WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

КОЗИНА Ирина Владимировна

МОЛЕКУЛЯРНАЯ ДЕТЕКЦИЯ И НОВЫЕ ФЕНОТИПИЧЕСКИЕ

СВОЙСТВА ТЕРМОФИЛЬНЫХ БАКТЕРИЙ РОДОВ

THERMOANAEROBACTER И CALDANAEROBACTER

Специальность 03.00.07-микробиология

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Москва 2008

Работа выполнена в Институте микробиологии им. С.Н. Виноградского РАН

Научный руководитель: доктор биологических наук Е.А. Бонч-Осмоловская

Официальные оппоненты: доктор биологических наук профессор А.С. Яненко доктор биологических наук А.Н. Ножевникова

Ведущая организация: Биологический факультет Московского Государственного Университета им М.В. Ломоносова

Защита диссертации состоится «13» октября 2008 г. в ч.

на заседании Диссертационного совета Д.002.224.01 в Институте микробиологии им. С.Н. Виноградского РАН по адресу: 117312, Москва, Проспект 60-летия Октября, д.7, к.

С диссертацией можно ознакомиться в библиотеке Института микробиологии им.С.Н. Виноградского РАН

Автореферат разослан сентября 2008. г.

Ученый секретарь Диссертационного совета, кандидат биологических наук Т.В. Хижняк

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность работы. Интерес к термофильным микроорганизмам, которые активно исследуются последние два десятилетия, определяется задачами как фундаментального, так и прикладного характера. Последние в основном связаны с наличием у термофильных прокариот термостабильных ферментов и возможностью их применения в различных областях биотехнологии. Многие микробиологические и биохимические исследования посвящены органотрофным термофильным бактериям, в том числе обладающим способностью к гидролизу различных биомолекул. К ним относятся анаэробные умеренно-термофильные органотрофные бактерии, впервые описанные как представители рода Clostridium, но затем отнесенные к родам Thermoanaerobacterium и Thermoanaerobacter (Lee, 1993). В настоящее время в род Thermoanaerobacter входит 14 видов, выделенных из различных мест обитания:





горячих источников (Zeikus et al., 1979), цианобактериальных матов (БончОсмоловская и др., 1997), вулканических озер (Slobodkin et al., 1999), высокотемпературных нефтяных пластов (Cayol et al., 1995) и др. Это умеренные термофилы, облигатные анаэробы с бродильным типом метаболизма, способные в процессе брожения восстанавливать различные неорганические акцепторы электронов – серу, тиосульфат, окисное железо. Экстремально- термофильные организмы, первоначально отнесенные к этому роду (Xue et al., 2001; Kim et al., 2001), впоследствии реклассифицированы как представители нового рода Caldanaerobacter (Fardeau et al., 2004). Представители родов Thermoanaerobacter и Caldanaerobacter оказались способными к синтезу протеиназ с новыми, ценными для биотехнологии свойствами (Riessen et al., 2001, Jang et al., 2002). Однако можно предположить, что разнообразие метаболических свойств и биотехнологический потенциал этих микроорганизмов еще далеко не исчерпаны. Это делает актуальным детальное исследование распространения и метаболического разнообразия термофильных бактерий, относящихся к родам Thermoanaerobacter и Caldanaerobacter.

Цель работы. Целью данной работы являлось исследование распространения и разнообразия бактерий рода Thermoanaerobacter и Caldanaerobacter молекулярнобиологическими методами.

Основные задачи исследования состояли в следующем:

1. Разработка методов молекулярной детекции и/или идентификации термофильных бактерий родов Thermoanaerobacter и Caldanaerobacter;

2. Детекция термофильных бактерий рода Thermoanaerobacter и Caldanaerobacter в накопительных культурах и природных образцах;

3. Идентификация изолятов, фенотипически сходных с Thermoanaerobacter и Caldanaerobacter, но имеющих новые для этих родов свойства;

4. Выделение и характеристика новых представителей этих таксонов;

5. Характеристика ферментативных активностей и/или генов, кодирующих новые ферменты, у бактерий группы Thermoanaerobacter/Caldanaerobacter.

Научная новизна. Впервые разработаны олигонуклеотидные зонды для детекции и идентификации бактерий родов Thermoanaerobacter и Caldanaerobacter.

Доказана их высокая специфичность, что позволяет детектировать представителей Thermoanaerobacter и Caldanaerobacter непосредственно в накопительных культурах и природных образцах, а также идентифицировать штаммы без необходимости культивирования.

