WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Татаринова Ольга Николаевна

Конструирование белок-нуклеиновых комплексов

для направленного транспорта в клетки чужеродной ДНК

03.01.04 – Биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва – 2010

Работа выполнена в Федеральном государственном учреждении «Научноисследовательском институте физико-химической медицины» Федерального медико-биологического агентства России Научные руководители:

доктор химических наук, доцент Позмогова Галина Евгеньевна

Официальные оппоненты:

доктор биологических наук Торховская Татьяна Ивановна (ФГУ «НИИ ФХМ» ФМБА России) кандидат химических наук Липкин Алексей Валерьевич (РНЦ "Курчатовский институт")

Ведущая организация: Институт молекулярной биологии им. В.А. Энгельгардта РАН

Защита диссертации состоится «» _ 2010 года в _ часов на заседании Диссертационного Совета Д 208.057.01 при ФГУ «НИИ ФХМ» ФМБА России по адресу: 119435, Москва, Малая Пироговская д. 1А

С диссертацией можно ознакомиться в библиотеке ФГУ «НИИ ФХМ» ФМБА России

Автореферат разослан «» 2010 года

Ученый секретарь Диссертационного Совета доктор биологических наук Мурина М.А.

Общая характеристика работы

Актуальность работы. Одной из задач современной генотерапии является избирательная доставка в клетки чужеродного генетического материала. Это связано в первую очередь со спецификой его применения в качестве терапевтического агента. Уникальные адресующие свойства показаны для белковых переносчиков ДНК (Rusconi S., 2000; Uherek C., 2000), интерес к которым особенно возрос в связи с открытием новых перспективных свойств олигонуклеотидов (антисмысловые олигомеры, аптамеры, ДНК/РНК гибриды, siRNA и др.). Представленная работа развивает подход к конструированию самоорганизующихся белковонуклеиновых молекулярных ансамблей, способных избирательно интернализоваться клетками-мишенями и обеспечивать взаимодействие нуклеиновой компоненты с внутриклеточными целями. Избирательность таких комплексов в отношении целевых клеток обеспечивается взаимодействием рецепторсвязывающего домена белковой компоненты с тканеспецифичными поверхностными рецепторами или рецепторами клеток-мишеней, а интернализация – рецепторопосредованным эндоцитозом.





На сегодняшний день существуют различные подходы к формированию многофункциональных биополимерных структур. На рис. 1 А показана схема мультидоменного функционального комплекса, состоящего из лиганда, отвечающего за узнавание поверхности и обеспечивающего транспорт посредством рецеп- Рис. 1. Схема конструирования белок-нуклеиновых комплексов: А – мультидоменный рекомбинантный белок в тор-опосредованного энкомплексе с ДНК; Б – комплекс, состоящий из металличедоцитоза, ДНК- ской наночастицы и адсорбированных на ее поверхности функциональных доменов белков и ДНК.

связывающего домена с нуклеиновой компонентой или непосредственно ДНК (ковалентные ДНКбелковые конъюгаты) и возможных дополнительных доменов – эндосомолитических единиц токсинов, сигнальных последовательностей и т.д. Другим подходом может служить конструирование функциональных комплексов на основе твердых платформ, например металлических наночастиц (рис. 1 Б). В этом случае все домены непосредственно сорбируются на поверхности за счет различных взаимодействий. Однако необходимо доказать, что при сорбции молекул их свойства сохранились, так, ДНК должна сохранять возможность к гибридизации, белки – сохранять структуру и т.д.

С точки зрения практической медицины особый интерес представляют активно пролиферирующие клетки – эмбриональные, стволовые и опухолевые, для которых характерна суперэкспрессия рецепторов факторов роста и альфафетопротеина (АФП) (Abelev G.I., 1971; Mizejewski G.J., 1985). АФП и его фрагменты успешно использовались ранее для создания средств направленной доставки антибиотиков в опухолевые клетки (Гороховец Н.В., 2006). Обнадеживающие результаты были получены и при in vitro испытаниях конъюгатов нативного АФП с тиофосфорильными антисмысловыми олигонуклеотидами, а также для комплексов полилизинового производного АФП, выделенного из ретроплацентарной сыворотки рожениц, с ДНК (Посыпанова, Г.А., 2005).

Конструирование и исследование функциональных белок-нуклеиновых комплексов на поверхности металлических частиц является одним из направлений в поиске новых материалов, обладающих заданными функциональными свойствами, что является одной из актуальных задач нанотехнологии. В сравнении с ранее описанными платформами, наночастицы никеля обладают рядом привлекательных свойств, обусловленных их электропроводными и магнитными характеристиками, а также уникальной способностью удерживать гистидинилированные белки (Becerril, H., 2006, Лазарев, В.Н., 2007), поэтому их использование в биосенсорах и диагностических системах представляет значительный интерес.

Особенно важно в этой связи изучить условия образования комплексов и подтвердить целостность и функциональность молекул в их составе.

Цель работы состоит в конструировании, получении и исследовании свойств функциональных нуклеопротеиновых комплексов, а также их ассоциатов с наноразмерными частицами никеля.





Для выполнения работы были поставлены следующие задачи.

1. Конструирование на основе альфа-фетопротеина новых белков-векторов, способных ассоциироваться с олигонуклеотидами, их аналогами, а также с плазмидной ДНК для избирательной доставки генетического материала в целевые клетки.

2. Получение экспрессирующих конструкций, штаммов-продуцентов рекомбинантных белков, наработка целевых полипептидов, подтверждение их первичной структуры, исследование комплексообразования с ДНК и транспортных свойств полученных нуклеопротеиновых ассоциатов.

3. Исследование способности наноразмерных частиц никеля ассоциироваться с молекулами олигонуклеотидов и гистидинилированных белков, подтверждение целостности и функциональности биополимеров в составе комплексов с никелем.

4. Оптимизация методов ВЭЖХ-очистки олигонуклеотидов фосфодиэфирной, тиофосфорильной природы и несущих метки, а также антисмысловых олигонуклеотидов, таких как TMO (telomere-mimic oligonucleotide, фрагмент теломерной ДНК, подавляющий экспрессию гена теломеразы), AS1 (подавляющий экспрессию проонкогена C-myc) и др., структура которых затрудняет очистку по стандартным протоколам.

Научная новизна и практическая значимость. На сегодняшний день не существует универсальных избирательных систем доставки ДНК в целевые клетки. Высокий уровень интернализации чужеродного генетического материала достигается при использовании различных подходов, например липофекцией, но в данном случае речь не идет об избирательном транспорте. В то же время нет данных о том, какого количества трансформированных клеток необходимо добиться для достижения терапевтического эффекта, однако ряд экспериментов свидетельствует о том, что эффективной оказывалась трансформация лишь 5-10% пораженных клеток (Kay M.A., 2000). Использование механизма рецепторопосредованного эндоцитоза позволяет решить ряд проблем, связанных как с избирательностью доставки, так и с безопасностью его применения в целом. В представленной работе впервые получены 3 рекомбинантных белковых вектора на основе фрагмента альфа-фетопротеина. Экспонирование рецепторов АФП на поверхности клеток служит одним из надежных маркеров ряда опухолей (Abelev G.I., 1971). Новые белковые векторы имеют 2-х доменную структуру: 1) рецептороспецифичный домен (фрагмент альфа-фетопротеина), отвечающий за узнавание комплекса определенной поверхности и обеспечивающий транспорт комплекса посредством рецептор-опосредованного эндоцитоза, 2) ДНК-связывающий домен, представленный различными олигокатионными последовательностями.

