436 п. н. Амплифицированный фрагмент был клонирован в экспрессионный вектор pET23a, в результате чего была получена промежуточная конструкция pTNF-1.

Недостающие в конструкции pTNF-1 два экзона были получены ферментативной достройкой пары частично комплементарных синтетических олигонуклеотидов (Рис. 1).

Синтетическая Рис. 1. Схема сборки экспрессионной конструкции pTNF5 на базе вектора pET23а под контролем индуцибельного промотора Т Существуют наблюдения, свидетельствующие о значительном влиянии на эффективность трансляции 5’-концевых кодонов, располагающихся в составе мРНК непосредственно вблизи старта трансляции [Патрушев, 2000]. C учетом этого обстоятельства, восстанавливая участок кодирующей области, недостающий в составе конструкции pTNF-1, за счет клонирования синтетического ДНКдуплекса, мы заменили первые 5 кодонов гена человека на синонимичные им кодоны, предпочтительно использующиеся в E. coli.

Val, следующий за N-концевым остатком Met, в природном человеческом гене в составе полусинтетического гена был заменен на Met. Следующий Arg кодировался бы чрезвычайно редким для E. coli кодоном AGA (Рис. 2). В результате сборки полусинтетического гена TNF- в составе конструкции pTNF кодон AGA был заменен на CGC, что не сказалось на аминокислотном составе продукта, но, потенциально могло привести к повышению уровня синтеза рекомбинантного белка в клетках E. coli. Следующие 3 кодона (Ser, Ser, Ser) также были заменены на синонимичные. Синтетический фрагмент был внесен в состав конструкции pTNF-1, в результате чего получена конструкция pTNF5, кодирующая зрелый вариант TNF- человека. Таким образом, был получен полусинтетический ген TNF- ожидаемого размера 490 п. н.

NdeI 1. agatcatcttctcgaaccccgagtgacaagcctgtagcccatgttgtagca 2.catatggtccgcagcagcagccgcaccccgagtgacaagcctgtagcccatgttgtagcga

3. MMRSSSRTPSDKPVAHVVA

Pис. 2. Фрагмент последовательности полусинтетического гена TNF- человека вблизи начала транслируемой области; 1) природный ген человеческого TNF-;

2) полусинтетический ген; 3) аминокислотная последовательность, получаемая при трансляции как природного, так и полусинтетического генов. Цветом отмечены нуклеотиды в природном гене, подвергшиеся замене в составе полусинтетического гена Продукция и очистка рекомбинантного TNFПо результатам анализа телец включения из биомассы соответствующих рекомбинантных штаммов, обе конструкции pTNF-1 и pTNF5 в условиях индукции ИПТГ (изопропил--тиогалактозид) вызывали накопление целевых белковых продуктов в клетках E. coli. Тем не менее, при экспрессии конструкции pTNF-1 в E. coli удалось получить соответствующий белковый продукт. При этом участок, отсутствующий в продукте pTNF-1 по сравнению с полноразмерным зрелым TNF-, не составляет отдельного глобулярного домена. Уровень продукции усеченного белка в нашей системе составлял 70-90 мг/л. Полноразмерный зрелый белок - продукт конструкции pTNF5 - также эффективно синтезировался в использованной системе. При этом уровень его продукции в различных экспериментах можно оценить на уровне 50-100 мг/л (Рис. 3).

Рис. 3. Накопление рекомбинантного TNF- в лизатах E. сoli. На дорожки нанесен: 1) суммарный лизат культуры, трансформированной pTNF5;

2) суммарный лизат культуры, трансформированной pTNF-1; 3) стандарты молекулярной массы. Целевые продукты отмечены стрелками В литературе приводится ряд данных об экспериментах по синтезу TNFчеловека в E. coli. Так, Шингаровой и соавт. [Шингарова и др.,1997] описана экспрессия TNF- под контролем промотора триптофанового оперона E. coli, причем продукт экспрессии накапливался в цитоплазме в растворимом виде, а не формировал тельца включения. Однако уровень экспрессии при этом оказывался невысоким. При этом выделение и очистка такого белка требовала нескольких стадий, что сказывалось на количественном выходе конечного продукта.

Синтез белка в нашей системе происходила под контролем индуцибельного промотора фага Т7. Поскольку ген ДНК-полимеразы фага Т7 в использованном нами штамме E. coli BL21(DE3) находился под контролем лактозоиндуцибельного промотора lac-tac, для запуска транскрипции в среду культивирования добавляли ИПТГ. При этом TNF- накапливался в виде телец включения с высоким выходом.

Следует отметить, что мы модифицировали протокол экспрессии по сравнению со стандартным [Palmer et al., 1995]. В настоящее время в литературе наиболее часто упоминается схема, при которой индуктор добавляется по достижении культурой оптической плотности A680=0.3-0.4. Мы обнаружили, что в разработанной нами системе ИПТГ может быть внесен одновременно с инокулятом, что это не сказывается на выходе белка, но позволяет сократить время ферментации.

Ренатурация TNFВ литературе описана экспрессия TNF- человека, а также его ренатурация из телец включения в лабораторных и полупромышленных условиях. Однако, конструктивные особенности нового продуцента, в том числе уровень продукции целевого продукта и состав среды культивирования, привели к качественному изменению свойств и химического состава исходного материала (телец включения), используемых для ренатурации. Исходя из этого, при разработке схемы ренатурации не были использованы подходы, ранее положительно зарекомендовавшие себя применительно к TNF-, а была выбрана методология, основанная на скрининге панели буферных растворов для ренатурации, и тех свойствах белка, которые могут быть рассчитаны на основании лишь известной аминокислотной последовательности. Из рассмотрения были исключены методы гель-фильтрации, диализа и другие, ограничивающие возможность широкого варьирования состава буферов или требующие значительных количеств обрабатываемого белка, что нежелательно на начальных этапах отработки методики.