Полученные результаты расширяют представление о распространении и физиологии термофильных бактерий родов Thermoanaerobacter и Caldanaerobacter.

В то время как все известные ранее виды родов Thermoanaerobacter и Caldanaerobacter являлись нейтрофилами с минимальным рН роста 4.7, нами были идентифицированы как представители рода Thermoanaerobacter два анаэробных ацидофильных штамма, способные развиваться при рН 3.5. Впервые бактерии рода Thermoanaerobacter были обнаружены в пробах из глубоководных гидротерм.





Впервые для термофильных прокариот установлена способность микроорганизмов родов Thermoanaerobacter и Caldanaerobacter к гидролизу агарозы.

Установлено, что некоторым представителям рода Caldanaerobacter свойственна способность к анаэробному использованию СО с образованием водорода.

Сравнительное исследование генетических детерминант гидрогеногенной карбоксидотрофии, проведённое с помощью ПЦР с разработанными нами праймерами, показало их своеобразие у представителей Caldanaerobacter на фоне единства организации у ряда других филогенетически разнообразных термофилов.

Полученные данные подтверждаются результатами анализа полных геномов анаэробных кабоксидотрофов.

Практическая ценность работы. Разработанные нами олигонуклеотидные зонды позволяют идентифицировать представителей родов Thermoanaerobacter и Caldanaerobacter в накопительных и чистых культурах, минуя стадии определения фенотипических дескрипторов, а также детектировать их в природных образцах.

Полученные данные важны для развития представлений о распространении и физиологии родов Thermoanaerobacter и Caldanaerobacter. Разработанный нами метод может быть использован для экспресс-детекции изолятов, в том числе при поиске представителей новых филогенетических групп.

Описанные нами агаролитические штаммы могут быть использованы для получения термостабильной агаразы с целью ее применения в молекулярной биологии для освобождения нуклеиновых кислот и белков из тугоплавких агарозных гелей.

Разработанные нами методы детекции генетических детерминант гидрогеногенной карбоксидотрофии могут быть использованы для исследования экологии и распространения водородобразующих СО-трофов.

Апробация работы. Результаты исследований доложены на IV Международном Конгрессе «Экстремофилы-2002» (Италия, Неаполь, 2002), 1-ом Международном FEMS Конгрессе Европейский микробиологов (Словения, Любляна, 2003), ХV Международной зимней молодежной научной школе (Москва, 2003), VII Международной конференции «Термофилы-2003 (Экзетер, Англия), V Международном Конгрессе «Экстремофилы-2004» (США, Мэрилэнд, 2004), VIII Международной конференции «Термофилы-2005» (Серферс Парадайс, Австралия, 2005).

Публикации. По теме диссертации опубликованы 2 статьи, 9 тезисов, 1 статья находится в печати.

Объем работы. Диссертационная работа состоит из введения, обзора литературы и экспериментальной части, включающей глав, обсуждения и выводов, изложенных на страницах печатного текста и включает таблиц и рисунков.

Место проведения работы и благодарности. Работа выполнялась в лаборатории гипертермофильных микробных сообществ Института микробиологии им. С.Н. Виноградского РАН. Некоторые этапы работы были выполнены в лаборатории Центра Биоинженерии РАН под руководством к.б.н. Банниковой Г.Е.

Подбор олигонуклеотидных праймеров и зондов был проведен совместно с к.б.н.

А.В. Лебединским (ИНМИ РАН). Определение состава Г+Ц пар в ДНК и ДНК-ДНК гибридизацию выполняли совместно с к.б.н. Н.А. Черных (ИНМИ РАН). Анализ последовательностей 16S рРНК чистых культур микроорганизмов, а также ПЦР продуктов проводили совместно с к.б.н. Т.В. Колгановой (Центр Биоинженерии РАН) и к.б.н. Т.П. Туровой (ИНМИ РАН). Электронную микроскопию чистых культур микроорганизмов выполнила Н.А. Кострикина (ИНМИ РАН).

Автор выражает благодарность к.б.н. Н.А. Черных за помощь в освоении молекулярных методов, а также к.б.н. А.В. Лебединскому за постоянное внимание, советы и помощь на всех этапах молекулярной работы. Особенно признателен автор научному руководителю д.б.н. Е.А. Бонч-Осмоловской за интересную тему, обсуждение результатов, ценные советы и замечания на всех этапах работы.

