WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

Давыдова Ольга Николаевна

Исследование NMDA-рецепторов лимфоцитов человека

03.00.04-биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени

кандидата биологических наук

Москва

2007 г.

Работа выполнена в ГУ НИИ неврологии РАМН

Научный руководитель:

Заслуженный деятель науки РФ, доктор биологических наук, профессор Болдырев Александр Александрович

Официальные оппоненты:

доктор биологических наук профессор Муронец Владимир Израилевич доктор биологических наук Орлова Валентина Cергеевна

Ведущая организация:

ГУ Гематологический научный центр РАМН

Защита состоится «» _2007 г. в «_» часов на заседании диссертационного совета Д 212.203.13 при Российском университете дружбы народов по адресу: 117198, ГСП, г. Москва, ул. Миклухо-Маклая, д.

С диссертацией можно ознакомиться в Научной библиотеке Российского университета дружбы народов по адресу: 117198, ГСП, г. Москва, ул.

Миклухо-Маклая, д.

Автореферат разослан «_» 2007 г.

Ученый секретарь диссертационного совета Д 212.203. доктор биологических наук, профессор Лукашева Е.В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы В современном естествознании сложилось устойчивое представление о взаимосвязи нервной и иммунной систем, совместную работу которых можно рассматривать как единый защитный механизм, обеспечивающий адаптационные реакции организма. Показано, что клетки иммунной системы человека экспрессируют ряд рецепторов, чувствительных к нейромедиаторам, что позволяет им воспринимать информацию, получаемую от клеток нервной системы. В частности, известно, что в поддержании гомеостаза лимфоцитов важную роль играет глутаминовая кислота, однако механизмы, опосредующие ее действие на клетки белой крови, до сих пор недостаточно изучены.

Необходимым условием для понимания процессов, лежащих в основе «диалога» между нервной и иммунной системами, как в норме, так и при патологии, является изучение тонких механизмов их взаимодействия на клеточном и молекулярном уровнях. Проблема регуляции межклеточных взаимодействий такого рода до сих пор остается открытой, поэтому актуальность проведения подобных исследований трудно переоценить.




Возможно, выяснение регуляторных взаимосвязей между нервной и иммунной системами позволит выявить новые подходы в лечении ряда заболеваний. В первую очередь это относится к патологическим состояниям, характеризующимся воспалительными процессами в ЦНС, в частности, ишемии головного мозга, рассеянному склерозу, болезни Альцгеймера и другим патологиям, протекающим на фоне выраженного окислительного стресса. Общей чертой в развитии таких заболеваний является значительное повышение уровня глутаминовой кислоты, что приводит к нейрональной смерти вследствие развития экзайтоксических механизмов. Поскольку в процессе нейровоспаления активированные клетки белой крови проникают в ткани мозга, оказывая на них повреждающее воздействие, исследование механизмов воздействия глутаминовой кислоты на лимфоциты и другие клетки иммунной системы может способствовать лучшему пониманию патогенеза воспаления нервной ткани.

С другой стороны, уровень глутаминовой кислоты в плазме крови существенно повышается у больных с опухолевыми заболеваниями. Известно, что это коррелирует с подавлением иммунной системы, в частности, со снижением числа лимфоцитов и их функциональной активности, однако механизмы, обуславливающие эти эффекты, мало исследованы.

В связи с вышесказанным, изучение влияния глутаминовой кислоты на клетки иммунной системы представляется весьма актуальной проблемой как для теоретической, так и для практической медицины.

Целью настоящей работы явилось изучение действия агониста глутаминовой кислоты N-метил-D-аспартата (NMDA) на лимфоциты человека и поиск в этих клетках NMDA-рецепторов как молекулярной основы, обеспечивающей наблюдаемые эффекты.

Исходя из цели исследования были поставлены следующие экспериментальные задачи:

Исследовать продукцию свободнорадикальных соединений в суспензии лимфоцитов человека в присутствии глутаминовой кислоты и ее хемилюминесценции.

Охарактеризовать действие NMDA на состояние лимфоцитов человека при помощи метода проточной цитометрии.

Исследовать в лимфоцитах экспрессию мРНК, кодирующей белок NMDA-рецепторного комплекса методом обратной транскрипции и полимеразной цепной реакции (ОТ-ПЦР).

Исследовать экспрессию белковой субъединицы (NR1) NMDAрецептора на клеточной поверхности лимфоцитов методом флуоресцентного окрашивания антителами, специфичными к внеклеточному участку аминокислотной последовательности этого белка.

Научная новизна и практическая ценность работы В работе охарактеризовано влияние агониста глутаматных рецепторов NMDA-класса, N-метил-D-аспартата, на лимфоциты периферической крови человека. Впервые было продемонстрировано усиление люминол-зависимой хемилюминесценции суспензии клеток в ответ на их инкубацию в присутствии NMDA, а также ингибирование этого эффекта в присутствии антагониста NMDA-рецепторов дизоцилпина (МК-801). Это позволяет сделать заключение о специфическом рецепторном действии NMDA на лимфоциты, проявляющемся в усилении продукции свободных радикалов этими клетками.





Методом проточной цитометрии продемонстрировано увеличение внутриклеточного уровня активных форм кислорода (АФК) в присутствии NMDA. При помощи иммунофлуоресцентного окрашивания показано связывание антител к внешнему домену рецепторного белка с мембраной лимфоцитов, а также усиление экспрессии данного антигена в результате инкубации клеток с NMDA. Наконец, в работе была показана экспрессия в лимфоцитах периферической крови человека мРНК, кодирующей основную белковую субъединицу NMDA-рецепторного комплекса (NR1). Полученные в работе данные позволяют считать доказанной экспрессию на внешней специфическими компонентами нейрональных клеток. Полученные результаты расширяют представления о молекулярных механизмах взаимодействия глутаминовой кислоты с лимфоцитами человека, что существенно для понимания функции этого медиатора в иммунной системе.

Лимфоциты человека экспрессируют глутаматные рецепторы NMDAкласса, активация которых приводит к изменению внутриклеточного уровня АФК. Этот процесс является составной частью специфического действия глутаминовой кислоты на клетки белой крови.

Результаты исследований были доложены на XIII международной конференции «Новые информационные технологии в медицине, биологии, фармакологии» (Украина, Крым, 2005), на XXIX ежегодном собрании Японского нейрохимического общества (Япония, Киото, 2006). Апробация работы прошла 25 декабря 2006 г. на заседании ученого совета ГУ НИИ неврологии РАМН.

По теме диссертации опубликовано 5 работ.

Диссертация состоит из введения, обзора литературы, описания материалов и используемых методов, результатов исследования и их обсуждения, заключения, выводов и списка литературы. Диссертация изложена на 110 стр. печатного текста, содержит 18 рисунков и 1 таблицу. Список литературы включает 265 наименований.

СОДЕРЖАНИЕ РАБОТЫ

МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

В качества объекта исследования в работе использовались гранулярные клетки мозжечка и лимфоциты периферической крови крыс и человека.

Получение ткани мозжечка крыс и выделение гранулярных клеток.

Для получения гранулярных клеток мозжечка использовали 10-дневных крыс линии Wistar. После декапитации животных выделяли мозжечок, помещали его на льду в чашку Петри, измельчали и добавляли диспазу (1,66 IU/мл).

Пробы инкубировали 30 мин при 340С в растворе Тироде (NaCl 148 мM;

KCl 5 мM; CaCl2 2 мM; MgCl2 1 мM; D-глюкоза 10 мM; HEPES 10 мM; pH 7.3).

После инкубации кусочки ткани трижды промывали раствором Тироде и аккуратно пертурбировали клетки при помощи пастеровской пипетки.