На этапе подбора условий ренатурации применялся экспресс-протокол, включающий одноступенчатое разбавление аликвот телец включения, предварительно солюбилизированного в растворе хаотропного агента (6 М гуанидин-гидрохлорид), панелью из 15 различных буферных растворов. При этом часть панели была исключена из эксперимента путем сопоставления их рН с pI белка, подлежащего ренатурации: предполагается, что вблизи pI белок менее склонен к формированию агрегатов за счет ионных взаимодействий. С помощью пакета программ “DNA STAR” была рассчитана pI денатурированного TNFчеловека, составившая 7.28. С учетом этого результата из полной панели были отобраны только буферные растворы cо щелочными значениями pH (табл. 1).

Номер Компоненты и их концентрации буфера Табл. 1. Состав буферных растворов c pH=8.0, использованных для ренатурации рекомбинантного TNF-. Штриховкой отмечен буферный раствор, показывающий лучший результат; серым цветом отмечены буферные растворы с низким содержанием соли Состав буферных растворов, приведенный в Табл. 1, можно разделить на буферные растворы низкой (№1-4) и высокой ионной силы (№5-8). Концентрацию общего белка в суспензии телец включения определяли по модифицированному методу Лоури (нерастворимые в воде агрегаты предварительно растворяли в небольшом объеме 0.7 M NaOH, разбавляя затем стандартным раствором в 10 раз).

В ходе экспериментов было установлено, что ренатурация TNF- человека эффективно идет лишь в буферных растворах с высокой ионной силой, в остальных буферах основная масса белка агрегировала и удалялась из раствора при центрифугировании (Рис. 4). Буферный раствор №6, обеспечивший наилучший результат, содержал 240 мМ NaCl, 10 мМ КСl и 0.5% Triton X-100 (табл. 1). В то же время, высокая ионная сила буфера не является достаточным условием хорошего выхода ренатурации: так, для буфера 7 ионная сила не отличается от буфера 6 (Рис. 4 дорожка 8), в то же время, белок, ренатурированный в буфере 7, нестабилен при хранении в течение 7 дней при 4С, подвергаясь протеолизу (Рис. дорожка 9).

Рис. 4. SDS-PAAG электрофорез в 12.5% геле ренатурированного TNF. На дорожки нанесено (верхний ряд) (1)–стандарты молекулярной массы; (2)-белок TNF- до процедуры рефолдинга; (3-10)-белок, оставшийся в растворе после ренатурации 2.5 мкг (по общему белку) солюбилизированного материала телец включения в присутствии буферов 1-8 (нижний ряд) (табл. 1) Объясняя причину различной эффективности ренатурации TNF- в зависимости от условий среды, необходимо учитывать, что нативный TNFнаходится в растворе в форме тримера, что характерно для всех лигандов и рецепторов семейства TNF/TNF-R. Существуют данные о возможности аномального фолдинга TNF-, приводящего к формированию димерных молекул, вместо тримерных. Такой белок стабилен в растворе лишь непродолжительное время и не способен к спонтанному переходу в истинно нативную конформацию.

Экспрессия TNF-R1 в клетках Drosophila melanogaster Для тестирования функциональной активности TNF- человека, полученного экспрессией в E. coli в виде нерастворимого денатурированного белка и подвергнутого далее процедуре ренатурации, была разработана система, при которой предполагалось молекулярное взаимодействие как с моноклональными антителами, так и с нативным экстраклеточным доменом рецептора (ed-TNFR1).

Экстраклеточный домен рецептора I типа было решено получить в секреторном виде экспрессией в эукариотических клетках.

Клетки линии S2 Drosophila melanogaster практически идеально подходят для продукции растворимых форм рецепторов человека и высших млекопитающих, так как естественным образом адаптированы для секреции рекомбинантного белка с большим числом дисульфидных связей во внеклеточную среду, обеспечивая при этом их корректный фолдинг. В клетках насекомых белок продуцируется не только функционально активным, но и гликозилированным, что невозможно в случае экспрессии рекомбинантного продукта в прокариотических микроорганизмах.

Получение кДНК TNF-R1 и создание экспрессионной конструкции pMT-TNFR Экстраклеточная часть TNF-R1 кодируется в геноме человека 4 экзонами общей длиной 501 п.н., поэтому для создания продуцентов была клонирована кДНК, кодирующая этот белок. Хотя многие клетки организма чувствительны к TNF-, содержание в них рецепторов невелико, что осложняло задачу выделения препарата мРНК, пригодного для извлечения целевого транскрипта. В качестве источника кДНК TNF-R1 была выбрана мРНК из длительно поддерживаемой в культуре линии предшественников нормальных цитотоксических лимфоцитов человека CER43. Для увеличения уровня продукции TNF-R1 клетки CER подвергали стимуляции кокультивированием с облученными периферическими моноцитами крови человека в течение 10 суток. По окончании культивирования окрашивание красителем трипановым синим показало присутствие в культуре большого числа мертвых клеток CER43, что свидетельствовало о запуске апоптоза (клетки-мишени были уничтожены ранее за счет цитотоксической активности CER43).

Фрагмент ДНК длиной 501 п.н., полученный в результате ПЦР первой цепи тотальной кДНК из клеток CER43 после стимуляции, кодировал только экстраклеточный, но не трансмембранный и внутриклеточный домены TNF-R (Рис. 5).

PMT лидер кДНК TNF-R Рис. 5. Схема сборки конструкции pMT-TNFR1 под контролем медьиндуцибельного промотора металлотионеина В литературе имеются кристаллографические данные высокого разрешения, позволяющие судить о структуре экстраклеточного домена TNF-R1 (ed-TNFR1), состоящем из 167 а.о. Следует отметить, что ed-TNFR1 содержит внутримолекулярных дисульфидных связей. По обилию дисульфидных связей этот рецептор сходен со многими другими поверхностными трансмембранными рецепторами эукариот (Fas, KDR, ActRII). В связи с этим растворимые формы лиганд-связывающих доменов рецепторов с трудом поддаются ренатурации in vitro, следовательно, они только с низким выходом могут быть приведены в функционально активное состояние за счет использования стандартной технологии экспрессии в E. coli и рефолдинга продукта, извлеченного из телец включения.