СОДЕРЖАНИЕ РАБОТЫ

1. ОБЪЕКТЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Объекты исследования. В работе использовали чистые и накопительные культуры анаэробных термофильных микроорганизмов из коллекции Лаборатории гипертермофильных микробных сообществ Института микробиологии им. С.Н.

Виноградского РАН, а также природные образцы из гидротермальных источников кальдеры Узон и Долины гейзеров на Камчатке.

В качестве реперных организмов использовали типовые штаммы Thermoanaerobacter siderophilus (DSM 12299T), Thermoanaerobacter sulfurophilus (DSM 11584T), Thermoanaerobacter wiegelii (DSM 10319T), Thermoanaerobacter mathranii (DSM 11426T), Thermoanaerobacter italicus (DSM 9252T), Caldoanaerobacter subterraneus subsp. subterraneus (DSM 13054T), Caldoanaerobacter subterraneus subsp.

yonseiensis (DSM 13777T), Caldanaerobacter subterraneus subsp. tengcongensis (DSM 15242T); Caldanaerobacter subterraneus subsp. pacificus (DSM 12653T), Moorella glycerinii (DSM 11254T ), Thermoterrabacterium (=Carboxydothermus) ferrireducens (DSM 11255T) и Thermotoga maritima (DSM 3109T).

В исследованиях генетических детерминант гидрогеногенной карбоксидотрофии использовали СО-окисляющие бактерии Carboxydothermus hydrogenoformans (DSM 6008T), Carboxydocella thermautotrophica (DSM12356T), Thermosinus carboxydivorans (DSM 14886T), Thermincola carboxydiphila (DSM 17129T) и Thermolithobacter carboxydivorans (DSM 7242T), а также Bacillus subtilis ВКМ B-720 в качестве отрицательного контроля.

Условия культивирования. Культивирование анаэробных термофильных бактерий проводили в герметично закрывающихся флаконах объемом 10 мл на модифицированной среде Пфеннига, приготовленной согласно методам анаэробной техники (Hungate, 1966; Жилина, Заварзин, 1978) и содержащей (г/л): NH4Cl – 0.33;

KH2PO4 – 0.33; MgCl – 0.33; СaCl2 х6 Н2О – 0.33; NaHCO3 – 1.0; Na2Sх9 Н2О –0.5;

резазурин 0.001; дрожжевой экстракт – 0.05 - 0.5; 1 мл /л раствора микроэлементов (Pfennig, Lippert, 1966), 1 мл/л раствора витаминов (Wolin et al., 1963).

Для органотрофных представителей родов Thermoanaerobacter и Caldanaerobacter в качестве субстратов добавляли мальтозу или сахарозу (2.0 г/л; рН среды 6.5-7.0); культивирование проводили в атмосфере N2 или CO2.

Накопительные и неидентифицированные чистые культуры выращивали анаэробно согласно ранее описанной методике на среде 1 (минеральный фон среды Пфеннига, микроэлементы, витамины; Prokofeva, 2000) с различными донорами и акцепторами электронов. Органические субстраты добавляли в концентрации 3 г/л;

железоредуцирующие микроорганизмы культивировали на той же среде с добавлением 10 г/л пептона и 0.2 г/л дрожжевого экстракта; Fe(III) добавляли в среду в виде оксида Fe(III) (конечная концентрация 90 мM), Штаммы, выделенные из морских местообитаний, выращивали на среде 2 следующего состава (г/л): KCl – 0.325; MgCl – 2.75; MgSO4 – 3.45; NH4Cl – 0.25; СaCl2 ·2H2O – 0.15; K2HPO4 – 0.15;

NaCl - 18; NaHCO3 - 1; Na2S – 0.25; микроэлементы, 1 мл/л; витамины, 1 мл/л; в среду добавляли 2 г/л мальтозы и 2 г/л тиосульфата или 10 г/л серы и, при необходимости, дрожжевой экстракт, рН среды был от 6.8 до 7.0.

Ацидофильные штаммы и накопительные культуры растили на среде 1 с рН от 3.5 до 5.7.

Карбоксидотрофные штаммы культивировали на среде 1 с добавлением 0.5 г/л дрожжевого экстракта в атмосфере 100% окиси углерода, рН 6.8-7.0. Накопительную культуру GB2 растили на морской среде с СО в газовой фазе (Sokolova, 2001).

Все чистые и накопительные культуры инкубировали при 60°С, кроме накопительных культур К44, 432, 416, Kar (70°С), штамма 2707 (80°С) и штамма (55°С).