Показано, что полученные рекомбинантные белки самопроизвольно ассоциируются с олигонуклеотидами, олигонуклеотидными дуплексами и плазмидной ДНК с образованием стабильных комплексов, способных избирательно интернализоваться клетками, несущими рецепторы АФП. Избирательность полученных нуклеопротеиновых комплексов подтверждена in vitro экспериментами с целевыми и рецептордефицитными (контрольными) клеточными культурами. Универсальность белковых векторов в отношении переносимого генетического материала подтверждена как исследованием взаимодействий белков с олигомерами, дуплексами и плазмидной ДНК, так и экспериментами по доставке с их помощью известных антисмысловых к таким ключевым генам канцерогенеза, как ген теломеразы и C-myc, олигонуклеотидов тиофосфорильной природы. Полученные результаты важны для понимания механизмов образования и изучения взаимодействий молекулярных ДНК-белковых ансамблей. Новые белки могут стать универсальной основой для разработки эффективных высокоизбирательных геннаправленных противоопухолевых лекарств.

В настоящей работе на примере полученных новых рекомбинантных белков на основе АФП исследовано образование протеин-никелевых ассоциатов. В работе продемонстрирована принципиальная возможность и перспективность использования наночастиц никеля для формирования многофункциональных биополимерных структур, а также их преимущества в сравнении с другими наноразмерными основами. Показана способность агрегатов наночастиц никеля ассоциироваться с фрагментами однонитевых ДНК с образованием стабильных комплексов.

Впервые показано, что в составе комплексов молекулы биополимеров не деградированы и могут частично или полностью сохранять функциональные свойства, это создает основу для их использования, например, в системах селекции аффинных к белкам аптамеров. Полученные результаты вносят вклад в создание новых биополимер-никелевых наноструктур – исследовательских и диагностических инструментов в области молекулярной наноэлектроники, биологии и медицины.

Апробация работы. Основные положения диссертационной работы доложены и обсуждены на расширенном межлабораторном заседании Отдела молекулярной биологии и генетики ФГУ «НИИ физико-химической медицины» ФМБА России (Москва, 12 ноября 2009 года), а так же в ходе следующих конференций:

III Международная конференция "Фундаментальные науки – медицине" (Новосибирск, 2007), IV Съезд российского общества биохимиков и молекулярных биологов (Новосибирск, 2008), Международная конференция студентов, аспирантов и молодых ученых «Ломоносов» (Москва, 2008), 1-й Международной научной школе Нано-2009 (Москва, 2009), Конференция молодых ученых НИИ ФХМ (Москва, 2009).

Публикации по теме диссертационной работы. По теме диссертации автором опубликовано 3 статьи в рецензируемых журналах из списка ВАК, результаты работы представлены на 5 конференциях.

Структура и объем работы. Диссертация состоит из введения, обзора литературы, материалов и методов исследования, результатов и их обсуждения, заключения, выводов, приложения и списка литературы. Работа изложена на страницах печатного текста, содержит 14 рисунков. Список литературы включает 190 источников.

Материалы и методы.

Клеточные линии, бактериальные штаммы и плазмидные векторы.

В работе были использованы клетки линии DU 145 (human prostate carcinoma), SCOV3 (ovarian carcinoma), наличие в которых рецепторов AFP подтверждали по взаимодействию с флуоресцентным AFP, и лимфоциты, а также бактериальные штаммы E. coli DH5 (F- 80lacZM15 (lacZYA-argF) U169 recA endA1 hsdR17 (rk-, mk+) phoA supE44 - thi-1 gyrA96 relA1) (Life Technologies, Великобритания), B834 (DE3)(F– ompT hsdSB(rB– mB–) gal dcm met (DE3)) (Novagen, США), BL21(DE3)pLysS (F– ompT hsdSB(rB– mB–) gal dcm (DE3), pLysS, Cmr (Promega), плазмидные векторы pGEM-Т/easy (Promega, США), pET-15b, pET-28b (Novagen, США), pRC-CMV (Invitrogen, США).

Наночастицы никеля.

Наночастицы никеля (20 нм) получены в Институте энергетических проблем химической физики РАН, Россия.

Высокоэффективную жидкостную хроматографию (ВЭЖХ) проводили на хроматографах Waters, Agilent Chemstation 1100 Series в градиенте ацетонитрила в 0,1 М ацетате аммония или 0,1 М триэтиламмоний ацетата на С16, С18 и С4 обращеннофазовых колонках. Хроматографию белков проводили с использованием FPLC систем Pharmacia (Швеция) или Agilent (США).

Электрофоретическое разделение олигонуклеотидов проводили стандартно в 20% полиакриламидном геле (ПААГ) в денатурирующих условиях, ампликонов и плазмид в агарозном геле 2% и 1% соответственно, белков в 12% ПААГ.

Масс-спектры регистрировались на MALDI TOF-спектрометрах UltraFlex и MicroFlex (Bruker, США) с использованием стандартной стальной мишени (MSP polished steel, Bruker, США). В качестве матрицы при анализе олигонуклеотидной составляющей применяли 0,25 М раствор 3-гидроксипиколиновой кислоты (Fluka, США). Для получения масс-спектров белков непосредственно с никелевых нанокомплексов последние дважды промывали 0,1 M раствором ацетата аммония в 1% ацетонитриле, водой и ресуспендировали в 0,022 М растворе матрицы (3,5диметокси-4-оксикоричной кислоты, Aldrich, США), в 50% водном ацетонитриле, содержащем 0,1% трифторуксусной кислоты. Полученную суспензию наносили на мишень и высушивали на воздухе.

Синтез олигонуклеотидов.

Олигодезоксирибонуклеотиды синтезировали твердофазным амидофосфитным методом на автоматическом синтезаторе ASM (Россия) с использованием стандартных коммерческих реагентов в условиях модифицированных нами программ реакционных циклов. Для реакционных циклов с введением 3’тиофосфорильных звеньев вместо стандартного окислителя, содержащего йод и воду, применяли свежеприготовленный 0,05 М раствор 3H-1,2-бензодитиол-3-ондиоксида (Glen Research, США) в ацетонитриле. Деблокирование и расщепление связи олигомера с носителем осуществляли с использованием стандартных процедур. Полученные препараты олигомеров анализировали методами ВЭЖХ, MALDI-TOF MS (Matrix Assisted Laser Desorption/Ionization Time-of-Flight Mass Spectrometry), УФ-спектрофотометрией и электрофорезом в ПААГ.

Методы генетической инженерии.

Реакции кинирования, лигирования, рестрикции проводили с использованием коммерческих ферментов согласно протоколам производителей и другими стандартными методами.

Фрагменты ДНК из агарозного геля выделяли с использованием набора Wizard PCR Preps DNA Purification System (Promega, США) согласно инструкции.

Трансформацию, культивирование штаммов E.coli, получение компетентных клеток и др. проводили согласно инструкции производителя.

Получение, выделение и очистка целевых рекомбинантных белков.

При работе с клеточными линиями использовали стандартные протоколы производителей.

Выделение и очистку белков проводили с помощью металло-хелатной аффинной и ионообменной хроматографий. Предварительно отмытые тельца включения, содержащие целевые полипептиды, разрушали дезинтегратором в буфере, содержащем гуанидин хлорид. После фракционирования хроматографией, фракции обессоливали и рехроматографировали. Концентрацию белка определяли по методу ВСА (ВСА-набор, Sigma США). Очищенный белок характеризовали электрофоретическим анализом в ПААГ и масс-спектрометрически.