Суспензию клеток фильтровали через нейлоновый фильтр с диаметром пор 60 µм для удаления крупных кусков ткани. Подсчет клеток проводили в камере Горяева. Полученную суспензию инкубировали 60 мин при 370С в растворе Тироде. В каждую пробу для измерений брали в среднем (1-2) клеток.

Отбор крови. В работе использовалась кровь доноров без выраженных патологий, которая отбиралась у каждого донора многократно. Забор крови осуществляли из локтевой вены с утра, натощак. Кровь собирали в полистироловую пробирку с гепарином (конечная концентрация гепарина составляла 100 ед/мл). При выделении клеток для последующего роста в культуре отбор крови осуществляли в стерильных условиях с использованием вакуумтейнеров.

Отбор крови у крыс проводили следующим образом. Взрослых животных перед опытом усыпляли хлоралгидратом, взятым из расчета 400-600 мг вещества на 1 кг веса животного и отбирали кровь из яремной вены с помощью шприца, содержащего раствор гепарина (50 ед/мл крови).

Выделение лимфоцитов. Процедуру выделения лимфоцитов проводили не позднее 2 часов с момента отбора крови. Выделение периферических мононуклеарных клеток проводили в градиенте фикол-гипака (плотность 1,077±0,001), используя стандартную среду выделения «LymphoSep» (ICN Biomedicals) и следуя указанному производителем протоколу. Собранные после выделения клетки дважды отмывали, и полученный осадок ресуспендировали в изотоническом растворе Хенкса (рН 7,2). Когда было необходимо, от моноцитов избавлялись путем «приплэйтинга» - адгезии на пластике при 37С в течение 40 мин. Подсчет клеток проводили в камере Горяева.

Первичная культура периферических лимфоцитов. Клетки выделяли описанным выше способом, избавляясь от моноцитарной фракции. Все работы проводили в стерильном ламинарном боксе. После отмывки клетки суспендировали в среде RPMI-1640, содержащей 10% инактивированную телячью эмбриональную сыворотку, глутамин (2 mM), пенициллин (100 ед./мл), стрептомицин (100 мг/мл), и инкубировали в 5% СО2-инкубаторе.

Плотность клеточной суспензии составляла 106 кл/мл. О количестве мертвых клеток в ходе эксперимента судили по окраске проб трипановым голубым. Активированные лимфоциты получали в результате инкубации с фитогемагглютинином (ФГА-П, ПанЭко, Россия) (10 мкг/мл) в течение часов.

ИСПОЛЬЗУЕМЫЕ ПОДХОДЫ И РЕГИСТРИРУЕМЫЕ ПАРАМЕТРЫ

Хемилюминесцентный анализ АФК. Регистрацию продукции АФК в клеточной суспензии проводили в присутствии 50 µМ химического активатора хемилюминесценции люминола (5-амино-1,2,3,4-тетрагидро-1,4-фталазиндиона) на жидкостном сцинтилляционном счетчике «Mark III» («Searle Analytic Inc.», The Netherlands). Люминол растворяли в DMSO так, чтобы концентрация растворителя в образце не превышала 0,1%. Регистрацию интенсивности люминесценции проводили в течение 200-250 мин с момента добавления реактивов к клеточной суспензии. Плотность клеточной суспензии составляла (5-10)104 кл/мл. Все опыты с клеточной суспензией проводили при рассеянном освещении.

Стационарный уровень свечения клеток, определенный в присутствии люминола, отражал исходную скорость образования АФК, а увеличение числа регистрируемых импульсов в минуту – увеличение скорости накопления АФК.

В качестве положительного контроля активации к клеточной суспензии добавляли 1 µМ форболмиристат ацетат (ФМА). Для оценки специфичности действия в пробы одновременно с NMDA вносили МК-801 (антагонист NMDAрецепторов) в конечной концентрации 10 µМ.

Проточная цитометрия. Измерения проводили на приборе «Beckman Coulter, EPICS» (USA), оснащенном аргоновым лазером с длиной волны возбуждения 485 нм. В каждой пробе анализировали 10000 событий. В качестве параметра, характеризующего интенсивность флуоресценции внутриклеточного маркера АФК (DCFН-DA) использовали среднее значение флуоресценции (Mean fluorescence), которое отражает уровень АФК. При анализе апоптоза, некроза или взаимодействия клеток со специфическими антителами, определяли процент клеток, имеющих положительную флуоресценцию в результате взаимодействия с соответствующими красителями, по отношению к контролю.

Определение внутриклеточного уровня АФК. Для определения внутриклеточного уровня АФК клетки нагружали флуоресцентным красителем DCFН-DA (2,7-дихлордигидрофлуоресцеин-диацетатом, ex=485 нм, и em= нм) в конечной концентрации 100 мкМ в течение 40 мин. Краситель растворяли в DMSO так, чтобы концентрация растворителя в образце была не выше 0,1%.

Определение доли мертвых клеток. Для идентификации некроза в клеточной популяции лимфоциты или нейроны окрашивали иодидом пропидия (PI, ex=485 нм, и em=610 нм) в конечной концентрации 10 мкМ. Краситель добавлялся к клеточной суспензии за 5 мин до измерения, окраска оставалась стабильной в течение по крайней мере 30 мин.

Определение доли апоптотических клеток. Степень апоптоза в клеточной суспензии определяли с помощью окраски внутриклеточной ДНК йодидом пропидия следующим образом. Исследуемые пробы, содержащие 1106 клеток в объеме 0,5 мл, отмывали от культуральной среды буферносолевым раствором стандартного состава осадок после центрифугирования осторожно ресуспендировали в 1 мл охлажденного (-20°С) 70% этанола и оставляли от 12 до 48 ч при -20°С. Затем его дважды отмывали от этанола раствором PBS, осадок ресуспендировали в 1 мл гипотонического раствора флуорофора (5 мкг/мл PI, 0,1% цитрата натрия, 0,1% Тритон Х-100), и инкубировали в течение 20 мин при 4°С в темноте. Подготовленные пробы анализировали методом проточной цитометрии.

Иммунофенотипирование. Клеточную суспензию окрашивали моноклональными антителами к СD-маркерам поверхности лимфоцитов (CD45, CD3, CD19), конъюгированными с флуоресцентными красителями флуоресцеинизотиоционатом (FITC) или фикоэритрином (PE). Преципитацию антител проводили следующим образом. К 50 мкл суспензии, содержащей тысяч клеток, добавляли 5 мкл антител («Сорбент» Россия), инкубировали мин при +40С, дважды отмывали, а осадок ресуспендировали в 50 мкл среды Хенкса. Анализ проводили методом проточной цитометрии.

Определение экспрессии NR1-субъединицы. Определение экспрессии NMDA-рецепторного белкового комплекса на поверхности лимфоцитов проводили методом непрямого иммунофлуоресцентного окрашивания с двумя видами антител к NR1-субъединице NMDA-рецептора:

1) специфичными поликлональными (rabbit anti-rat) антителами ab («Abcam», USA) к внеклеточному домену NR1-субъединицы, с последующей окраской поликлональными (goat anti-rabbit) FITC-коньюгированными антителами ab 6717 («Abcam», USA).

2) специфичными моноклональными (mouse anti-rat) антителами (GTX30182, GenTex, USA) с последующей окраской FITC-коньюгированными поликлональными козьими Fab-фрагментами к IgG мыши (ab 6669, Abcam, USA).

В качестве положительного контроля использовали связывание анти-NR антител с гранулярными клетками мозжечка крысы.