Система экспрессии в клетках Drosophila позволяет получать растворимые формы рецепторов в нативной конформации и естественным гликозилированием, что может иметь значение при изучения взаимодействий рецептора с лигандом.

Учитывая эти соображения, фрагмент ДНК, кодирующий ed-TNFR1, был клонирован в вектор pMT/V5-His, предназначенный для экспрессии в клетках зародышевых линий дрозофилы под контролем индуцибельного медь-зависимого промотора металлотионеина. Данный промотор позволяет обеспечивать высокий уровень транскрипции и широко применяется для продукции рекомбинантных белков.

В результате клонирования была получена конструкция pMT-TNFR1, кодирующая рекомбинантный ed-TNFR1. В составе этого белка на С-конце экстраклеточного домена TNF-R1 вместо трансмембранного домена находился двухаминокислотный спейсер Thr-Gly и последовательность из шести остатков His.

Для обеспечения секреции ed-TNFR1 из клеток дрозофилы был использован собственный лидерный пептид TNF-R1.

Экспрессия конструкции pMT-TNFR1 в клетках Drosophila С целью получения клеточной линии S2, несущей интегрированную в геном копию плазмиды pMT-TNFR1, первичная культура трансфицированных клеток подвергалась селекции на устойчивость к гентицину (G418) в концентрации 500 мкг/мл в течение 6 недель. Параллельно с селекцией был проведен тест на способность частично обогащенной культуры к синтезу целевого продукта. Для этой цели из общего пула отбирали часть клеток, подвергшихся нескольким этапам селекции, и индуцировали их ионами двухвалентного металла (Cu2+). На 3-ий день после индукции отбирали образцы кондиционированной среды и анализировали наличие в них ed-TNFR1 с помощью ELISA.

Клетки Drosophila melanogaster после 6 недель селекции продуцировали edTNF-R1 в культуральную среду в виде 3-х полос близкой молекулярной массы, которые указывают на различную степень гликозилирования (Рис. 6).

Рис. 6. SDS-PAAG` электрофорез в 12.5% акриламидном геле продукции TNF-R1. 1стандарты молекулярной массы; 2-культуральная жидкость клеток Drosophila melanogaster, трансфицированных конструкцией pMT-TNFR1; 3-культуральная жидкость, сконцентрированная в 70 раз; 4-несвязавшаяся белковая фракция после Ni-NTA-сефорозы; 4-проскок; 5-промывка; 6-элюция (стрелками отмечен конечный продукт в разной степени гликозилирования) Экстраклеточный домен рецептора TNF типа 1 был очищен до гомогенного состояния с помощью 2-х стадийной процедуры: металло-хелатной хроматографией на Ni-NTA-сефарозе и гель-фильтрацией на Superdex HR-200.

В результате был получен продукт, двигающийся при денатурирующем электрофорезе в виде 3-х полос близкой молекулярной массы, что свидетельствовало о различной степени гликозилирования полипептидной цепи (Рис. 6).

Изучение эффективности взаимодействия ed-TNFR1 с рекомбинантным TNFчеловека и тестирование его функциональной активности in vitro Эффективность взаимодействия полученного ed-TNFR1 с человеческим TNF- была протестирована с помощью ELISA в сравнении с эффективностью взаимодействия моноклональных антител к TNF-. Полученные графики представлены на Рис. 7. Можно предположительно оценить аффинность ed-TNFR1, сопоставив ее с аффинностью моноклональных антител, исходя из утверждения об одновалентности иммобилизованного ed-TNFR1 и двухвалентности антитела.

Молекулярная масса ed-TNFR1 (20 кДа), что приблизительно в 6 раз меньше массы IgG (140 кДа). Следовательно, Mr одновалентного лиганд-связывающего центра edTNFR1 меньше Mr одновалентного антиген-связывающего центра IgG примерно в 3 раза. Таким образом, при сорбции на планшеты mAb2 и ed-TNFR1 в равных массовых концентрациях (5 мкг/мл), ed-TNFR1 находился в 3-х кратном молярном избытке по сравнению с mAb. Несмотря на это величина сигнала (A490) (Рис. 7), показывающая количество TNF-, связавшегося с рецептором, существенно больше в случае mAb, чем ed-TNFR1. Из представленных рассуждений можно сделать вывод о более высокой аффинности моноклональных антител к TNF- по сравнению с растворимым рецептором.

Рис. 7. Эффективность взаимодействия ренатурированного TNF- с моноклональными антителами и экстраклеточным доменом рецептора типа 1, протестированная методом ELISA3: 1 - связывание ренатурированного TNF и моноклональных антител (квадраты); 2 - связывание ренатурированного TNF- и его рецептора (треугольники) Данные, представленные на Рис. 7, позволяют сделать вывод о связывании TNF- как с моноклональными антителами, так и с нативным экстраклеточным доменом рецептора ed-TNF-R1 и, следовательно, о наличии у ренатурированного из телец включения TNF- естественной третичной структуры.

mAb – моноклональные антитела к TNFELISA – твердофазный иммуноферментный анализ рекомбинантным TNF- человека. Использование аффинно-очищенных антител для тестирования продукции TNF- в сыворотках больных рассеянным склерозом Иммунизация животных рекомбинантным продуктом, полученным при использовании конструкции pTNF5 в виде телец включения Получение антител к продукту того или иного вновь открытого гена с неизвестной функцией является распространенной задачей. Ее решение, однако, зачастую осложняется невозможностью эффективно ренатурировать продукт из телец включения. Эффективность ренатурации, в свою очередь, сдерживается сложностью ее оценки по функциональной активности. Таким образом, антитела, полученные против агрегированного нерастворимого белка, могут служить ценным инструментом на начальных этапах исследования локализации и функциональной активности вновь открытых генов и их продуктов. TNF- человека детально изучен в качестве антигена для иммунизации, поэтому он может рассматриваться в качестве удобного модельного объекта для изучения роли нативности антигена с точки зрения развития гуморального иммунного ответа.