Микроскопические методы. Культуры наблюдали в световом микроскопе с фазово-контрастным устройством при увеличении 90х10 (ЛОМО АУ-12, Россия).

Тонкое строение клеток изучали с помощью стандартных методов фиксации клеток и окраски срезов (Reynolds, 1963), с использованием ультрамикротома LKB 3R и трансмиссионного электронного микроскопа JEM-100C (Jeol, Tokyo, Japan).

Подбор ПЦР-праймеров и зондов. ДНК, выделяли из чистых и накопительных культур и природных образцов, амплификацию генов 16S рРНК проводили с прямым бактериальным праймером Bact 8F и обратным универсальным обратным праймером 1492R (Lane, 1991). Праймеры, специфичные к генам СО-дегидрогеназ (СО-ДГ) и гидрогеназы и к генному кластеру, включающему гены гидрогеназы и СО-ДГ, разрабатывали на основания выравнивания с помощью программы MultAlin (Corpet, 1988) фрагментов последовательноcтей геномов Carboxydothermus hydrogenoformans DSM 6008T (номер NC_007503 в базе данных GenBank) и Rhodospirillum rubrum UR (U65510).

Для разработки олигонуклеотидных зондов использовали нуклеотидные последовательности 16S рДНК всех валидных видов Thermoanaerobacter и Caldanaerobacter, взятые из базы данных GenBank. Поиск зондов проводили с помощью программы ProbeDesigner (Субботина и др., 2003; Лебединский и др., 2007). Специфичность выбранных зондов дополнительно проверяли, используя программу NCBI BLASTN (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi).

Молекулярно-биологические методы. Выделение и очистку геномной ДНК из биомассы бактерий проводили по методу Мармура (Marmur, 1961). ПЦР проводили по стандартному протоколу Boehringer Mannheim с небольшими модификациями, используя прибор Perkin Elmer Cetus DNA Thermal Cycler модель 480 или многоканальный амплификатор ДНК Терцик ("ДНК-технология", Россия). Гельэлектрофорез и перенос по Саузерну проводили, следуя общепринятым методикам (Маниатис и др., 1984). Гибридизацию с олигонуклеотидными зондами и детекцию сигнала проводили согласно протоколам из лабораторного руководства Boehringer Mannheim (http://www.roche-applied-science.com/fst/products.htm?/prod_inf/manuals/dig_man/dig_toc.htm) с небольшими модификациями; все реактивы были производства Boehringer Mannheim.

Гибридизацию проводили в течение 12 часов при температуре, рассчитанной по формуле Tm-10°С, где Tm=81.5+16.61М+0.41[G+C]-820/n.

Для тестирования специфичности зондов в качестве контролей использовали ПЦР-продукт, полученный с праймерами Bact 8F и 1492R (Lane, 1991) на ДНК типовых штаммов ряда видов родов Thermoanaerobacter: T. siderophilus, T.

sulfurophilus, T. wiegelii (1я группа), T. mathranii, T. italicus (2я группа) и Сaldanaerobacter subterraneus subsp. yonseiensis, С. subterraneus subsp. pacificus, С.

subterraneus subsp. tengcongensis (3я группа). ПЦР продукты ДНК штаммов, относящихся к различным группам, служили отрицательными контролями для зондов на группы рода Thermoanaerobacter. Продукты амплификации, полученные на ДНК Moorella glycerinii и Thermoterrabacterium ferrireducens, служили отрицательным контролем для родового зонда и зондов на каждую из групп.

При подборе условий проведения ПЦР с праймерами, специфичными к генам СО-дегидрогеназ и гидрогеназы и к генному кластеру, включающему гены гидрогеназы и СО-ДГ, использовали ДНК Carboxydothermus hydrogenoformans в качестве положительного контроля и Bacillus subtilis как отрицательный контроль.

Секвенирование 16S рДНК и генов СО-ДГ проводили с помощью набора реактивов ABI PRISM® BigDye™Terminator v. 3.0 с последующим анализом продуктов реакции на автоматическом секвенаторе ABI PRISM 3100-Avant.

Филогенетические деревья генов 16S рРНК и генов СО-ДГ исследуемых бактерий были построены с помощью пакета программ TREECON (Van de Peer, De Wachter, 1994).