Для нейронов и лимфоцитов процедуру окрашивания проводили сходным образом. Клетки после отмывки от среды выделения разводили в растворе Хенкса до концентрации (1-5)106 кл/мл и инкубировали 40 мин при комнатной температуре в присутствии первичных антител. После этого клетки отмывали в растворе Хенкса при 400 g в течение 10 мин и окрашивали вторичными антителами, меченными флуоресцентным красителем (FITC). Инкубацию проводили в течение 30 мин в темноте, после чего клетки отмывали в тех же условиях. Для того чтобы исключить неспецифическую флуоресценцию вторичных антител, контрольные пробы прокрашивались с ними без предварительной инкубации с первыми антителами.

Чтобы исключить неспецифическое связывание поликлональных первых антител (ab6483), а также возможное связывание с Fc-рецептором клеточной поверхности, дополнительно ставили изотипический контроль с очищенной фракцией иммуноглобулинов (IgG) кролика («Имтек», Россия), поскольку первичные антитела (ab 6483) относились к тому же изотипу иммуноглобулинов. Пробы подготавливали по описанному выше протоколу, концентрации IgG в изотипическом контроле были равны концентрациям первичных антител. После титрования первых антител в диапазоне концентраций 0,110 мкг/мл была выбрана оптимальная рабочая концентрация 3 мкг/мл. Концентрация FITC-коньюгированных антител составляла 10 мкг/мл.

Анализ образцов проводили на проточном цитофлуориметре в течение 2 ч с момента приготовления образцов.

Дизайн праймеров для полимеразной цепной реакции. Дизайн праймеров для полимеразной цепной реакции (ПЦР) проводили на основании базы данных «Gene NCBI» с иcпользованием программ «Vector NTI Suite 8» и «Oligо 631». Специфичность выбираемых праймеров дополнительно проверяли при помощи программы «NCBI Blast». Оценку температуры отжига проводили с использованием программы «HyTher».

В связи с тем, что в качестве положительного контроля экспрессии мРНК NMDA-рецептора был взят мозжечок крысы, для постановки реакции были выбраны следующие универсальные праймеры, в равной степени гомологичные «TTCACTCCCACCCCTGTCTCCTAС», обратный праймер «CAGCACCTTCTCTGCCTTGGACT». Длина получаемого продукта составляет 282 п.о.

В качестве положительного контроля выделения РНК и проведения ОТПЦР проводили реакцию с праймерами к гену GAPDH (глицеральдегид-3фосфат-дегидрогеназе): прямой праймер «CAGCCTCAAGATCATCAGCAATGCC», обратный праймер «GGGTGTCGCTGTTGAAGTCAGAGGA», длина получаемого продукта 446 п.о. Все использовавшиеся в работе праймеры были составлены с учетом интрон-экзонной структуры таким образом, чтобы избежать их специфического отжига на геномной ДНК.

Выделение РНК и обратная транскрипция. Выделение тотальной РНК из мозжечка крыс линии Wistar и лимфоцитов периферической крови человека проводили с использованием стандартного набора для выделения РНК «RNeasy MicroKit» («Qiagen», USA). Количество ткани мозжечка, использовавшегося для выделения, составляло 7 мг, количество лимфоцитов – 5106 клеток.

Обратную транскрипцию проводили следующим образом. Смесь объемом 20 мкл, содержащую 10 мкг тотальной РНК, 40 ед. ингибитора РНКаз IRNase («Синтол», Россия), 1 мкл Random-нуклеотидов (исходная концентрация 0,5 мг/мкл, «Синтол», Россия), инкубировали в течение 1 мин при 94°С для отжига праймеров и мгновенно охлаждали до 4°С. После этого в инкубационную смесь вносили 5 ед. IRNase, 6 мкл 5кратного MLV-буфера («Синтол», Россия), 1 мкл дезоксинуклеотидтрифосфатов (dNTP, концентрация 10 мМ, «Синтол», Россия), 1 мкл фермента MLV-ревертазы («Синтол», Россия) и проводили реакцию обратной транскрипции при 42°С в течение 40 мин, после чего смесь инкубировали 3 мин при 93°С для остановки реакции.

Полимеразная цепная реакция. Для постановки полимеразной реакции использовали набор «PCR-Core» для проведения ПЦР фирмы «ИзоГен»

(Россия), рассчитанный на проведение реакции в объеме 20 мкл. Конечные концентрации реагентов в одной пробе составляют 1 ед. Taq-полимеразы, мМ KCl, 15 мM сульфата аммония, 65 мМ Трис-HCl- буфера (рН 8,8), 2,5 мМ MgCl2, 200 мкМ дезоксинуклеотидтрифосфатов.

В качестве затравочных нуклеотидов использовали уникальные пары праймеров к субъединице NR1 NMDA-рецепторного комплекса или к GAPDH, описанные выше. В пробирку вносили 2 мкл ДНК-матрицы и праймеры (в концентрации 1 мкМ), наслаивали на реакционную смесь 30 мкл минерального масла во избежание испарения жидкости, и проводили амплификацию в амплификаторе «Терцог» (Россия).

Отрицательным контролем служили пробы, в которые в качестве матрицы вносили продукт выделения тотальной РНК без последующей реверсии; все остальные компоненты присутствовали в тех же количествах.

ПЦР проводили в следующем режиме: исходная денатурация матрицы – 95°С, 5 мин; денатурация – 94°С, 30 сек; отжиг праймеров – 60°С, 60 сек;

элонгация – 72°С, 60 сек. Заключительная достройка продуктов реакции – 72°С, 10 мин. Реакцию проводили в течение 36 циклов. Визуализацию продукта ПЦР проводили методом электрофореза в 1,5% агарозном геле при напряжении поля 10 В/см.

Статистическая обработка результатов. Измерение люминолзависимой хемилюминесценции проводили не менее чем в 5 параллельных пробах для каждого данного образца клеточной суспензии. Результаты представлены в виде: «среднее значение ± стандартное отклонение» для каждого фиксированного момента времени. В экспериментах с использованием методов проточной цитометрии измерялось не менее 3 параллельных проб.

Обработку результатов проводили при помощи программы «Biostatistika», используя для сравнения полученных выборок парный критерий Стьюдента.

Достоверными считали различия при t0.05.

РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЯ И ИХ ОБСУЖДЕНИЕ

1. Влияние NMDA на хемилюминесценцию суспензии лимфоцитов Известно, что люминол-зависимая люминесценция является индикатором суммарного уровня образования свободнорадикальных соединений, поскольку высвобождение квантов света имеет место при действии на люминол ряда различных окислителей: гидроксид-радикала, гипохлорита, окиси азота. В связи с этим метод люминол-зависимой хемилюминисценции широко применяется для исследования дыхательного взрыва лейкоцитов (в частности, нейтрофилов) (Владимиров и соавт., 1989). Мы применили этот подход для изучения состояния суспензии периферических мононуклеарных клеток крови (ПМК).

Для определения уровня активных форм кислорода анализировали ответ суспензии клеток, выделенных из образцов крови разных доноров. Следует отметить, что от опыта к опыту наблюдались отличия в стационарном уровне свечения клеток, отражающем исходную скорость образования АФК, что может объясняться как различиями в функциональном состоянии клеток белой крови разных доноров, так и возможной активацией лимфоцитов в процессе выделения. По этой причине действие исследуемых лигандов определяли как уровень детектируемого сигнала по отношению к базовому уровню.

В предварительных экспериментах, проведенных на образцах клеток, выделенных из крови разных доноров, рассматривалось действие NMDA в концентрациях 10, 100, 250, 500 мкМ. Эти опыты показали, что 10 мкМ NMDA не вызывал достоверно значимых изменений, а возрастающие концентрации в диапазоне от 100 мкМ до 500 мкМ вызывали дозозависимое усиление люминесценции для каждого исследовавшегося образца крови. Для дальнейшей оценки была выбрана минимальная эффективная концентрация, равная мкМ. В большинстве экспериментов внесение 100 мкМ NMDA к суспензии лимфоцитов сопровождалось усилением люминесценции по отношению к контролю. По сравнению с активацией, вызываемой ФМА, эффект NMDA был выражен существенно слабее и пролонгирован во времени (рис. 1).