В настоящей работе мы использовали в качестве антигена для иммунизации водную суспензию интактных телец включения, представляющих собой продукт конструкции pTNF5. Иммунизацию кролика проводили в три этапа по стандартной схеме, широко применяющейся при работе с разнообразными природными и рекомбинантными белками в нативной форме. При этом на каждой стадии иммунизации животным внутримышечно вводили 1 мг телец включения в виде суспензии в 1 мл физиологического раствора в смеси с полным адъювантом Фрейнда. Наличие продукции поликлональных антител в неочищенной кроличьей сыворотке протестировано вестерн-блоттингом с контрольным препаратом рекомбинантного TNF- человека (Reafan, Россия) (Pис. 8).

Поликлональную антисыворотку, полученную при иммунизации кролика тельцами включения, тестировали на способность связываться со специфическим антигеном в иммуноблоттинге. Было показано, что сыворотка без дополнительной очистки при разведении в 1500 раз избирательно реагирует с гомологичным антигеном (TNF-) в концентрациях не менее 2.5 нг в образце (Рис. 8), что свидетельствует о высокой аффинности полученных антител. Для проверки чувствительности в качестве антигена использовался контрольный препарат TNFчеловека.

Рис. 8. Тестирование эффективности распознавания ренатурированного TNF неочищенной кроличьей поликлональной антисывороткой.

На дорожки нанесены:

2) 2.5 нг TNFДля аффинной очистки фракции поликлональных антител против человеческого TNF- был предварительно синтезирован сорбент. 0.6 мг ренатурированного TNF- связали с 2 мл сефарозы, активированной BrCN.

Тестирование содержания TNF в сыворотках больных рассеянным и боковым амиотрофическим склерозом с помощью аффинноочищенных кроличьих поликлональных антител Боковой амиотрофический (BAS) и рассеянный склерозы (MS) – это серьезные нейродегенеративные заболевания, преимущественно аутоиммунной природы, распространенные преимущественно у людей старшей возрастной группы. Они характеризуются сложной клинической симптоматикой, и для их распознавания зачастую используют методы лабораторной диагностики, в том числе, иммунологические.

Методом вестерн-блоттинга с помощью аффинноочищенных кроличьих поликлональных антител сравнили сыворотки 3 больных MS и 3 больных BAS (биологический материал был любезно предоставлен М.Н. Захаровой ин-т неврологии, МЗСР РФ). В качестве контрольной группы служили с 6 сывороток клинически здоровых доноров (предоставлены МГЦ «СПИД»). Как показано на Рис. 9, при окрашивании аффинноочищенными антителами против TNFнаблюдается выраженное различие состава белков сыворотки крови больных с одной стороны MS, и BAS и здоровых доноров – с другой.

Рис. 9. Анализ состава белков крови больных рассеянным и боковым амиотрофическим склерозом, методом вестерн-блоттинга с аффинноочищенными кроличьими поликлональными антителами. На дорожки нанесен материал сывороток: 1-6-здоровых доноров, 7-9-сывороток больных BAS, 10-12-сывороток больных MS, 13 – стандарт, рекомбинантный TNF- человека (1 нг на дорожку) Следует отметить, что картина, наблюдаемая при иммунохимическом окрашивании перенесенных на мембрану сывороточных белков антителами против TNF- не отличается у здоровых людей и больных BAS, но в тоже время резко отличается в случае больных MS. На основании полученных данных можно сделать вывод о потенциальной пригодности полученных антител для идентификации больных заболеваниями MS в отличие от BAS в тех случаях, когда этого удается сделать по анализу клинической картины.

ДНК-доставка TNF- на животной модели in vivo с детекцией результата по выработке антител В ряде случаев введение экспериментальным животным или человеку ДНК, несущей ген какого-либо ростового фактора, как правило, не приводит к выбросу заметных количеств антигена в кровоток, обеспечивая лишь локальное накопление продукта в ограниченной области близи точки инъекции. В этой связи непосредственная детекция продукта, доставляемого с помощью синтеза in situ, технически сложна. Облегчить решение этой задачи возможно путем выявления специфических антител, вырабатывающихся в ответ на появившийся антиген.

Антитела вне зависимости от распределения антигена накапливаются в кровотоке и циркулируют в течение долгого времени, значительно превышающего время существования самого продукта эктопической экспрессии.

В ряде случаев антитела, полученные в ответ на ДНК-иммунизацию, могут представлять практическую ценность, так как они вырабатываются в ответ на антиген, синтезированный в естественной для него среде. Таким образом, могут быть исключены искажения иммунного ответа, связанные с неестественным фолдингом продукта в гетерологичной системе или in vitro, а также с загрязнением антигена примесными белками продуцента.

ДНК-иммунизация – это недавно появившийся и недостаточно апробированный метод. Основанная масса результатов по ДНК-иммунизации касается выработки ответа против вирусных антигенов, как с целью получения антител, так и для вакцинации. В данной работе было показано, что этот метод может быть применим и в отношении других типов белков-антигенов, в частности, секреторных сигнальных факторов животных. ДНК-иммунизация позволяет значительно сократить временные затраты на получение антигена для иммунизации. Это обстоятельство особенно в том случае, если получение рекомбинантного белка в традиционных экспрессионных системах затруднено (например, для мембранносвязанных белков).

ДНК-иммунизация крыс Для доставки ДНК in vivo было получено 2 генно-инженерных конструкции pCD-TNF3 и pCD-TNF4. В первой из них под контролем CMV находится ген, кодирующий зрелый TNF- человека без секреторного лидера, а во второй полный геномный ген TNF.