Культивирование клеток.

В экспериментах использовали опухолевые клети человека линии DU145 и контрольные клетки. Клетки культивировали в пластиковых культуральных флаконах (Costar, Великобритания) в среде RPMI 1640 (Gibco, США), содержащей 10% эмбриональной бычьей сыворотки и 50 мкг/мл гентамицина при 37°С в увлажненной атмосфере, содержащей 5% СО2. Клеточные культуры рассевали раза в неделю и высевали в 12-луночные планшеты на покровные стекла или непосредственно в лунки за сутки до эксперимента.

Проточная цитофлуориметрия.

Клетки DU145 и контрольные в логарифмической фазе роста отмывали дважды PBS (pH 7,4) и 2 часа инкубировали в среде DMEM (Sigma, США), не содержащей сыворотки. Далее клетки снимали с пластика и отмывали буфером PBS. Комплексы белков PGA, PGA1 и PGA1-His с флуоресцентномеченными TMO и TMS (соотношение белок:олигонуклеотид от 1:1 до 4:1) в концентрации 200 нM по олигонуклеотидам и 200-800 нМ по белку добавляли к суспензии клеток на холоду и инкубировали при 37С в течение 1 часа. После окончания инкубации клетки снимали с пластика с помощью раствора 0,05% трипсина в растворе Версена (Sigma, США), промывали и ресуспендировали в PBS. Интенсивность флуоресценции измеряли на проточном цитофлуориметре EPICS-XL (BeckmanCoulter, США), флуоресценцию возбуждали аргоновым лазером (Coherent), возб.

488 нм, исп. 520 нм.

Флуоресцентная микроскопия.

Клетки DU145 высевали на покровные стекла в 24-луночные планшеты за сутки до эксперимента. Комплексы белков с флуоресцентномеченными олигонуклеотидами (соотношение белок:олигонуклеотид от 1:1 до 5:1) добавляли к клеткам на 24 часа в концентрации 200 нМ по олигонуклеотидам. Клетки отмывали PBS и фиксировали 4% параформальдегидом. Ядра клеток окрашивали флуоресцентным красителем Hoechst 33342 (Sigma, США). Клетки заключали в мовиол и анализировали флуоресценцию с помощью микроскопа Opton IM35 (Carl Zeis, Германия) при увеличении 400х с использованием фильтров: G450, FT510, LP515-565 – для FAM и G365, FT395, LP420 – для Hoechst. Визуализацию изображения осуществляли с помощью цифровой камеры DXM 1200 (Nikon, Япония).

Получение комплексов ДНК и белков с наночастицами никеля.

Суспензию 10-15 мг порошка наночастиц Ni в 1 мл 0,1 М серной кислоты встряхивали (1 ч, 20С), обрабатывали ультразвуком (22 кГц, 15 мин.), частицы отделяли центрифугированием или магнитной сепарацией. После удаления кислоты остаток промывали водой до нейтральной реакции. Подготовленные частицы никеля хранили в виде суспензии в 30% водном глицерине в среде гелия или аргона. Взвеси после встряхивания и ультразвуковой обработки были стабильны в течение 1-2 часов.

Для получения изотерм адсорбции олигонуклеотидов и белков из водных растворов наночастицами никеля в пробирки помещали аликвоты приготовленной взвеси, промывали PBS (рН 7,4) и добавляли равные объемы растворов олигонуклеотидов или белков в 0,1 М PBS. Взвеси интенсивно встряхивали в течение оптимального времени, затем фиксировали изменение оптической плотности супернатанта (260 нм – для олигонуклеотидов, 280 – для белков 3D и PGA, 395 – для GFP). В случае FAM-содержащих олигомеров регистрировали изменение интенсивности флуоресценции (возб.=430 нм, исп.=495 нм), для GFP – возб.=490 нм, исп.=512 нм. Молярную концентрацию образовавшегося комплекса рассчитывали по разности исходной и остаточной оптических плотностей растворов. Молярную концентрацию связанного белка рассчитывали по изменению оптической плотности с учетом коэффициентов молярной экстинкции белков, (для 3D и PGA – ( нм)=67400, для GFP – (395 нм)=30000).

Получение комплексов ДНК-Ni и белок-Ni проводили аналогично.

Изучение взаимодействия Ni-GFP с ДНК-аптамерами Agfp1 и Agfp2 проводили следующим образом: аликвоты взвеси ассоциатов Ni-GFP помещали в пробирки, промывали 0,1 М PBS (рН 7,4) и встряхивали с равными объемами растворов олигонуклеотидов dС30, Agfp1 и Agfp2 (0,2-0,4 О.Е./мл). Оптическую плотность супернатантов измеряли через 2 часа при 260 нм.

Содержание работы.

Настоящая работа посвящена разработке подхода транспорта чужеродной ДНК в клетки с использованием природных механизмов рецепторопосредованного эндоцитоза. Домен белкового вектора, отвечающий за интернализцию всего комплекса в целевые клетки, можно рассматривать как модифицированный лиганд рецепторов клетки, который снабжен олигокатионной последовательностью, предназначенный для связывания с нуклеиновой компонентой.

Получение белок-нуклеиновых комплексов подразумевает под собой работу в нескольких направлениях, таких как конструирование белковой составляющей комплекса, дальнейшая наработка, очистка и подтверждение структуры, исследование комплексообразования и транспортных свойств, эксперименты in vitro по доставке комплексов в клетки, кроме этого получение олигонуклеотидов различной природы и флуоресцентномеченных олигонуклеотидов, а также исследование взаимодействия олигонуклеотидов и белков с поверхностью частиц никеля.

1. ДНК-компонента комплексов.

В качестве нуклеиновой компоненты в экспериментах были использованы как кольцевые молекулы плазмид, так и синтетические олигонуклеотиды. Однако использование любого деградируемого материала сталкивается с рядом проблем, касающихся интерпретации результатов. Чтобы избежать некорректных результатов, в работе были использованы не только фосфодиэфирные олигонуклеотиды, но и их идентичные по нуклеотидной последовательности тиофосфорильные аналоги. Последние устойчивы к биодеградации в биологических жидкостях и при этом сохраняют гибридизационные свойства. Кроме этого для визуализации интернализации белок-нуклеиновых комплексов были использованы олигонуклеотиды с флуоресцентной меткой, в таких случаях применение природных аналогов олигонуклеотидов с FAM-меткой1 не дает однозначной оценки, так как, наблюдая за флуоресценцией, нельзя однозначно утверждать, что метка еще входит в состав молекул олигомеров, и делать выводы об ее транслокации. Поэтому в настоящей работе рассмотрены некоторые особенности получения тиофосфорильных олигонуклеотидов, а также олигомеров, содержащих флуоресцентные метки.

1.1. Синтетические фосфодиэфирные и фосфоротиоатные олигонуклеотиды.

В работе использовались олигонуклеотиды как в качестве нуклеиновой составляющей комплексов, так и для получения экспрессирующих конструкций, плазмид, а также как праймеры для полимеразноц цепной реакции (ПЦР) и сиквенса.

Среди модификаций сахаро-фосфатного остова, повышающих устойчивость олигонуклеотидов к биодеградации, наиболее подробно изучены особенности применения и метаболизм тиофосфорильных олигонуклеотидов, показана их перспективность использования в качестве антисмысловых последовательностей (Stein C.A., 1991; Agrawal S., 1995). В то же время известно, что тиофосфорильные олигонуклеотиды обладают некоторой системной токсичностью, это затрудняет их использование непосредственно при работе с живыми организмами. Однако необходимо иметь ввиду, что рабочие концентрации используемых в экспериментах олигонуклеотидов, в виду своей устойчивости к клеточным нуклеазам, могут быть значительно ниже.