Характерное время начала повышения уровня люминесценции под действием NMDA наступало через 3050 мин с момента начала инкубации. В процессе регистрации (в течение, по крайней мере, 2 часов) происходило прогрессивное нарастание интенсивности люминесценции.

Эффективность клеточного ответа на NMDA оценивали в процентах по отношению к максимуму усиления люминесценции суспензии в присутствии ФМА. Интенсивность активации при этом варьировала в пределах от 5 до 20%, в некоторых экспериментах NMDA не оказывал достоверно значимого влияния на изменение люминесценции клеточной суспензии, такие образцы не подвергали дальнейшему анализу.

Различия в реакции ПМК из крови разных доноров на действие лиганда могли быть вызваны как индивидуальными особенностями и общим состоянием организма доноров, так и методическими особенностями эксперимента. Возможно, в наших условиях частичная активация клеток могла происходить без значительного роста свободнорадикальных соединений. Как известно из литературы, глутамат не вызывает активации покоящихся клеток, однако стимулирует реакцию лимфоцитов на митоген-стимулирующие факторы (Lombardi et al., 2001). Поэтому можно предположить, что в эксперименте активация клеток NMDA имеет место, когда лимфоциты находятся в «подпороговом» состоянии.

Рис. 1. Хемилюминесценция ПМК: 1 – в контроле (клетки+люминол); 2 – в присутствии 100 мкМ NMDA, 3 – в присутствии 1 мкМ ФМА.

Для оценки специфичности действия NMDA к клеточной суспензии одновременно с лигандом вносили его антагонист МК-801. Оказалось, что МКснижает люминесценцию клеток, активированных NMDA, до контрольных значений (пример типичного эксперимента показан на рис. 2). В качестве дополнительного контроля мы использовали пробы, инкубировавшиеся с МКв отсутствие NMDA. Во всех рассмотренных случаях МК-801 не оказывал достоверных изменений уровня АФК по сравнению с контрольными значениями (пробы «клетки+люминол»). Этот факт, несмотря на различие в интенсивности наблюдаемого эффекта NMDA, позволяет предположить, что действие изучаемого лиганда является рецептор-опосредованным.

Таким образом, в описанной модельной системе, позволяющей охарактеризовать продукцию свободнорадикальных соединений, было показано, что NMDA специфическим образом повышает уровень активных форм кислорода в суспензии ПМК человека. Одновременная инкубация клеток в присутствии NMDA и его антагониста предотвращала рост люминолзависимой люминесценции.

Рис. 2. Подавление эффекта NMDA (100 мкМ) в присутствии МК-801 ( мкМ): 1- контроль, 2 – NMDA, 3 – NMDA+МК-801, 4 – МК-801. *-p0,01 по отношению к контролю, **-p0,05 по отношению к пробам, инкубировавшимся с В отличие от нейтрофилов и клеток моноцитарно-макрофагального ростка дифференцировки, использующих генерацию свободнорадикальных соединений для защиты организма от инфекций, образование лимфоцитами активных форм кислорода (АФК) не является их специфической функцией. Тем не менее, в литературе имеются многочисленные данные о генерации АФК лимфоидными клетками. Известно, что лимфоциты продуцируют супероксид (Pani et al., 2000), и их пролиферация и дифференцировка протекают с участием Redox-чувствительных процессов (Kaisho et al., 2001), хотя источники АФК в этих клетках до сих пор недостаточно изучены (Williams and Kwon, 2004). В связи с этим, повышение продукции свободно-радикальных соединений лимфоидными клетками можно рассматривать как один из критериев их активации, что согласуется со сложившимся на сегодняшний день представлением о свободных радикалах как своеобразных вторичных мессенджерах, играющих важную роль в процессах меж- и внутриклеточной сигнализации (Kamata and Hirata, 1999; Drdge, 2002).

В описанных экспериментах мы анализировали всю мононуклеарную фракцию периферических клеток крови, поэтому нельзя однозначно утверждать, что наблюдаемый ответ на NMDA не был (по крайней мере, отчасти) опосредован присутствием моноцитарных клеток. В экспериментах с применением метода проточной цитометрии было проведено уточнение этого вопроса.

2. Исследование действия NMDA на функциональное состояние лимфоцитов методом проточной цитометрии Используемый в работе метод выделения клеток позволяет выделять фракцию мононуклеаров периферической крови человека, содержащую некоторый процент моноцитов, а также возможную примесь гранулоцитов. В связи с этим, в первую очередь мы решили проверить степень контаминации получаемой суспензии этими клетками, которые, как известно, являются активными продуцентами АФК, и, следовательно, могут обусловливать наблюдаемые эффекты.

Чтобы ответить на этот вопрос, на начальном этапе анализа мы осуществлялся выбор анализируемой области (гейта) из всего диапазона событий, регистрируемых прибором, которая соответствовала бы положению субпопуляции лимфоцитов в координатах светорассеяния: SS (side scattering, боковое рассеяние) versus FS (forward scattering, малоугловое рассеяние). Для этого клеточную суспензию окрашивали моноклональными антителами к клеточным маркерам лимфоцитов, конъюгированными с флуоресцентными красителями (FITC или PE). Окраску проводили с антителами к панлейкоцитарному маркеру CD45, не экспрессирующемуся на тромбоцитах, антителами к лимфоцитарным маркерам CD3 (маркер Т-клеток) и CD (маркер В-клеток).

Исходя из логических ограничений, накладываемых видом клеток в координатах «SS-FS» и результатов окрашивания клеток анти-CD антителами, для дальнейшей работы мы выбрали гейт, однозначно соответствующий популяции лимфоцитов. В дальнейшем именно эти клетки были использованы для анализа эффекта NMDA. В проведенных экспериментах было показано, что количество моноцитарных клеток в пробах незначительно (в пределах 2%), а гранулоциты отсутствуют.

Таблица 1. Изменение клеточных характеристик под действием 1 mM NMDA (FS – малоугловое рассеяние, SS – боковое рассеяние, Mean FL-DCF – среднее значение флуоресценции DCF) (величины представлены как среднее ± ст. откл. в процентах по отношению к контрольным пробам, n=3, * соответствует величине p0,01 по отношению к контролю).

Анализ клеток методом проточной цитометрии позволил выявить влияние NMDA на ряд клеточных характеристик. Оказалось, что 30 мин инкубация с высокими концентрациями NMDA (0,51mM) приводит к усилению флуоресценции DCF-DA, что свидетельствует о накоплении АФК внутри клеток (результат типичного эксперимента приведен на рис. 3). Этот феномен сопровождается изменением параметров светорассеяния клеток FS и SS, характеризующих размеры и гранулярность клеток соответственно. Под действием 1 мM NMDA происходит смещение положения клеток в координатах «SS-FS» в сторону больших значений SS и меньших значений FS.

Результаты типичного эксперимента приведены в таблице 1. Концентрации лиганда, меньшие 0,5 мM, не оказывали эффекта на изменение параметров FS/SS.

Данные Таблицы 1 иллюстрируют, что даже кратковременная инкубация клеток с высокой концентрацией NMDA приводит к сжатию клеток и увеличению их гранулярности, что косвенно свидетельствует об изменении метаболического состояния клеток. Данные изменения могут соответствовать начальным стадиям активации клеток или их возможной подготовке к апоптозу: перестройке цитоскелета и поверхностному сжатию (shrinking).