Схема их функциональных элементов конструкции представлена на Рис. 10.

Рис. 10. Схема генно-инженерных конструкций, использованных для ДНКиммунизации на базе вектора pC-DNA3; 1) pCD-TNF3, кодирующая зрелый TNF-;

2) pCD-TNF4, содержащая геномный (интронированный) вариант гена TNF-, кодирующая секретируемый вариант белка с лидерным пептидом (штриховкой отмечены экзоны) Предполагалось, что продукция антигена in vivo будет происходить под контролем СMV промотора, который обеспечивает высокий уровень конститутивной транскрипции. CMV промотор достаточно универсален, при этом от исследователей не требовалось изменять дизайн генно-инженерных конструкций при переходе от одной системы экспрессии in vivo к другой. Дизайн pCD-TNF4 предполагал, что продуцируемый in vivo антиген будет секретироваться в межклеточное пространство с помощью лидерного пептида; в случае pCD-TNF будет осуществляться внутриклеточная экспрессия, при этом антиген не секретируется, но может попасть в межклеточное пространство за счет случайной гибели трансфицированных клеток.

A(490нм) Рис. 11. Предварительное тестирование конструкций для ДНК-иммунизации на крысах. Иммунизация животных конструкцией: 1 - pCD-TNF4 (треугольники); 2 pCD-TNF3 (квадраты) Для предварительной проверки функциональности собранных конструкций крысы породы Wistar (самки) были проиммунизированы соответственно конструкциями pCD-TNF3 и pCD-TNF4 по стандартному протоколу, применяемому для белков: внутримышечно, с дозировкой ДНК 1 мг в 1 мл физиологического раствора на инъекцию. Уровень продукции человеческого TNF- тестировался путем титрования антисывороток в непрямом методе ELISA.

Полученные данные представлены на Рис. 11. При анализе полученных данных был сделан вывод о целесообразности использования в следующих опытах конструкции pCD-TNF3. В литературе встречаются данные о снижении выхода рекомбинантного белка в случае его секреции по сравнению с аналогичным белком, лишенным секреторного лидера и накапливающимся в цитоплазме.

Вероятно, этим можно объяснить трудности в продукции антител в случае pCDTNF4.

В следующем опыте 7 крыс породы Wistar (самки) были проиммунизированы раствором ДНК конструкции pCD-TNF3 по стандартной методике иммунизации описанной выше. В качестве положительного контроля животное подвергалось параллельной иммунизации рекомбинантным TNFчеловека. Уровень продукции поликлональных антител тестировался путем титрования сывороток в непрямом ELISA. На Рис. 12 представлены данные, показывающие уровень продукции поликлональных антител у отдельных животных.

Рис. 12. Продукция поликлональных антител у крыс, проиммунизированных pCDTNF3, протестированная методом ELISA; 1-3 животные, иммунизированные pCD-TNF3 (круги и квадраты). (Треугольники) - контрольное животное, иммунизированное рекомбинантным белком TNF-. По оси абсцисс отложено разведение сывороток крыс Из 7-ми иммунизированных животных достоверно на иммунизацию ДНК прореагировали только три (у остальных четырех животных максимальное значение A490, определяющееся уровнем продукции поликлональных антител, в ELISA практически не отличалось от фонового и на Рис. 12 не приведены). При этом уровень продукции поликлональных антител у двух из них оказался невысоким, а иммунный ответ третьего оказался высоким, превысив уровень положительного контроля (при иммунизации белком).

Рассматривая итоги ДНК-иммунизации крыс генно-инженерной конструкцией pCD-TNF3, кодирующей ген зрелого TNF- человека, можно сделать вывод о значительном разбросе результатов эксперимента. Необходимо отметить, что исходя из литературных данных, в ряде случаев иммунный ответ на ДНКиммунизацию проходит не по гуморальному пути, то есть путем продукции антител, которые тестировались в этом случае, а только по клеточному пути.

Объясняя недостаточную воспроизводимость эффекта, мы предположили, что ход иммунного ответа организма на иммунизацию зависит от тонкой гистологической структуры сайта введения ДНК в организм (близость региональных лимфоузлов, сосудов, фасций и т.д.). Однако, остается неясным, какой из факторов привел к резкому усилению эффекту в случае 1-oго животного (Рис. 12).

ДНК-иммунизация кролика Для эксперимента был взят один кролик, которого изначально троекратно проиммунизировали внутримышечно конструкцией pCD-TNF3, при этом при одной инъекции ему вводили 1 мкг ДНК. В отличие от крыс при иммунизации кролика оказалось возможным исследовать динамику продукции антител. После каждой инъекции ДНК сыворотка кролика тестировалась вестерн-блоттингом и ELISA на предмет появления антител против синтезировавшегося in vivo TNFчеловека. Следует отметить, что в результате иммунизации кролика конструкцией pCD-TNF3 сколько-нибудь значительной продукции антител получить не удалось.

После этого был сделан вывод о необходимости изменения протокола ДНКдоставки. Поэтому далее кролик был вторичной иммунизации конструкцией pCDTNF4. Уже после первой инъекции ДНК наличие антител против TNF- было подтверждено вестерн-блоттингом (Рис. 13).

Рис. 13. Тестирование продукции поликлональных антител в кроличьей ДНКиммунизационной сыворотке методом вестерн-блоттинга. Окрашивание мембран после переноса белков проведено a) преиммунной сывороткой; b) сывороткой, полученной после 2-кратной ДНК-иммунизации. На дорожки нанесены: 1,2 – клеточные лизаты E. coli BMH 71-18; 3) очищенный рекомбинантный TNF-.