FAM – 6-флуоресцеинил-6-карбоксиамидогексил 1.2. Флуоресцентномеченные олигонуклеотиды.

Широкое применение флуоресцентномеченные олигонуклеотиды получили из-за возможности визуализировать ряд процессов, происходящих с исследуемыми объектами. В представленной работе флуоресцентные производные олигонуклеотидов позволили получить данные об интернализации клетками искусственных нуклеопротеиновых комплексов, их внутриклеточной локализации и др.

Кроме того, надежность и совершенствование методов получения высокоочищенных меченых олигонуклеотидов играет большую роль в создании комплексных диагностических наборов, которые позволяют одновременно анализировать содержание в пробе нескольких ДНК-мишеней (Probert W.S., 2004; Ram S., 2005).

Было замечено, что особенности хроматографического поведения таких олигонуклеотидов затрудняют их очистку. Это обусловлено рядом причин, например склонностью к внутри- и межмолекулярной агрегации. Соотношение конформационных форм олигомера зависит от температурного режима хроматографии (рис. 2 А и Б) и зачастую различно для разбавленных и концентрированных растворов, и, как оказалось, профили аналитических и препаративных хроматограмм могут содержать разные пики, т.е. условия хроматографии, найденные в аналитическом варианте, неэффективны для препаративной очистки (рис. 2 В).

При оптимизации ВЭЖХ методов очистки олигонуклеотидов фракции, соответствующие пикам на хроматограммах, собирали и исследовали с помощью MALDI TOF MS (лазерная десорбционно-ионизационная времяпролетная массспектрометрия с участием матрицы), UV-VIS-спектрофотометрии, электрофоретического анализа в ПААГ и сравнивали эффективность их работы в соответствующих условиях Real-Time PCR.

Рис. 2. Хроматографические профили разделения (градиент ацетонитрила в 0,1М ацетате аммония) 5’-(6-FAM)-37-mer-3’BQH11 (A), 5'-HEX2-46-mer-3'-Dabsyl3 (Б), 5'-(6-FAM)-35mer-3'-BQH2 (В) реакционных смесей олигонуклеотидного синтеза. Колонка С16Т 4х мм, Диасорб, Россия (A и В); Nucleosil 10x250 мм, Teknokroma, Испания (Б).

Учитывая перечисленные свойства, для подбора условий хроматографической очистки олигонуклеотидов использовали реакционные смеси синтеза (в масштабе 0,1-0,2 мкмоль) олигомеров после удаления аммиака в вакууме, варьируя не только параметры градиента растворителей, но и температуры. Наиболее существенные для идентификации пиков данные приведены на рис. 2. Из сравнительного анализа профилей видно, что, например, 5'-(6-FAM)-37-мер-3'-BHQ (рис. 2 A) эффективнее отделяется от примесей при 35oС, а 5'-5'-HEX-46-mer-3'Dabsyl – при 55oС (рис. 2Б).

1.3. Использование в работе терапевтически значимых олигонуклеотидов.

Black hole quenchers 4,7,2’,4’,5’,7’-гексахлор-флуоресцеинил-6-карбоксиамидогексил 4-(диметиламино)азобензен-4'-сульфонил В работе использовался широкий круг олигонуклеотидов, в том числе терапевтически значимых. Известно из литературы, что TMO (telomeric mimic oligonucleotide) и его тиоаналог TMS ингибируют активность теломеразы (Sun D., 1997; Wang E.S., 2004), процесс происходит, по-видимому, за счет связывания их с каталитической белковой субъединицей белка, хотя точный механизм ингибирования теломеразной активности мимик-олигонуклеотидами не вполне ясен.

Также в работе использовались хорошо изученные антисмысловые олигомеры к генам С-myc, Bcl-II и др. (Dias N., 2002; Manoharan M., 2002; Kurreck J., 2003, Wang E.S., 2004), действие которых вызывает апоптоз опухолевых клеток. В работе были использованы фосфодиэфирные олигонуклеотиды, их тиоаналоги и несущие флуоресцентые метки олигонуклеотиды.

2. Рекомбинантные белковые векторы.

Наиболее перспективный, гибкий и доступный способ получения новых белков сегодня – это химико-ферментативный синтез гена, получение штаммапродуцента и биотехнологическая наработка рекомбинантного полипептида. Использование белковых векторов для доставки чужеродной ДНК в клетки рассмотрено в литературном обзоре настоящей диссертации.

Оригинальность белковых конструкций, полученных в настоящей работе (совместно с лабораторией биотехнологии ММА им. И.М. Сеченова), состоит в том, что в качестве рецептор-узнающего домена белок содержит фрагмент альфафетопротеина (3D), который обеспечивает взаимодействие всего комплекса в целом с рецепторами клеточной поверхности. Суперэкспрессия рецепторов АФП характерна для многих типов опухолевых клеток (Ницветов М.Б., 2005). Природный АФП, выделенный из ретроплацентарной сыворотки рожениц, и его рекомбинантный фрагмент (3D) зарекомендовали себя как эффективные адресующие агенты, обеспечивающие избирательность в отношении многих активно пролиферирующих клеток (Гороховец Н.В., 2006). Для создания на основе доступного рекомбинантного белка 3D белковых векторов-переносчиков ДНК его последовательность дополняли ДНК-связывающими фрагментами, в состав которых был введен известный мотив сигнала ядерной локализации (рис. 3). В ряде работ показано, что NLS-домен в составе белков не только способен удерживать ДНК, но и придает кариофильность их нуклеопротеиновым комплексам (Keller M., 2003;

Позмогова Г.Е., 2007).

2.1. Дизайн белковых векторов на основе альфа-фетопротеина.

Известно, что С-концевая модификация 3D-фрагмента АФП не препятствует его связыванию с рецептором. Однако в ряде случаев именно N-концевое положение ДНК-связывающих последовательностей в составе векторов оказывалось предпочтительным (Uherek C., 2000; Kircheis R., 2002). Поэтому при создании новых белков были предусмотрены оба варианта расположения доменов. В составе PGA 3D-фрагмент модифицирован по N-концу, а в составе PGA1 и PGA1-His – по С-концу (рис. 3). Кроме того, из состава белка PGA1 удален технологический (His)6 сайт, предназначенный только для увеличения эффективность металлохелатной хроматографии. Схема строения белков-векторов PGA, PGA1 и PGA1His на основе рецепторсвязывающего фрагмента АФП приведены на рис. 3.

Рис. 3. Схематичное расположение функциональных доменов белковых векторов PGA, PGA1 и PGA1-His. NLS – фрагмент, отвечающий за связывание белка с ДНК, 3D – домен альфа-фетопротеина, ответственный за узнавание и связывание белка с AFP-рецепторами клеток, HHHHHH – полигистидиновый таг (His)6, предназначенный для выделения белка с помощью иминодиацетата сефарозы, заряженной ионами Ni(2+).

2.2. Получение белков PGA, PGA1 и PGA1-His.

Наработку белков с использованием штаммов-продуцентов E.coli проводили см. Материалы и методы. При выделении из биомассы рекомбинантных белков, содержащих полигистидиновую последовательность, в качестве альтернативы выделения с помощью иминодиацетате сефарозы, насыщенный ионами Ni(2+), использовали частицы никеля, как описано в работе (Лазарев В.Н., 2007). При выделении белка PGA1, последовательность которого не содержала олигогистидин, стадию с использованием металло-хелатной аффинной хроматографии пропускали и проводили сразу выделение ионообменной хроматографией. Такой подход увеличивал выход конечного белкового препарата при меньших временных и материальных затратах. Профиль элюции белка PGA приведен на рис. 4А.