Окрашивание клеток иодидом пропидия показало, что процент мертвых клеток как в контроле, так и в пробах, прошедших инкубацию с NMDA, был незначителен (никогда не превышал 1%). В ходе инкубации клеток с лигандами количество клеток, окрашиваемых иодидом пропидия, не увеличивалось. Таким образом, несмотря на вызываемые эффекты, инкубация с NMDA не приводила к клеточной гибели в рассматриваемом временном диапазоне (до 1,5 ч инкубации).

хемилюминесценции, наблюдаемый эффект был выражен в разной степени для клеток разных доноров. Более того, препараты, выделенные из образцов крови разных доноров, обладали разной пороговой чувствительностью по отношению к концентрации лиганда, в связи с чем в экспериментах этой серии мы исследовали действие NMDA в достаточно высоких концентрациях (0,5 - мМ).

Поскольку люминол, использовавшийся при изучении влияния NMDA на лимфоциты в первой части экспериментальной работы, является индикатором преимущественно внутриклеточного уровня свободнорадикальных соединений (Caldefie-Chezet et al., 2002), можно предположить, что наблюдаемый эффект был опосредован усилением продукции АФК внутри клетки. Наличие корреляции в результатах, полученных при использовании двух независимых подходов – хемилюминесцентного анализа и флуоресцентного анализа методом проточной цитометрии – отчасти подтверждает это предположение.

3. Определение экспрессии мРНК к NR1 субъединице NMDAрецепторного комплекса Доказательство экспрессии мРНК, кодирующей субъединицу NMDAрецептора, проводили методом обратной транскрипции (ОТ) и последующей ПЦР с нуклеотидными праймерами, специфическими к определенному участку искомой последовательности.

Основной задачей проводимого исследования было обнаружение мРНК, кодирующей субъединицу NR1 NMDA-рецепторного комплекса (далее – мРНК-NR1) в лимфоцитах человека. В качестве положительного контроля (ткани с высоким уровнем экспрессии NMDA-рецепторов) был взят мозжечок крысы. Такая постановка эксперимента накладывала определенные требования к дизайну праймеров: они должны быть универсальны, то есть в равной степени комплементарны к кДНК как крысы, так и человека.

В связи с вышеуказанными обстоятельствами, выбор праймеров для ПЦР проводили на основании выравниваний различных сплайс-вариантов мРНКNR1 человека и крысы. Степень гомологии, определяемая как отношение числа парных совпадений к длине последовательности, для мРНК-NR1 у данных видов составляет 89%.

Проведенный анализ показал наличие в пробах кДНК, полученной из лимфоцитов периферической крови человека, соответствующего продукта ПЦР длиной 282 п.о., что является доказательством экспрессии мРНК к NR1субъединице (Рис. 4). Практически одновременно и независимо аналогичные результаты были описаны в литературе (Miglio et al., 2005), где показали экспрессию мРНК к NR1 и NR2-субъединицам в лимфоцитах человека.

Поэтому, опираясь на их данные, мы не стали изучать экспрессию различных изоформ NR2-субъединицы, хотя ее коэкспрессия с NR1 и является необходимым условием для формирования функционального рецепторного комплекса.

Поскольку функциональное значение экспрессии NMDA-рецепторов в лимфоцитах неизвестно, нас интересовало, изменяется ли уровень экспрессии мРНК к NR1 в результате активации клеток.

Состояние ФГА-активированных лимфоцитов, а также клеток, инкубировавшихся в контрольных условиях, оценивали с помощью анализа ДНК методом проточной цитометрии. Для этого после 48 и 72 ч инкубации проводили фиксацию клеток 70% этанолом и окрашивали иодидом пропидия.

Данный метод позволяет оценить процент клеток, находящихся в различных фазах клеточного цикла, а также процент апоптотических клеток. В наших условиях инкубация с ФГА (10мкг/мл) приводила к изменению морфологии клеток (изменению параметров светорассеяния SS и FS) в анализируемых пробах. Одновременно были обнаружены существенные изменения в содержании ДНК: сокращалось число клеток с диплоидным количеством ДНК (клетки в фазе G0/G1 клеточного цикла), и увеличивалось число апоптотических клеток (фракция с гиподиплоидным содержанием ДНК). Увеличение по сравнению с контролем числа гиподиплоидных клеток является косвенным свидетельством их активации: стимуляция периферических мононуклеаров митогенами неизбежно приводит к запуску процесса апоптоза в части клеточной популяции, поскольку в обоих процессах задействованы общие внутриклеточные сигнальные системы.

Сопоставление уровня экспрессии мРНК-NR1 с экспрессией мРНК к GAPDH (house keeping gene) обнаружило некоторое усиление экспрессии мРНК исследуемого гена в клетках, подвергшихся 72 ч инкубации с ФГА, по сравнению с контрольными пробами (пример типичного эксперимента приведен на рис. 4). В связи с этим мы предположили возможное участие NMDAR в процессе активации лимфоцитов.

Рис. 4. Анализ экспрессии мРНК NMDA-рецептора. 1 – экспрессия NR1, мозжечок крысы, 2 – экспрессия NR1, лимфоциты человека после 72 ч инкубации в среде, 3 – то же в присутствии ФГА, 4 – экспрессия GAPDH, лимфоциты человека после 72 ч инкубации в среде, 5 – то же в присутствии ФГА, 6 – отрицательный контроль, 7 – маркеры ДНК (опыты поставлены совместно с А.Н. Пеговой, МБЦ МГУ им. Ломоносова).

4. Определение экспрессии субъединицы NR1 NMDA-рецепторного Экспрессия NR1 субъединицы является необходимым условием для формирования NMDA-рецепторного комплекса вне зависимости от того, в сочетании с какими субъединицами (NR2 и/или NR3), коэкспрессирующимися в конкретных условиях, формируется ионный канал. Поэтому в проведенном эксперименте мы определяли уровень экспрессии NR1 на клеточной поверхности лимфоцитов методом окраски антителами, специфичными к внеклеточному участку аминокислотной последовательности этого белка.

4.1 Окраска клеток поликлональными антителами (ab6483) к NR1субъединице. Использовавшиеся в эксперименте антитела к NR1 были специфичны к белку крысы. Сравнение аминокислотной последовательности участка (порядка 20 аминокислот), к которому специфичны поликлональные антитела ab6483, у человека и крысы показывает 100% гомологию. Кроме того, высокий консерватизм белковой последовательности NR1 в области N-конца (гомология 99%) позволяет предположить очень близкую или даже идентичную конформацию белка для этих видов, что послужило основанием для использования данных антител на лимфоцитах человека.

В качестве положительного контроля было проведено окрашивание суспензии нейронов мозжечка крысы. Клеточную суспензию окрашивали иодидом пропидия для дискримининации между живыми и мертвыми клетками, и в процессе дальнейшего анализа окраски антителами рассматривали популяцию клеток, не окрашиваемых эти красителем. Такой подход необходим при анализе связывания антител с внешней мембраной клеток, поскольку положительно окрашенные по PI клетки имеют поврежденную клеточную мембрану, и, соответственно, более высокий уровень неспецифического связывания (background staining). Эксперименты показали окрашивание 50 % живых нейронов в суспензии анти-NR1 антителами.

Далее мы провели окрашивание данными антителами лимфоцитов крысы.

Анализ показал увеличение количества окрашенных лимфоцитов крысы в пробах, инкубировавшихся в присутствии NR1-специфичных антител, по отношению к пробам, инкубировавшимся с изотипическими антителами, на 5%. Те же результаты были получены при анализе связывания антител с поверхностью лимфоцитов человека (рис. 5).

Таким образом, нам удалось показать, что в исходной популяции лимфоцитов около 5% клеток связывают антитела к NR1-субъединице.