Стрелкой отмечено расположение TNFОднако, несмотря на наличие антител по данным вестерн-блоттинга, при использовании этой сыворотки в постановке ELISA сколько-нибудь значительной продукции поликлональных антител зафиксировано не было (данные не приведены). Следует отметить, что этот факт оказался для несколько неожиданным, так как чувствительность одних и тех же антител в ELISA, как правило, выше, чем в вестерн-блоттинге. Объяснение этого явления, возможно, связано с особенностями эпитопной специфичности образующихся антител против TNF-. в случае ДНК-иммунизации.

По литературным данным динамика продукции антител при ДНКиммунизации принципиально отличается от сероконверсии при стандартной схеме иммунизации белком. Ответ на ДНК-иммунизацию характеризуется небольшим максимумом после первой или второй инъекции ДНК, затем титр антител падает до нуля, и только через определенное время при условии продолжения инъекций ДНК претерпевает подъем. В настоящий момент не предложено модели, которая может адекватно объяснить такое поведение аппарата синтеза антител при ДНКиммунизации.

Подобный эффект наблюдался и в настоящей работе. После двух следующих инъекций pCD-TNF4 продукция поликлональных антител не наблюдалась ни в вестерн-блоттинге, ни в ELISA.

После 4-ой инъекции pCD-TNF4 в сыворотке животного появились антитела, реагирующие с рекомбинантным антигеном не только в вестерн-блоттинге, но и в ELISA. Результаты испытаний этой сыворотки приведены на Рис. 14.

Рис. 14. Тестирование активности сывороток кролика после четырех инъекций pCD-TNF4 методом непрямого ELISA. Серые столбцы-А490, характеризующее продукцию поликлональных антител с экспериментальной иммунной сывороткой;

черные столбцы-A490, характеризующее отсутствие сигнала преиммунной (контрольной) сыворотки того же животного Делая вывод о результатах эксперимента по ДНК-доставке TNF- человека в ткани крыс и кролика, можно, прежде всего, отметить возможность использования предложенного нами дизайна генно-инженерных конструкций для получения внутриклеточной экспрессии белка in vivo, при условии, что детекция продукта осуществляется по уровню продукции поликлональных антител против него.

Однако следует отметить высокий разброс получаемых результатов, что, в конечном итоге, снижает перспективность ДНК-иммунизация как метода, альтернативного типовой иммунизации рекомбинатным белком.

Продукция антител, вызванная инъекциями животным конструкции pCDTNF3, которая рассчитана на внутриклеточную продукцию белка, в ряде случаев была выше, чем продукция антител, вызванная инъекциями рекомбинантного антигена. Продукция поликлональных антител после инъекций животным конструкции pCD-TNF4, дизайн которой предполагал секрецию кодируемого гена in vivo, отличалась большей стабильностью, но в ряде случаев показывала эффект несколько худший по сравнению с pCD-TNF3. В качестве возможного приема, позволяющего минимизировать риск неудачи при ДНК-иммунизации целесообразно планировать одновременное введение ДНК конструкций обоих типов.

Благодарности Автор работы выражает искреннюю благодарность: к.б.н. С. П. Домогатскому (Кардиологический центр им. Л.А. Мясникова), Ю. Сикулеву (Kimmel Cancer Center, Philadelphia, USA), В. Филичкиной (Кардиологический центр им.

Л.А. Мясникова), M. Безрученкову (Кардиологический центр им. Л.А. Мясникова).

1. Созданы генно-инженерных конструкции для доставки растворимого TNFчеловека в клетки млекопитающих в секреторной и внутриклеточной форме, в том числе, для проведения ДНК-иммунизации. Впервые показана возможность доставки TNF- в организм млекопитающих с помощью плазмидных конструкций.

2. Получен гуморальный ответ против синтезированного in vivo TNFчеловека, доставляемого с помощью ДНК-иммунизации. Подтверждено ранее сделанное наблюдение о двухфазной динамике сероконверсии специфических антител в ответ на ДНК-иммунизацию у кролика.

3. На основе E. coli получен новый штамм-продуцент TNF- человека и предложена методика ренатурации TNF из телец включения.

4. В результате экспрессии в клетках Drosophila melanogaster получен экстраклеточный домен высокоаффинного рецептора TNF- типа 1. Показано связывание рецептора и лиганда in vitro, что подтверждает нативность структуры TNF-, приобретенной в результате ренатурации.

5. Показана перспективность использования поликлональных аффинноочищенных антител против TNF для исследования клинических материалов, в том числе, сывороток больных рассеянным и боковым амиотрофическим склерозами.

Список работ, опубликованных по теме диссертации:

1. Суровцева Е.В., Кузнецова Т.В., Шевелев А..Б. Использование рекомбинантной технологии для изучения взаимодействия рецепторов и их лигандов на примере TNF и TNFR1. // Тезисы. Перспективные направления физико-химической биологии и биотехнологии. Москва, стр. 72.

2. Суровцева Е.В., Кузнецова Т.В., Хоменков В.Г., Домогатский С.П., Шевелев А.Б. Новый штамм-продуцент фактора некроза опухолей человека на основе E.coli. // Биоорганическая химия. 2005, 5, С 1- 3. Суровцева Е.В., Аникеева Н., Сикулев Ю., Шевелев А.Б. Получение растворимой формы рецептора фактора некроза опухоли человека путем экспрессии в клетках Drosophila. // Молекулярная генетика, микробиология и вирусология. 2005, 3, С 34-

 
Похожие работы:

«Попова Анна Михайловна ЛУГОВАЯ РАСТИТЕЛЬНОСТЬ ПОЙМЫ СРЕДНЕГО ТЕЧЕНИЯ РЕКИ ВЫЧЕГДА 03.00.05 – ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Сыктывкар 2008 Работа выполнена на кафедре ботаники ГОУ ВПО Сыктывкарский государственный университет. Научный руководитель : кандидат биологических наук, доцент ШУШПАННИКОВА Галина Сергеевна Официальные оппоненты : доктор биологических наук, старший научный сотрудник МАРТЫНЕНКО Вера Антоновна...»