Фракции, содержащие целевой белок, объединяли, обессоливали и рехроматографировали на той же колонке (рис. 4Б).

Рис. 4. Хроматографические профили разделения белка PGA ионообменной хроматографией из обогащенного концентрата (А – время удерживания 30-33 мин) и рехроматография фракций, содержащих целевой продукт (Б – время удерживания 19-21 мин).

Колонка – Protein Pak DEAE 8HR (8 х 350 мм); линейный градиент буфера, содержащего NaCl, поток элюента – 1 мл/мин; УФ-детекция – 280 нм.

Очищенные белки характеризовали электрофоретическим анализом в ПААГ (рис. 5 А) и масс-спектрометрически (рис. 5 Б).

Рис. 5. Анализ чистоты полученного белкового препарата (белок PGA) А: 12% ПААГ (1 – маркер молекулярной массы, 2 – белок PGA после очистки), Б: масс-спектр белка PGA (М.м.PGA=29025Да), полученный на MALDI-времяпролетном масс-спектрометре UltraFlex II (Bruker, Германия).

Первичную последовательность белков подтверждали методом массспектрометрического анализа их триптических гидролизатов. В результате были определены фрагменты последовательностей белков, совпавшие с идентифицированными пептидами (на 73% для белка PGA, на 82% для PGA1 и на 84% для PGA1-His).

3. Получение и исследование ассоциатов наночастиц никеля с олигонуклеотидами и гистидинилированными белками.

Наночастицы никеля способны избирательно связывать гистидинилированные (His-tagged) белки, что стало основой технологии эффективного выделения последних из биомассы. Важно отметить, что сорбция белков носит обратимый характер, а очищенные полипептиды, например GFP (зеленый флуоресцирующий белок) и цитохром Р450 из Mycobacterium tuberculosis не теряли своих биологических свойств (Лазарев В.Н., 2007).

Возможность модификации поверхности частиц никеля делает их чрезвычайно привлекательными и перспективными для придания такой магнитной основе разнообразных заданных свойств, как совершенно новых, так и присущих уже известным наноструктурам (Chang-Cheng Y., 2007). Наночастицы никеля вполне могут стать связующим звеном в многокомпонентных полифункциональных конструкциях, содержащих как различные белки, так и белки в сочетании с ДНК.

В настоящей работе проводились исследования закономерностей взаимодействий наночастиц никеля с одноцепочечными фрагментами ДНК (ssДНК) различной длины и состава, в том числе с тиофосфорильными олигодезоксирибонуклеотидами, а также с гистидинилированными рекомбинантными белками. Цель такого исследования – показать, что молекулы белков, содержащие полигистидиновые последовательности, могут обратимо сорбироваться на поверхности никеля, определить характеристики такой сорбции, а также доказать, что адсорбированные молекулы как минимум частично сохраняют свои конформационные свойства.

3.1. Взаимодействие поверхности частиц никеля с олигонуклеотидами.

Для того чтобы охарактеризовать общий процесс образования комплексов из биомолекул и наночастиц никеля, были использованы различные олигонуклеотиды. Первоначально необходимо было изучить возможность и условия их адсорбции.

В результате ряда экспериментов показана способность агрегатов комплексов (рис. 6).

на поверхности частиц Ni, C1 – общая концентрация олигоадсорбции ряда олиго- нуклеотида, С2 – концентрация комплекса Ni-ДНК.

нуклеотидов свидетельствует о зависимости параметров связывания олигомеров от их длины, нуклеотидного состава и природы межнуклеотидных связей.

Важно было понять, какие оптимальные условия образования комплексов из биомолекул и металлических частиц. Было изучено влияние ряда параметров на процесс сорбции (рН, ионной силы буферного раствора и влияние имидазола, который вытесняет биополимеры с поверхности частиц за счет образования координационных связей с Ni) и подобраны условия для сорбции.

циональности адсорбированных фрагментов ДНК на поверхности наночастиц никеля. ная металлизация ДНК на по- dТ30-Ni комплементарного (dA30) и некомплементарного (dC30) олигонуклеотидов. C1 – суммарная верхности металлических часконцентрация олигонуклеотида, С2 – концентрация тиц способствует потере гиб- комплексов Ni-ДНК.

ридизационных свойств(Becerril H.A., 2005). Поэтому были проведены эксперименты по гибридизации Ni-олигонуклеотидных комплексов и показано, что Niсвязанные олигомеры способны избирательно удерживать комплементарные последовательности. Для исследования взаимодействий адсорбированных на поверхности Ni олигонуклеотидов (на примере dT30) с их комплементарными фрагментами использовали комплементарный олигомер dA30 и отрицательный контроль dC30. По данным на изотермах видно, что происходит удерживание комплементарного олигомера dA30, в то время как сорбции некомплементарного dC30 почти не наблюдается (рис.7).

3.3 Сорбция гистидинилированных белков на поверхности частиц никеля.

В ходе работы было исследовано образование Ni-белковых ассоциатов.

Частицы никеля модифицировали рядом белков, например рекомбинантными гистидинилированными GFP, 3D и PGA, далее определяли параметры сорбции. Были найдены четкие закономерности взаимоC2/C1, % действия гистидинилированных белков с Ni. Изотермы, предPGA ставленые на рис. 8, были получены, как описано выше. Пока- зано, что Ni высокоэффективно тидинилированные белки 3D Рис. 8. Изотермы адсорбции (20oС) частицами Ni рекомбинантных гистидинилированных белков GFP, (рецепторсвязывающий домен альфа-фетопротеина), получен- концентрация комплексов Ni-белок.

ный рекомбинантный PGA и GFP, что соответствует и литературным данным (Лазарев В.Н., 2007). По подсчетам, сделанным на основании анализа кривых ассоциации белков с частицами никеля, приведенных на рис. 8, удельная нагрузка белка достигала ~10-20 молекул на частицу. Можно предположить, что белки образуют довольно плотное покрытие частиц, практически полностью модифицируя их поверхность. При этом сохраняется целостность (по данным массспектрометрии) и, вероятно, конформация белковой компоненты, поскольку спектр флуоресценции GFP, высвобожденного из GFP-Ni ассоциата обработкой 500 мМ раствором имидазола, соответствовал спектру исходного белка.

Некоторые взаимодействия биомолекул с металлическими поверхностями могут приводить как к потере конформационных свойств, так и к разрушению первичной структуры. В этой связи необходимо было подтвердить, что молекулы не подвергаются таким воздействиям.

Десорбированные белки и белки непосредственно на поверхности никеля исследовали методами MALDI TOF масс-спектрометрии, что позволило получать молекулярные характеристики органических доменов в составе Ni-комплексов и подтвердить их целостность.

3.4. Взаимодействие Ni-GFP с ДНК-аптамерами Agfp1 и Agfp2. Важно было не только сохранить неизменной аминокислотную последовательность белковых молекул, но и их структурную организацию.

C2/C1, % Рис. 9. А – Изотермы адсорбции (20oС) ассоциатов GFP-Ni с GFP-аптамерами Agfp1 – 5'ATCCGCCTGATTAGCGATACTCAGAAGGAT, Agfp2 – 5'-GCTGTTGAGTTCTATGGCTATG TGACCGTA и dC30. С1 – суммарная концентрация связанного и свободного олигонуклеотида, С2 – концентрация ДНК-Ni комплексов; Б – изотермы адсорбции ассоциатов GFP-Ni с аптамерами Agfp1 и Agfp2 за вычетом поправки на неспецифическое связывание.