4.2 Окраска клеток моноклональными антителами (GTX30182) к NR1-субъединице. В качестве дополнительного доказательства экспрессии NR1-субъединицы на поверхности мононуклеарных клеток человека мы решили также исследовать связывание других антител к NR1 с поверхностью этих клеток – моноклональных антител (GTX30182), специфичных к внеклеточному домену рецепторного белка. Анализ показал окраску 5,5±1 % периферических лимфоцитов, выделенных из крови 3 здоровых доноров, что коррелирует с данными, полученными в эксперименте с поликлональными антителами, и является дополнительным доказательством экспрессии белковой субъединицы NR1 NMDA-рецепторного комплекса на внешней мембране субпопуляции лимфоцитарных клеток. Полученные результаты соответствует данным, недавно опубликованным в литературе (Miglio et al., 2005).

Таким образом, результат исследований, проведенных с использованием специфических антител к NR1-субъединице NMDA-рецептора, доказывает поверхностную экспрессию белковой субъединицы NR1 NMDA-рецепторного комплекса на внешней мембране субпопуляции лимфоцитарных клеток.

Несмотря на то, что мы не анализировали экспрессию остальных белковых субъединиц NMDA-рецепторного комплекса, комплексный анализ полученных данных свидетельствует об экспрессии данного рецептора в лимфоидных клетках, хотя не исключено, что его структура и функциональные свойства у лимфоцитов могут отличаться от таковых для NMDA-рецепторов, экспрессируемых в нейрональных тканях.

4.3 Изменение экспрессии NR1 в результате инкубации клеток с NMDA. Поскольку моноклональные антитела, связываются с единственной антигенной детерминантой и, следовательно, обладают более высокой специфичностью по сравнению с поликлональными антителами, они, как правило, характеризуются меньшей степенью неспецифического связывания (background staining) и лучше подходят для исследования методом проточной цитометрии. Поэтому в дальнейших экспериментах мы решили использовать именно моноклональные антитела для оценки степени экспрессии NR1субъединицы на поверхности мононуклеаров периферической крови человека в процессе их активации.

Рис.6. Определение NR1-позитивных клеток в культуре периферических лимфоцитов. А – доля окрашенных клеток, выявляемых после совместной инкубации с ФГА (10 мкг/мл) и NMDA (500 мкМ): 0 ч - 1 (5,5% окрашенных клеток); 48 ч - 2 (28,5%); 72 ч - 3 (85%). Б – доля окрашенных клеток, выявляемых после инкубации в присутствии агонистов и антагонистов NMDAрецепторов в течение 72 часов: 1 – контроль, 2 – ФГА (10 мкг/мл), 3 – NMDA ( мкМ), 4 – MK-801 (25 мкМ), 5 – ФГА + NMDA, 6 - ФГА + NMDA + MK- (опыты проведены совместно с А.П. Машкиной, кафедра биохимии МГУ им.

Исходя из данных, полученных в экспериментах с определением экспрессии мРНК к NR1-субъединице, мы ожидали, что процент клеток, экспрессирующих NR1 на своей поверхности, будет расти в результате инкубации клеток в присутствии ФГА. Тем не менее, в экспериментах с окрашиванием лимфоцитов моноклональными антителами оказалось, что достоверно значимых изменений уровня экспрессии не происходит. Однако мы обнаружили другой любопытный эффект: инкубация ФГА-стимулированных мононуклеаров с NMDA (500 мкМ) приводит к резкому увеличению процента позитивно окрашенных NR1-антителами клеток (Рис. 6). Таким образом, с увеличением времени инкубации активированных лимфоцитов с NMDA усиливается экспрессия клетками субъединицы NR1, при этом число NR1позитивных клеток в контроле (инкубировавшихся без NMDA), не изменяется.

Оказалось, что антагонист NMDA-рецепторов MK-801 (25 мкМ) полностью нивелирует этот эффект. При этом инкубация клеток с одними агонистами и/или антагонистами NMDA-рецепторов в отсутствие ФГА не вызывала достоверных изменений экспрессии.

Различие между увеличением экспрессии мРНК к NR1 в клетках, активированных ФГА, качественная оценка которой была дана в предыдущем разделе работы, и отсутствием изменений в экспрессии самого белка, выявляемого при окраске клеток антителами, может объясняться как различной чувствительностью применяемых методов, так и неполной экстернализацией синтезированных белковых субъединиц на внешней мембране клетки. Так, известно, что в нейронах, экспрессирующих NMDA-рецепторы, идет конститутивный синтез субъединиц NR1, которые могут длительное время удерживаться в эндоплазматическом ретикулуме, избегая встраивания в цитоплазматическую мембрану. В результате, в нейронах обнаруживается большой пул свободных NR1-субъединиц, (неассоциированных с NR2субъединицами), что позволяет быстро регулировать численность и функциональную активность рецепторов в синапсе (Prybylowski and Wenthold, 2004). Таким образом, можно предположить, что, в проведенных нами экспериментах инкубация активированных периферических лимфоцитов с агонистом глутаматных рецепторов NMDA ведет к запуску процессов, приводящих либо к усилению синтеза рецепторных субъединиц, либо к активации процессов их экстернализации и сборки функционально активных рецепторов.

Несмотря на то, что механизмы, лежащие в основе наблюдаемого феномена, требуют дальнейшего изучения, проведенное исследование показывает, что существует положительная обратная связь между воздействием NMDA на периферические лимфоциты и экспрессией клетками рецепторов к этому лиганду, что может служить свидетельством вовлечения глутаматных рецепторов NMDA-класса в регуляцию процессов клеточной активации.

ВЫВОДЫ

1. Инкубация лимфоцитов периферической крови человека с агонистом ионотропных глутаматных рецепторов N-метил-D-аспартатом (в диапазоне концентраций 0,1-1 мМ) приводит к усилению люминол-индуцируемой хемилюминесценции клеточной суспензии, что свидетельствует о повышении уровня продукции свободнорадикальных соединений этими клетками. Этот эффект снимается при одновременной инкубации клеток в присутствии NMDA и его антагониста МК-801.

2. Анализ лимфоцитов методом проточной цитометрии показал изменение параметров светорассеяния клеток, а также увеличение уровня внутриклеточных АФК в результате инкубации с NMDA, что свидетельствует об изменении метаболического состояния клеток.

3. Показано, что в лимфоцитах человека экспрессируется мРНК к облигатной субъединице NR1 NMDA-рецептора.

4. Антитела, специфичные к внеклеточному домену NMDA-рецептора, связываются с клеточной поверхностью лимфоцитов человека, что свидетельствует об экспрессии рецепторного белка на лимфоцитарной мембране.

5. Показано, что экспрессия NR1-субъединицы NMDA-рецептора в лимфоцитах человека, активированных ФГА, увеличивается в результате инкубации с NMDA.

ПУБЛИКАЦИИ ПО ТЕМЕ ДИССЕРТАЦИИ

1. Тюлина О.В., Бычкова О.Н., Прокопьева В.Д., Болдырев А.А.

Гистидинсодержащие дипептиды и форменные элементы крови. // Проблемы гематологии, 2002, 4, с. 53-63.

2. Тунева Е.О., Бычкова О.Н., Болдырев А.А. Влияние NMDA на продукцию активных форм кислорода лимфоцитами человека. // Бюлл. эксп.

биол. мед., 2003, т. 36, № 8, с. 184-186.

3. Бычкова О.Н. Влияние NMDA на образование свободных радикалов в лимфоцитах человека. // В книге «Новые информационные технологии в медицине, биологии, фармакологии», Украина, Крым, 2005, с. 260-262.