«БАХАРЕВА ИРИНА ЮРЬЕВНА ИЗМЕНЕНИЕ ЭКОЛОГИЧЕСКИХ УСЛОВИЙ НА ГАРЯХ В ЛЕНТОЧНЫХ БОРАХ АЛТАЙСКОГО КРАЯ В ЗОНАХ СУХОЙ И УМЕРЕННО-ЗАСУШЛИВОЙ КОЛОЧНОЙ СТЕПИ 03.02.08 – экология Автореферат диссертации на соискание учёной степени кандидата биологических наук Барнаул – 2009 2 Работа выполнена на кафедре экологии ГОУ ВПО Алтайский государственный университет Научный руководитель : доктор сельскохозяйственных наук, профессор Трофимов Иван Тимофеевич Официальные оппоненты : доктор...»

«РАХИМОВ Ильгизар Ильясович АВИФАУНА СРЕДНЕГО ПОВОЛЖЬЯ В УСЛОВИЯХ АНТРОПОГЕННОЙ ТРАНСФОРМАЦИИ ЕСТЕСТВЕННЫХ ПРИРОДНЫХ ЛАНДШАФТОВ Специальность 03.00.16 - экология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Москва - 2002 Работа выполнена на кафедре зоологии и экологии биолого-химического факультета Московского педагогического государственного университета Научный консультант : доктор биологических наук, профессор КонстантиновВ.М....»

«ХАМАЕВ АЙРАТ АХКЫЯМОВИЧ ВОДНЫЙ РЕЖИМ, ЗАСУХОУСТОЙЧИВОСТЬ И ПРОДУКТИВНОСТЬ РАЗЛИЧНЫХ ЭКОТИПОВ ЯРОВОЙ ПШЕНИЦЫ В УСЛОВИЯХ СЕВЕРНОЙ ЛЕСОСТЕПИ СРЕДНЕГО ПОВОЛЖЬЯ, 06.01.09 - растениеводство 03.01.09 - физиология и биохимия растений Автореферат диссертации на соискание ученой степени кандидата сельскохозяйственных наук Казань - 2003 Диссертационная работа выполнена на кафедре ботаники и физиологии растений Казанской государственной сельскохозяйственной академии в 2000-2003 гг....»

«СИМОНОВИЧ ЕЛЕНА ИЛЬИНИЧНА ЭКОЛОГИЧЕСКИЕ АСПЕКТЫ ПРИМЕНЕНИЯ БИОЛОГИЧЕСКИХ АКТИВИЗАТОРОВ ПОЧВЕННОГО ПЛОДОРОДИЯ 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Ростов-на-Дону - 2011 2 Работа выполнена на кафедре зоологии и в НИИ Биологии Южного Федерального университета доктор биологических наук, профессор Научный консультант : Казадаев Анатолий Анисимович доктор биологических наук, профессор Официальные оппоненты :...»

«ПЕРЕВОЗОВ Александр Георгиевич ИЗМЕНЕНИЯ СООБЩЕСТВ ГНЕЗДЯЩИХСЯ ПТИЦ ВДОЛЬ ВЫСОТНОГО ГРАДИЕНТА НА ЗАПАДНОМ КАВКАЗЕ 03.02.08 – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону – 2010 2 Работа выполнена на кафедре экологии и защиты окружающей среды ГОУ ВПО Майкопский государственный технологический университет доктор биологических наук, профессор Научный руководитель : Акатов Валерий Владимирович доктор...»

«Спасик Светлана Евгеньевна ТОЛЕРАНТНОСТЬ ПЧЕЛ APIS MELLIFERA L. К КИСЛОРОДНОМУ ГОЛОДАНИЮ Специальности 03.02.08 – Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Балашиха 2014 Работа выполнена в ФГБОУ ВПО Российский государственный аграрный заочный университет Научный руководитель : доктор биологических наук Еськова Майя Дмитриевна Официальные оппоненты : Маннапов Альфир Габдуллович, доктор биологических наук, профессор, ФГБОУ ВПО...»

«РАЧЕНКО МАКСИМ АНАТОЛЬЕВИЧ ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ СОРТОВ ЯБЛОНЬ В УСЛОВИЯХ ЮЖНОГО ПРЕДБАЙКАЛЬЯ Специальность 03.02.01 – ботаника (биологические наук и) 03.02.08 – экология (биологические науки) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ, 2011 Работа выполнена в ФГБОУ ВПО Иркутской государственной сельскохозяйственной академии Научный руководитель : кандидат биологических наук, доцент Худоногова Елена Геннадьевна...»

«ВАЛЕЕВА РАУЗА ТИМУРОВНА ИНТЕНСИФИКАЦИЯ ПРОИЗВОДСТВА КОРМОВЫХ ДРОЖЖЕЙ НА ОСНОВЕ СПИРТОВОЙ БАРДЫ 03.00.23 – Биотехнология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата технических наук Казань - 2007 Работа выполнена на кафедре химической кибернетики Казанского государственного технологического университета Научный руководитель : кандидат технических наук Мухачев Сергей Германович Официальные оппоненты : доктор технических наук, профессор Решетник Ольга...»

«ИВАНЕНКОВ ЯН АНДРЕЕВИЧ МОДЕЛИРОВАНИЕ БИОЛОГИЧЕСКОЙ АКТИВНОСТИ НИЗКОМОЛЕКУЛЯРНЫХ ОРГАНИЧЕСКИХ СОЕДИНЕНИЙ С ПРИМЕНЕНИЕМ КОМПЬЮТЕРНЫХ МЕТОДОВ АНАЛИЗА МУЛЬТИПАРАМЕТРИЧЕСКИХ ДАННЫХ 03.01.04 – Биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Уфа – 2010 Работа выполнена в Исследовательском институте химического разнообразия (ИИХР) совместно с Учреждением Российской академии наук Институт физиологически активных веществ РАН (ИФАВ РАН) Научный...»