Для получениия характеристик архитектуры белка GFP в составе протеинNi комплексов были использованы аптамеры к GFP (Stanlis K.K., 2003). В работе Stanlis K. было найдено и описано 2 аптамера к белку, показано, что они имели различную степень сродства к белковой молекуле. Мы использовали оба олигонуклеотида (Agfp1 и Agfp2) для подтверждения функциональности адсорбированных белковых молекул. Изотермы представлены на рис. 9.

Стоит отметить, что при проведении экспериментов и анализе их результатов мы старались выявить и снизить вклад неспецифической сорбции аптамеров.

Так, например, для экранирования (кепирования) поверхностей частиц никеля, не несущих белок, GFP-Ni ассоциаты выдерживали в растворе олигонуклеотида тиоТ15 и промывали буфером. При этом (по данным флуоресцентного анализа супернатантов) десорбции белка не наблюдалось. Природа погрешностей другого типа могла быть связана со слабыми неспецифическими взаимодействиями олигомеров с белковой компонентой ассоциата, поэтому при интерпретации данных мы учитывали и результаты контрольного опыта, например с олигомером dС30 (рис. 9А).

В итоге были получены кривые насыщения, представленные на рис. 9Б.

Оказалось, что аптамер Agfp1, как и в работе Stanlis K.K., значительно лучше (Kдисс.~300 нМ) ассоциировался с GFP-Ni в сравнении с Agfp2 (Kдисс. ~700 нМ).

Данные свидетельствуют о том, что по отношению к взаимодействию с аптамерами Agfp1 и Agfp2 белок GFP в составе ассоциата с частицами никеля проявлял свойства, гомологичные свойствам несвязанного GFP.

Полученные результаты свидетельствуют о том, что в составе ассоциатов биополимеры могут частично или полностью сохранять функциональные свойства.

4. Комплексы белков с олигонуклеотидами и плазмидной ДНК.

Для исследования комплексообразования белков PGA, PGA1 и PGA1-His с молекулами ДНК были проведены эксперименты по торможению в геле. Известно, что в неденатурирующих условиях электрофореза в ПААГ подвижность комплекса белок-ДНК значительно отличается от подвижности свободных компонентов комплекса. Эксперименты по комплексообразованию были проведены с белком PGA1 и одноцепочечным фрагментом ДНК ss48, его дуплексом – ds 48 и плазмидой pRC-CMV (рис. 10). На рис. 10 четко наблюдается корреляция между существенным изменением подвижности ДНК, особенно в случае олигонуклеотидов (рис. 10 А и Б), и увеличением избытка белка. Наличие нескольких новых полос в электрофореграммах позволяет предположить, что в состав ассоциатов может включаться одна или несколько белковых молекул.

Рис. 10. Электрофореграмма смесей флуоресцентномеченного олигонуклеотида (А), олигонуклеотидного дуплекса (Б) и плазмидной ДНК (В) с различными избытками белка PGA1.

А: водные растворы олигонуклеотида ss48 смешивали с раствором белка PGA1 до результирующей концентрации ss48, равной 31 нМ и PGA1: 1) 0, 2) 6 мкМ, 3) 15 мкМ.

Б: водные растворы олигонуклеотидного дуплекса ds48, смешивали с раствором белка PGA1 до результирующей концентрации дуплекса ds48 равной 31 нМ и PGA1 1) 0, 2) мкМ, 3) 15 мкМ. Смеси анализировали с помощью электрофореза в 8% ПААГ (неденатурирующие условия, сканер флуоресценции Tyfoon Amersham возб. – 495 нм, исп. – В: водные растворы плазмиды pRC-CMV смешивали с раствором белка PGA1 до результирующей концентрации ДНК, равной 2,5 нМ и белка PGA1: 1) 0, 2) 2,5 мкМ, 3) 5 мкМ, 4) 10 мкМ, 5) 15 мкМ. Электрофоретическое разделение смесей проводили в 0,8% агарозе.

5. Транспортные свойства белков PGA, PAG1 и PGA1-His.

Исследование интернализации нуклеопротеиновых комплексов клетками проводили с использованием флуоресцентномеченных олигонуклеотидов. Для того чтобы убедиться в универсальности белковых векторов в отношении состава переносимой ДНК, использовали тиофосфорильные модифицированные (FTelP5, FAS1, FTMS) и вырожденный FN23T олигомеры.

Об избирательности в отношении клеток-мишеней свидетельствуют данные распределения флуоресценции целевых DU145 (рис. 11, кривые 1-6) и рецептордефицитных контрольных клеток (кривая 7) после их инкубирования с комплексами, состоящими из флуоресцентномеченных терапевтически значимых антисмысловых олигомеров и белков (PGA – кривые 1, 4, 5, 6, 7, PGA1 – кривая 2, PGA1-His – 3).

Оказалось, что все белки образоИнтенсивность флуоресценции, у.е.

PGA1-His (см. кривые 2-3).

фотографии опухолевых клеток линии сью флуоресцентномеченного тиофос- инкубации с флуоресцентномеченными олигонуклеотидами в присутствии рекомбинантфорильного олигонуклеотида FTMS и белка PGA. Отметим, что в приведен- кривые 1, 4-7, с PGA1 – 2 и с PGA-His – 3. Зависимости 2-7 получены для тиофосфорильном эксперименте наблюдалась преных олигомеров: FN23T (кривые 2-4,7), TelP имущественная локализация переноси- (5) и AS1 (6); кривая 1 – для фосфодиэфирного олигонуклеотида FTMO.

мой ДНК в области эндоплазматического ретикулума клеток.

Рис. 12. Флуоресцентные микрофотографии клеток линии DU145 (карцинома простаты) после инкубации в течение 24 часов в присутствии белка PGA и флуоресцентного олигомера FTMS (соотношение 3:1). А – зеленая флуоресценция олигомера FTMS, Б – голубая флуоресценция окрашенных Hoechst 33342 ядер, В – инверсионная фотография, Г – суперпозиция кадров А-В.

Таким образом, в результате работы были получены новые белковые векторы, способные образовывать устойчивые комплексы с одноцепочечными олигонуклеотдами, их дуплексами и плазмидной ДНК и избирательно доставлять генетический материал в целевые клетки.

В работе продемонстрирована принципиальная возможность и перспективность использования наночастиц никеля для формирования многофункциональных биополимерных структур, которые могут найти применение в разработке биосенсеров, диагностических систем, конструировании новых материалов, поиске аптамеров для различных белков и др.

1. С использованием оптимизированых методов ВЭЖХ-очистки (снижающих влияние эффектов самоассоциации) получен ряд антисмысловых олигонуклеотидов, в том числе снабженных флуорофорами (FAM, HEX), а также фрагменты ДНК для сборки генетических конструкций.

2. Методами химико-ферментативного синтеза и генетической инженерии получены новые рекомбинантные белки PGA, PGA1 и PGA1-His, несущие рецепторсвязывающий домен альфа-фетопротеина человека и олигокатионные последовательности.

3. Показано, что белки PGA, PGA1 и PGA1-His способны самопроизвольно образовывать с плазмидной ДНК, фосфодиэфирными и тиофосфорильными олигонуклеотидами стабильные транспортные комплексы.

4. Продемонстрирована избирательная доставка чужеродной ДНК в составе комплексов с белками PGA, PGA1 и PGA1-His в клетки, несущие рецепторы альфа-фетопротеина.