4. Boldyrev A.A., Bulygina E.R., Davydova O.N., Mashkina A.P., Vladychenskaya E.A. Tyulina O.V. Functional role of glutamate receptors of NMDA-class in immune system. // Neurosci. Res., 2006, Vol. 55 (Suppl. 1), p. 67.

5. Болдырев А.А., Давыдова О.Н., Машкина А.П. Глутаматные рецепторы и регуляция окислительного стресса в нервной и иммунной системах. ХХ съезд физиологического общества им. И.П. Павлова, М. 2007, в печати.

Давыдова Ольга Николаевна (Российская Федерация) «Исследование NMDA-рецепторов лимфоцитов человека»

В работе охарактеризовано влияние агониста глутаматных рецепторов NMDA-класса, N-метил-D-аспартата, на лимфоциты периферической крови человека. Показано, что NMDA вызывает усиление люминол-зависимой хемилюминесценции суспензии клеток, а антагонист NMDA-рецепторов МКингибирует этот эффект. Методом проточной цитометрии продемонстрировано увеличение внутриклеточного уровня активных форм кислорода в лимфоцитах в присутствии NMDA, свидетельствующее об активации этих клеток. Методом ОТ-ПЦР была показана экспрессия в лимфоцитах периферической крови человека мРНК, кодирующей белковую субъединицу NR1 NMDA-рецепторного комплекса, синтез которой необходим для формирования функционально активного рецепторного комплекса. При помощи иммунофлуоресцентного окрашивания обнаружено, что около 5% нативных лимфоцитов периферической крови связывают антитела, специфичные к внешнему домену субъединицы NR1 NMDAрецептора. Экспрессия данного антигена на лимфоцитарной мембране возрастает при инкубации ФГА-стимулированных клеток в присутствии 0, мМ NMDA (до 90% после 72 ч инкубации), а антагонист NMDA-рецепторов МК-801 полностью ингибирует наблюдаемый эффект. Полученные данные свидетельствуют о том, что NMDA-рецепторы участвуют в регуляции функционального состояния лимфоцитов, и их активация лигандами глутамата приводит к усилению экспрессии глутаматных рецепторов NMDAкласса в активированных клетках.

“Characterization of NMDA-receptors in human lymphocytes»

Effect of glutamate agonist, N-methyl-D-aspartic acid, NMDA on human peripheral blood lymhocytes was studied. NMDA was found to induce luminaldependent chemiluminescence of lymphocyte suspension and NMDA antagonist, MK-801 suppressed this action. Using flow cytometric analysis, increase in intracellular level of reactive oxygen species was demonstrated in lymphocytes activated by NMDA. RT-PCR technique was used to monitor in human peripheral blood lymphocytes an mRNA coding the NR1 protein subunit of NMDA receptor complex, which formation is necessary to form functionally active receptor.

Immunofluorescent test was used to show that about 5% of native lymphocytes bind the antibodies to outer domain of NR1 subunit of NMDA receptor. After activation of the cells with phytohemagglutinin, PHA in the presence of 05 mM NMDA, amount of NMDA-positive cells is increased (till 90% after 72 hrs incubation) and MK-801 totally prevented this effect. The data presented demonstrate that NMDAreceptors in lymphocytes regulate their immune function and incubation of PHAactivated lymphocytes with glutamate agonists elevates an expression of glutamate receptors of NMDA-class.



 
Похожие работы:

«Нефедова Наталия Сергеевна МИНОРНЫЕ КОМПОНЕНТЫ МЕТАБОЛИЗМА В ИССЛЕДОВАНИИ МЕЖМОЛЕКУЛЯРНОГО ВЗАИМОДЕЙСТВИЯ 03.01.04 – Биохимия Автореферат диссертации на соискание ученой степени кандидата медицинских наук Челябинск 2013 2 Работа выполнена на кафедре фундаментальной и клинической биохимии с лабораторной диагностикой Государственного бюджетного образовательного учреждения высшего профессионального образования Самарский государственный медицинский университет Министерства...»

«БУРЦЕВ Игорь Александрович БИОЛОГИЧЕСКИЕ ОСНОВЫ ПОЛНОЦИКЛОВОГО КУЛЬТИВИРОВАНИЯ ОСЕТРОВЫХ РЫБ И СОЗДАНИЯ НОВЫХ ПОРОД МЕТОДАМИ ГИБРИДИЗАЦИИ И СЕЛЕКЦИИ 03.02.06 – ихтиология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Москва – 2013 Работа выполнена во Всероссийском научно-исследовательском институте рыбного хозяйства и океанографии (ФГУП ВНИРО), г. Москва Официальные оппоненты : доктор биологических наук, профессор Яржамбек Александр...»

«ЗЕНИНА Мария Александровна ОСТРАКОДЫ КАК ИНДИКАТОРЫ СОСТОЯНИЯ И ДИНАМИКИ ВОДНЫХ ЭКОСИСТЕМ (на примере северной части Амурского залива и акватории порта Владивосток) 03.00.18 – гидробиология Автореферат диссертации на соискание ученой степени кандидата биологических наук Владивосток - 2009 2 Работа выполнена в Лаборатории экологии бентоса Института биологии моря им. А.В. Жирмунского ДВО РАН Научный руководитель доктор биологических наук, старший научный сотрудник Шорников...»

«Шиенок Александр Николаевич ИСПОЛЬЗОВАНИЕ КОРМОВЫХ РЕСУРСОВ ОСТРОВНОЙ ПОПУЛЯЦИЕЙ ПЕСЦА (Vulpes lagopus semenovi Ognev, 1931) 03.02.04 – зоология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Москва 2014 Работа выполнена на кафедре зоологии позвоночных биологического факультета Московского государственного университета имени М.В.Ломоносова Научный руководитель : доктор биологических наук Крученкова Елена Павловна Официальные оппоненты :...»

«СОЛОВЬЕВА ИРИНА ВЛАДЛЕНОВНА МИКРОЭКОЛОГИЧЕСКИЕ ОСНОВЫ КОРРЕКЦИИ ДИСБИОЗНОЙ МИКРОБИОТЫ ЧЕЛОВЕКА 03.02.08 – экология (биология) 03.02.03 – микробиология АВТОРЕФЕРАТ на соискание ученой степени доктора биологических наук Нижний Новгород 2013 2 Работа выполнена в Федеральном бюджетном учреждении науки Нижегородский научно-исследовательский институт эпидемиологии и микробиологии им. академика И.Н.Блохиной Федеральной службы по надзору в сфере защиты прав потребителей и...»

«Цыганов Андрей Николаевич Морфологическая изменчивость, видовой состав и структура сообществ сфагнобионтных раковинных амёб Специальность 03.00.18 – Гидробиология 03.00.08 – Зоология Автореферат диссертации на соискание учёной степени кандидата биологических наук Москва – 2007 Работа выполнена на кафедре гидробиологии Биологического факультета МГУ им. М. В. Ломоносова. Научные руководители:...»

«ВЕРХУША Владислав Витальевич ФЛУОРЕСЦЕНТНЫЕ МАРКЕРЫ ДЛЯ МОЛЕКУЛЯРНОЙ И КЛЕТОЧНОЙ БИОЛОГИИ: ФЛУОРЕСЦЕНТНЫЕ ТАЙМЕРЫ, ПОСТОЯННО ФЛУОРЕСЦИРУЮЩИЕ И ФОТОАКТИВИРУЕМЫЕ БЕЛКИ 03.01.03 - молекулярная биология АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург 2011 Работа выполнена в Учреждении Российской академии наук Институт цитологии РАН и в Медицинском колледже им. А. Эйнштейна в Нью-Йорке Научный консультант : доктор...»