«АНДРЕЕВА Алевтина Сергеевна ЖУКИ-ЛИСТОЕДЫ (COLEOPTERA: CHRYSOMELIDAE) БЕЛГОРОДСКОЙ ОБЛАСТИ: ФАУНА, ЭКОЛОГИЯ, ХОЗЯЙСТВЕННОЕ ЗНАЧЕНИЕ 03.02.08 – Экология Автореферат диссертации на соискание учёной степени кандидата биологических наук Белгород – 2014 Работа выполнена на кафедре биоценологии и экологической генетики ФГАОУ ВПО Белгородский государственный национальный исследовательский университет Научный руководитель : доктор биологических наук, доцент Присный Александр...»

«Розломий Наталья Геннадьевна Зелёная зона г. Уссурийска Приморского края (состояние естественных и искусственных насаждений, оптимизация рекреационного лесопользования) 03.02.14 – биологические ресурсы Автореферат диссертации на соискание учёной степени кандидата биологических наук Владивосток 2010 2 Работа выполнена в Институте лесного и лесопаркового хозяйства Федерального государственного образовательного учреждения высшего профессионального образования Приморская...»

«Красникова Мария Сергеевна ИЗУЧЕНИЕ РАЗНООБРАЗИЯ И ЭВОЛЮЦИИ ГЕНОВ TAS3, КОДИРУЮЩИХ ПРЕДШЕСТВЕННИКИ ta-siРНК У НЕЦВЕТКОВЫХ НАЗЕМНЫХ РАСТЕНИЙ И ОСОБЕННОСТИ ИХ ЭКСПРЕССИИ У НЕКОТОРЫХ ПОКРЫТОСЕМЕННЫХ 03.01.03 - молекулярная биология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва 2013 Работа выполнена в отделе эволюционной биохимии НИИ физико-химической биологии имени А.Н.Белозерского Федерального государственного бюджетного...»

«Краснопевцева Виктория Михайловна ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ВЕСЕННИХ ЭФЕМЕРОИДОВ - РЕЛИКТОВЫХ ВИДОВ РАСТЕНИЙ ХРЕБТА ХАМАР-ДАБАН (ЮЖНОЕ ПРИБАЙКАЛЬЕ) 03.00.05. – ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ 2007 Работа выполнена в Байкальском государственном биосферном природном заповеднике. доктор биологических наук, профессор Научный руководитель : Намзалов Бимба-Цырен Батомункуевич доктор биологических наук,...»

«Дымшакова Ольга Сергеевна ЕСТЕСТВЕННАЯ И ИСКУССТВЕННАЯ ГИБРИДИЗАЦИЯ В КОМПЛЕКСЕ SAXIFRAGA CERNUA L. – S. SIBIRICA L. НА УРАЛЕ 03.00.05 – ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Екатеринбург – 2010 Работа выполнена в Учреждении Российской академии наук Институте экологии растений и животных Уральского отделения РАН Научный руководитель : доктор биологических наук Семериков Владимир Леонидович Официальные оппоненты : доктор...»

«Иванищева Елизавета Александровна ЛАНДШАФТНО-БИОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ ЭКОЛОГИЧЕСКОГО КАРКАСА СЕВЕРО-ЗАПАДА ВОЛОГОДСКОЙ ОБЛАСТИ 03.02.08. – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Владимир – 2013 Работа выполнена в лаборатории моделирования экосистем Федерального государственного бюджетного учреждения науки Институт физико-химических и биологических проблем почвоведения Российской академии наук Научный руководитель...»

«Ситников Максим Николаевич ГЕНЕТИЧЕСКИЙ АНАЛИЗ МУТАНТНЫХ ЛИНИЙ САХАРНОЙ КУКУРУЗЫ Специальности: 03.00.15 – Генетика 06.01.05 – Селекция и семеноводство АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Санкт-Петербург – 2006 Диссертационная работа выполнена на кафедре общей генетики, селекции и семеноводства биологического факультета КБГУ им Х.М. Бербекова. Научный руководитель : доктор биологических наук, профессор М.К. Керефова Официальные...»

«Каюкова Светлана Николаевна ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ВИДОВ РОДА OROSTACHYS FISCH. В ВОСТОЧНОМ ЗАБАЙКАЛЬЕ 03.00.05 - ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Улан-Удэ 2009 Работа выполнена в Забайкальском государственном гуманитарнопедагогическом университете им. Н.Г. Чернышевского доктор биологических наук, профессор Научный руководитель : Бэлла Иванова Дулепова Официальные оппоненты : Татьяна Петровна Анцупова, доктор...»

«ДИДАНОВА ЕЛЕНА НАЖМУДИНОВНА ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА И КАДАСТРОВАЯ ОЦЕНКА ПОЧВ ЛЕСОСТЕПНОЙ ЗОНЫ КАБАРДИНО-БАЛКАРСКОЙ РЕСПУБЛИКИ РОССИЙСКОЙ ФЕДЕРАЦИИ 03.00.27 – почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону 2008 2 Работа выполнена на кафедре почвоведения, агрохимии и физиологии растений Кабардино-Балкарской государственной сельскохозяйственной академии имени В.М. Кокова Научный руководитель : доктор...»

«ДЕМИНА Татьяна Степановна БИОЭКОЛОГИЯ РОСОМАХИ (Gulo gulo L.) И ОСОБЕННОСТИ ЕЕ РАЗВЕДЕНИЯ В НЕВОЛЕ 03.02.08 – экология, 06.02.09 – звероводство и охотоведение Автореферат диссертации на соискание ученой степени кандидата биологических наук Балашиха - 2011 1 Работа выполнена на кафедре экологии и охотоведения ФГОУ ВПО Российс кий г суд арственн ы й аг ар ны й з н ы й унив рситет ао Научные руководители: доктор биологических наук Новиков Борис Владимирович, доктор биологических...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.