5. Показана способность наночастиц никеля ассоциироваться с гистидинилированными рекомбинантными белками (на примере PGA, PGA1-His, 3D и белка зеленой флуоресценции) и с олигонуклеотидами с образованием стабильных комплексов. Найдено, что взаимодействие с наночастицами никеля не приводило к деструкции биополимеров. На примере двух конструкций продемонстрирована принципиальная возможность и перспективность использования наночастиц никеля в качестве платформы для сборки многофункциональных нуклеопротеиновых структур.

Основные результаты диссертации опубликованы в работах:

1. Позмогова Г.Е., Чувилин А.Н., Смирнов И.П., Зайцева М.А., Татаринова О.Н., Говорун В.М. Получение и свойства ассоциатов наночастиц никеля с ssДНК и белками. // Российские нанотехнологии. 2008. Т. 3. №5-6. С. 148-154.

2. Татаринова О.Н., Лукьянова Т.Н., Зайцева М.А., Веремеев К.Ю., Карпов В.А., Чувилин А.Н., Петрунин Д.Д., Позмогова Г.Е. Влияние способов очистки олигодезоксирибонуклеотидных зондов на эффективность генодиагностики методом PCR в режиме реального времени. // Бюлл. эксперим. биол. и мед. 2008.

Т. 145. №3. С. 275-280.

3. Татаринова О.Н., Гороховец Н.В., Макаров В.А., Посыпанова Г.А., Серебрякова М.В., Позмогова Г.Е.. Новые белковые векторы на основе фрагмента альфафетопротеина для направленного транспорта ДНК в опухолевые клетки. // Вестник РАМН. 2010. №1. С. 3-8.

4. Татаринова О.Н., Лукьянова Т.Н., Зайцева М.А., Карпов В.А., Чувилин А.Н., Позмогова Г.Е. Специфика обращено-фазовой ВЭЖХ олигодезоксирибонуклеотидных зондов для Real-Time PCR генодиагностики. // Тез. докл. III Межд.

конф. "Фундаментальные науки - медицине". 2 - 8 сент. 2007. Новосибирск. С.

143.

5. Позмогова Г.Е., Татаринова О.Н., Смирнов И.П. Формирование нуклеопротеиновых ассоциатов на основе наночастиц никеля. // Сб. трудов IV Съезда Российского общества биохимиков и молекулярных биологов. 2008. Новосибирск. С. 206.

6. Татаринова О.Н., Смирнов И.П., Позмогова Г.Е. Самосборка ассоциатов наночастиц никеля с олигодезоксирибонуклеотидами и гистидинилированными белками. // Тез. докл. XV Межд. конф. ст., асп. и мол. уч. «Ломоносов», разд. «Биоинженерия и биоинформатика». 8 – 11 апр. 2008. Москва. С. 51.

7. Татаринова О.Н., Гороховец Н.В., Макаров В.А., Посыпанова Г.А., Позмогова Г.Е. Направленный транспорт олигонуклеотидов в опухолевые клетки с помощью белковых векторов на основе фрагмента альфафетопротеина. // Тез.

докл. 1-й межд. науч. шк. Нано-2009. 29июня-4июля. 2009. Москва. С. 345-346.



 
Похожие работы:

«Фатыхова Юлия Наильевна РОЛЬ СТРУКТУРЫ СООБЩЕСТВ ХЕМОЛИТОТРОФНЫХ МИКРООРГАНИЗМОВ В РАЗРУШЕНИИ СТРОИТЕЛЬНЫХ СИЛИКАТНЫХ МАТЕРИАЛОВ 03.00.16 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2006 2 Работа выполнена в Томском государственном архитектурно – строительном университете на кафедре Охрана труда и окружающей среды Научный руководитель доктор геолого-минералогических наук, профессор Мананков Анатолий Васильевич...»

«Волынкин Антон Валерьевич Видовое разнообразие и экология совок (Insecta, Lepidoptera, Noctuidae (s. l.) Русского Алтая 03.02.08 – экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Барнаул – 2012 2 Работа выполнена на кафедре экологии, биохимии и биотехнологии биологического факультета ФГБОУ ВПО Алтайский государственный университет Научный руководитель : доктор биологических наук, профессор Соколова Галина Геннадьевна Официальные...»

«Сафенкова Ирина Викторовна ВЗАИМОДЕЙСТВИЕ ВИРУСОВ РАСТЕНИЙ С АНТИТЕЛАМИ: КОЛИЧЕСТВЕННЫЕ ЗАКОНОМЕРНОСТИ И ПРАКТИЧЕСКОЕ ПРИМЕНЕНИЕ Специальность 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва 2010 Работа выполнена в лаборатории иммунобиохимии Учреждения Российской академии наук Института биохимии им. А.Н. Баха РАН Научные руководители: доктор химических наук, профессор Б.Б. Дзантиев кандидат биологических наук А.В....»

«ЕФРЕМЕНКО ЕЛЕНА НИКОЛАЕВНА ГЕТЕРОГЕННЫЕ БИОКАТАЛИЗАТОРЫ НА ОСНОВЕ ИММОБИЛИЗОВАННЫХ КЛЕТОК МИКРООРГАНИЗМОВ: ФУНДАМЕНТАЛЬНЫЕ И ПРИКЛАДНЫЕ АСПЕКТЫ 03.00.02 – биофизика 03.00.23 – биотехнология Автореферат диссертации на соискание ученой степени доктора биологических наук Москва - 2009 Работа выполнена на кафедре химической энзимологии Химического факультета Московского государственного университета имени М.В. Ломоносова Научный консультант : Варфоломеев Сергей Дмитриевич, доктор...»

«ЭБЕЛЬ Александр Леонович ФЛОРА СЕВЕРО-ЗАПАДНОЙ ЧАСТИ АЛТАЕ-САЯНСКОЙ ПРОВИНЦИИ: СОСТАВ, СТРУКТУРА, ПРОИСХОЖДЕНИЕ, АНТРОПОГЕННАЯ ТРАНСФОРМАЦИЯ 03.02.01 – Ботаника Автореферат диссертации на соискание ученой степени доктора биологических наук Томск 2011 Работа выполнена на кафедре ботаники ФГБОУ ВПО Национальный исследовательский Томский государственный университет Научный консультант : доктор биологических наук, профессор Ревушкин Александр Сергеевич Официальные оппоненты :...»

«МАТЫЧЕНКОВ ВЛАДИМИР ВИКТОРОВИЧ РОЛЬ ПОДВИЖНЫХ СОЕДИНЕНИЙ КРЕМНИЯ В РАСТЕНИЯХ И СИСТЕМЕ ПОЧВА-РАСТЕНИЕ 03.00.12 – физиология и биохимия растений 03.00.27 – почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Пущино 2008 Работа выполнена в Институте фундаментальных проблем биологии Российской академии наук Научные консультанты: доктор биологических наук Биль Карл Яковлевич доктор биологических наук, профессор Ерохин Юрий Евдокимович...»

«КАТИНДА Марсиал Де Соуза Бело АГРОЭКОЛОГИЧЕСКАЯ ОЦЕНКА СОСТОЯНИЯ ПЛОДОРОДИЯ ПОЧВ НИЗМЕННО-ЗАПАДИННОГО АГРОЛАНДШАФТА В АГРОЦЕНОЗЕ ЗАПАДНОГО ПРЕДКАВКАЗЬЯ Специальность 03.02.13 – почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата сельскохозяйственных наук Краснодар – 2012 Работа выполнена в федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Кубанский государственный аграрный университет в 2009-2012 гг....»