«1 НА ПРАВАХ РУКОПИСИ Анисимова Марина Анатольевна Детоксицирующая способность почв и выделенных из них гуминовых кислот по отношению к гербицидам 03.00.27-почвоведение АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук МОСКВА 1997 2 Актуальность темы. Применение средств химической защиты растений, ставшее неотъемлемым элементом практики современного земледелия, привело к возникновению проблемы загрязнения почвенного покрова остаточными количествами гербицидов и их...»

«Лысак Людмила Вячеславовна Бактериальные сообщества городских почв Специальность 03.02.03 – микробиология АВТОРЕФЕРАТ на соискание ученой степени доктора биологических наук Москва 2010 Работа выполнена на кафедре биологии почв факультета почвоведения Московского государственного университета имени М.В. Ломоносова Научный консультант : доктор биологических наук, профессор Звягинцев Дмитрий Григорьевич Официальные оппоненты : доктор биологических наук Карпачевский Лев Оскарович...»

«Кляйн Ольга Ивановна ВЗАИМОДЕЙСТВИЕ БАЗИДИАЛЬНЫХ ГРИБОВ С ГУМИНОВЫМИ ВЕЩЕСТВАМИ 03.01.04 Биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук МОСКВА – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт биохимии им. А.Н. Баха Российской академии наук и Федеральном государственном образовательном учреждении высшего профессионального образования Московский государственный университет имени М.В. Ломоносова...»

«Зайцева Юлия Анатольевна ПАРТЕНОГЕНЕТИЧЕСКАЯ АКТИВАЦИЯ И ХИМИЧЕСКАЯ ЭНУКЛЕАЦИЯ ООЦИТОВ КРЫС. ПРОЦЕССЫ ДЕМЕТИЛИРОВАНИЯ ДНК У РАННИХ ПРЕДИМПЛАНТАЦИОННЫХ ЭМБРИОНОВ КРЫС И МЫШЕЙ 03.00.25 Гистология, цитология, клеточная биология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Санкт-Петербург 2008 Работа выполнена в Центре молекулярной медицины имени Макса Дельбрюка (Берлин) и в Институте цитологии Российской акдемии наук (Санкт-Петербург) Научные...»

«Бедарева Ольга Михайловна ЭКОСИСТЕМЫ СРЕДНИХ ПУСТЫНЬ КАЗАХСТАНА И ИХ ИНВЕНТАРИЗАЦИЯ МЕТОДАМИ ДИСТАНЦИОННОГО ЗОНДИРОВАНИЯ 03.00.16 – экология АВТОРЕФЕРАТ диссертации на соискание учёной степени доктора биологических наук Калининград 2009 2 Работа выполнена в Федеральном государственном образовательном учреждении высшего профессионального образования Калининградский государственный технический университет Научные консультанты: академик Национальной Академии Наук Республики...»

«Миронова Виктория Владимировна КОМПЬЮТЕРНОЕ ИССЛЕДОВАНИЕ РОЛИ АУКСИНА В МОЛЕКУЛЯРНО-ГЕНЕТИЧЕСКОЙ РЕГУЛЯЦИИ РАЗВИТИЯ КОРНЯ РАСТЕНИЙ 03.01.09 – математическая биология, биоинформатика АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Новосибирск 2010 1 Работа выполнена в Учреждении Российской академии наук Институте цитологии и генетики СО РАН в лаборатории теоретической генетики, г. Новосибирск Научный руководитель : Доктор биологических наук,...»

«ИВОНИН АЛЕКСЕЙ ГЕННАДЬЕВИЧ ОЦЕНКА АДГЕЗИВНЫХ СВОЙСТВ ШТАММА YERSINIA PESTIS EV НИИЭГ НА МОДЕЛИ ЭРИТРОЦИТОВ 03.02.03 микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Казань 2010 2 Работа выполнена на кафедре морфологии и микробиологии ФГОУ ВПО Вятская государственная сельскохозяйственная академия Научный руководитель доктор биологических наук, профессор Романов Владимир Евдокимович Официальные оппоненты : доктор медицинских наук,...»

«САИДОВ АБДУСАТТОР САМАДОВИЧ РАСПРОСТРАНЕНИЕ, СИСТЕМАТИКА, ЭКОЛОГИЯ И ПРАКТИЧЕСКОЕ ЗНАЧЕНИЕ ГРЫЗУНОВ ТАДЖИКИСТАНА Специальность: 03.02.04 - зоология АВТОРЕФЕРАТ на соискание ученой степени доктора биологических наук Душанбе – 2011 Работа выполнена в Отделе экологии наземных позвоночных животных Института зоологии и паразитологии им. Е.Н.Павловского Академии наук Республики Таджикистан Научный консультант : академик АН Республики Таджикистан, доктор биологических наук,...»

«3 МОСКОВСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ имени М. В. Ломоносова _ ФАКУЛЬТЕТ ПОЧВОВЕДЕНИЯ НА ПРАВАХ РУКОПИСИ Куликова Наталья Александровна СВЯЗЫВАЮЩАЯ СПОСОБНОСТЬ И ДЕТОКСИЦИРУЮЩИЕ СВОЙСТВА ГУМУСОВЫХ КИСЛОТ ПО ОТНОШЕНИЮ К АТРАЗИНУ 03.00.27 –ПОЧВОВЕДЕНИЕ АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва- Работа выполнена на кафедре общего земледелия факультета почвоведения Московского Государственного Университета имени М. В. Ломоносова. Научные...»

«Шлеев Сергей Валерьевич Функционирование, механизм регуляции активности и возможное практическое использование голубых медьсодержащих оксидаз Специальность 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора химических наук Москва 2010 Работа выполнена в лаборатории химической энзимологии Учреждения Российской академии наук Института биохимии им. А.Н. Баха РАН Научный консультант : доктор химических наук, профессор Ярополов Александр Иванович...»

«ВОЛКОВА Наталья Александровна ФЕНОТИПИЧЕСКИЙ ЭФФЕКТ ЭКСПРЕССИИ РЕКОМБИНАНТНЫХ ГЕНОВ В ОРГАНИЗМЕ ТРАНСГЕННЫХ ЖИВОТНЫХ 03.00.23 – Биотехнология 03.00.13 – Физиология Автореферат диссертации на соискание ученой степени доктора биологических наук п. Дубровицы, Московская обл. 2008 1 Работа выполнена в Центре биотехнологии и молекулярной диагностики животных Государственного научного учреждения Всероссийский научноисследовательский институт животноводства Российской академии...»

«ЛАВРЕНЧЕНКО Леонид Александрович МЛЕКОПИТАЮЩИЕ ЭФИОПСКОГО НАГОРЬЯ: ПУТИ И ОСОБЕННОСТИ ФОРМИРОВАНИЯ ФАУНЫ ГОРНЫХ ТРОПИКОВ 03.00.08 – зоология Автореферат диссертации на соискание ученой степени доктора биологических наук Москва 2009 Работа выполнена в Учреждении Российской академии наук Институте проблем экологии и эволюции им. А.Н. Северцова РАН доктор биологических наук, профессор, Официальные оппоненты : Никольский Александр Александрович доктор биологических наук, Холодова...»

«Потапенко Наталья Христофоровна АДАПТАЦИОННАЯ ИЗМЕНЧИВОСТЬ ШЕЛКОВИЦЫ В УСЛОВИЯХ КЛИМАТИЧЕСКОГО СТРЕССА (НА ПРИМЕРЕ НИЖЕГОРОДСКОГО ПОВОЛЖЬЯ) Специальность: 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Нижний Новгород 2011 Работа выполнена на базе Ботанического сада Государственного образовательного учреждения высшего профессионального образования Нижегородский государственный университет им. Н.И. Лобачевского Научный...»








 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.