«ЗОЛАЛА Хенгамех Абдоллах ПАЛИНОМОРФОЛОГИЯ И РАЗВИТИЕ СПОРОДЕРМЫ ПРЕДСТАВИТЕЛЕЙ СЕМЕЙСТВА КОЛОКОЛЬЧИКОВЫЕ (CAMPANULACEAE JUSS.) Автореферат диссертации на соискание ученой степени кандидата биологических наук Cпециальность 03.02.01 - ботаника Москва 2010 Работа выполнена на кафедре высших растений биологического факультета Московского государственного университета имени М.В. Ломоносова Научный...»

«Эрдэнэгэрэл АРИУНБОЛД ДИНАМИКА РАСТИТЕЛЬНЫХ СООБЩЕСТВ СУХИХ СТЕПЕЙ СРЕДНЕЙ ХАЛХИ (СОМОН БАЯН–УНДЖУЛ, МОНГОЛИЯ) 03.02.01 – Ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Санкт–Петербург 2014 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении высшего профессионального образования Санкт-Петербургском государственном лесотехническом университете им. С. М. Кирова доктор биологических наук, профессор...»

«Мальцев Александр Владимирович АГРОЛАНДШАФТНОЕ ОБОСНОВАНИЕ АГРОТЕХНИКИ НА ЧЕРНОЗЕМЕ ОБЫКНОВЕННОМ В ОТРОГАХ ДОНЕЦКОГО КРЯЖА 03.00.27 - почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону 2008 Работа выполнена на кафедре земледелия и мелиорации Донского государственного аграрного университета Научный руководитель : доктор биологических наук, профессор Калиниченко Валерий Петрович Официальные оппоненты : доктор...»

«ИВАЩЕНКО ТАТЬЯНА АЛЕКСАНДРОВНА МОНОКЛОНАЛЬНЫЕ АНТИТЕЛА К F1 И V АНТИГЕНАМ YERSINIA PESTIS ДЛЯ ВЫЯВЛЕНИЯ ВОЗБУДИТЕЛЯ ЧУМЫ 03.02.03 – микробиология 03.01.06 – биотехнология (в том числе бионанотехнологии) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Оболенск – 2013 2 Работа выполнена в Федеральном бюджетном учреждении науки Государственный научный центр прикладной микробиологии и биотехнологии Роспотребнадзора Научные руководители: доктор...»

«АВТУХ АЛЕКСАНДР НИКОЛАЕВИЧ СИСТЕМАТИКА АКТИНОМИЦЕТОВ РОДА KRIBBELLA 03.02.03 Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Пущино – 2012 Работа выполнена в отделе Всероссийская коллекция микроорганизмов Федерального государственного бюджетного учреждения науки Института биохимии и физиологии микроорганизмов им. Г.К. Скрябина РАН. Научный руководитель : доктор биологических наук Евтушенко Людмила Ивановна Научный консультант :...»

«Мамонтов Юрий Сергеевич ФЛОРА МОХОВИДНЫХ ОМСКОЙ ОБЛАСТИ 03.00.05 – Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2007 Работа выполнена на кафедре ботаники, цитологии и генетики ГОУ ВПО Омский государственный педагогический университет Научный руководитель : доктор биологических наук, профессор Борис Фёдорович Свириденко Официальные оппоненты : доктор биологических наук, доцент Андрей Ильич Пяк кандидат биологических наук...»

«ПОДОСОКОРСКАЯ ОЛЬГА АНДРЕЕВНА НОВЫЕ АНАЭРОБНЫЕ ТЕРМОФИЛЬНЫЕ ЦЕЛЛЮЛОЛИТИЧЕСКИЕ МИКРООРГАНИЗМЫ Специальность 03.02.03 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт микробиологии им. С.Н. Виноградского Российской академии наук (ИНМИ РАН) Научный руководитель : Бонч-Осмоловская Елизавета Александровна доктор биологических наук...»

«ЕЛИЗАРЬЕВА ОЛЬГА АЛЕКСАНДРОВНА ЭКОЛОГО-БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ ЭНДЕМИКА ЮЖНОГО УРАЛА OXYTROPIS GMELINII FISCH. EX BORISS. (FABACEAE) В УСЛОВИЯХ ИНТРОДУКЦИИ 03.00.05 – Ботаника Автореферат диссертации на соискание ученой степени кандидата биологических наук Уфа – 2009 2 Работа выполнена в лаборатории геоботаники и охраны растительности в Учреждении РАН Институт биологии Уфимского научного центра РАН Научный руководитель : кандидат биологических наук, старший научный...»

«Шелудченков Антон Александрович Исследование механизма цитотоксического действия белкового комплекса Tag7-Hsp70 на опухолевые клетки специальность 03.01.03 – молекулярная биология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва – 2014 Работа выполнена в лаборатории молекулярной иммуногенетики рака Федерального государственного бюджетного учреждения науки Института биологии гена Российской академии наук. Научный руководитель : доктор...»

«УМПЕЛЕВА Татьяна Валерьевна МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКАЯ ХАРАКТЕРИСТИКА КЛИНИЧЕСКИХ ИЗОЛЯТОВ MYCOBACTERIUM TUBERCULOSIS, ВЫДЕЛЕННЫХ ОТ БОЛЬНЫХ ТУБЕРКУЛЕЗОМ В УРАЛЬСКОМ ФЕДЕРАЛЬНОМ ОКРУГЕ РОССИЙСКОЙ ФЕДЕРАЦИИ 03.02.03 – Микробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Екатеринбург - 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Уральский научно-исследовательский институт фтизиопульмонологии Научные...»

«Дудченко Людмила Вадимовна ЭКОЛОГИЧЕСКАЯ ТРАНСФОРМАЦИЯ СОРНОЙ РАСТИТЕЛЬНОСТИ ЛЕСОПОЛОС В ТРАВОСТОИ ЗОНАЛЬНОГО ТИПА МЕТОДОМ АГРОСТЕПЕЙ 03.02.08 – экология (биологические наук и) АВТОРЕФЕРАТ диссертация на соискание ученой степени кандидата биологических наук Ростов-на-Дону - 2013 Работа выполнена в Ставропольском научно-исследовательском институте сельского хозяйства Россельхозакадемии Научный руководитель : доктор биологических наук, профессор Дзыбов Джантемир Сосренович...»

«КЛЕВЦОВА Ирина Николаевна ЭКОЛОГИЯ И ФИЗИЧЕСКИЕ СВОЙСТВА ПОЧВ ОРЕНБУРГСКОГО ПРЕДУРАЛЬЯ 03.00.16 - Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Оренбург-2008 Работа выполнена в Государственном образовательном учреждении высшего профессионального образования Оренбургский государственный университет Научный руководитель доктор биологических наук, профессор Русанов Александр Михайлович Официальные оппоненты : доктор биологических наук,...»

«Аушев Сергей Викторович ЭКОЛОГИЧЕСКИЕ ЗАВИСИМОСТИ ВЛИЯНИЯ ФАКТОРОВ ВНЕШНЕЙ СРЕДЫ НА ИНТЕНСИВНОСТЬ ПРИРОСТА СОСНЫ ОБЫКНОВЕННОЙ 03.00.16 - Экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2006 Работа выполнена на кафедре радиотехнологий и экологического мониторинга Томского государственного университета систем управления и радиоэлектроники Научный руководитель : доктор биологических наук, профессор Карташев Александр Георгиевич...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.