Определение агаразной активности. Клетки агаролитических штаммов и остатки агара отделяли в процессе центрифугирования в течение 20 минут при об/ мин, и супернатант использовали для определения агаразной активности. Осадок отмывали 0.1 M ацетатом натрия и затем центрифугировали в течение 20 минут при 12000 об/мин. Все процедуры проводили при комнатной температуре (20-25°С).

Содержание белка определяли с Coomassie Blue (метод Бредфорда). Агаразную активность измеряли путем определения концентрации восстанавливающих сахаров с динитросалициловой кислотой (DNSA).

2. РЕЗУЛЬТАТЫ ИССЛЕДОВАНИЙ И ИХ ОБСУЖДЕНИЕ

2.1. Детекция представителей родов Thermoanaerobacter и Cadanaerobacter с помощью олигонуклеотидных зондов 2.1.1. Проверка специфичности зондов Анализ филогенетического положения и структуры рода Thermoanaerobacter с помощью пакета программ TREECON показал (рис. 1.), что род хорошо обособлен от других родов и может быть подразделен на три филогенетические группы. Первая подгруппа включала T. wiegelii, T. siderophilus, T. sulfurophilus, T. brockii, T. kivui, T.

ethanolicus, T. acetoethylicus, T. thermohydrosulfuricus; вторая подгруппа T.

thermocopriae, T. mathranii и T. italicus; третья подгруппа T. tengcongensis, T.

yonseiensis и T. subterraneus. Анализ последовательностей 16S рДНК выявил, что третьей подгруппе рода Thermoanaerobacter близкородственен грамположительный СО-окисляющий, Н2-образующий термофил Carboxydobrahium pacificus (Sokolova et al., 2001). Позднее виды третьей подгруппы были выделены в новый род Caldanaerobacter, состоящий из одного вида и четырех подвидов: Caldoanaerobacter subterraneus subsp. subterraneus, C. subterraneus subsp. tengcongensis, C. subterraneus subsp. yonseiensis, C. subterraneus subsp. pacificus (Fardeau et al., 2004).

Были подобраны следующие зонды, специфичные для рода Thermoanaerobacter в целом и для трех его подгрупп (табл. 1).

Таблица 1. Олигонуклеотидные зонды на род Thermoanaerobacter и группы его видов Род Thermoanaerobacter Tab 827 GCTTCCGCDYCCCACACCTA Первая группа видов Tab_1 844 TTAACTACGGCACGRAATGCTTC Вторая группа видов Tab_2 424 CACTAMYGGGGTTTACAACC Третья группа видов Tab_3 184 TCCTCCATCAGGATGCCCTA (ныне род Caldanaerobacter) Рис. 1 Филогенетическое дерево, построенное на основе сравнения нуклеотидных последовательностей гена 16S рРНК, показывающее положение и структуру родов Thermoanaerobacter и Caldanaerobacter Для проверки специфичности зондов их гибридизовали с типовыми штаммами видов рода Thermoanaerobacter, принадлежащих к различным группам, и с представителями близких к роду Thermoanaerobacter родов Moorella и Thermoterrabacterium (сейчас Carboxydothermus) ferrireducens в качестве отрицательных контролей (рис. 2).

Общегрупповой зонд прореагировал со всеми ПЦР-продуктами, полученными с бактериальными праймерами на ДНК всех представителей рода Thermoanaerobacter и Caldanaerobacter. C ПЦР-продуктами, полученными с использованием ДНК отрицательных контролей, зонд сигнала не дал.

Зонд Tab_1 844, специфичный к первой группе рода Thermoanaerobacter, дал положительный сигнал с ампликоном T. sulfurophilus. С ПЦР-продуктами отрицательных контролей зонд не реагировал.

Зонд Tab_2 424, специфичный ко второй группе рода Thermoanaerobacter дал положительный сигнал с T. italicus. С ПЦР-продуктами отрицательных контролей зонд не реагировал.

Зонд Tab_3 184, специфичный к третьей группе рода Thermoanaerobacter дал положительный сигнал с C. subterraneus sub sp. pacificus. С отрицательными контролями зонд не реагировал.

Таким образом, результаты гибридизации подтвердили специфичность зондов и послужили основанием для их использования при анализе природных проб и накопительных культур. Разработанный нами метод позволил достоверно детектировать бактерии родов Thermoanaerobacter и Сaldanaerobacter, а также определять их принадлежность к одной из внутриродовых групп видов.

2.1.2. Идентификация чистых культур микроорганизмов С помощью ПЦР с бактериальными праймерами и последующей гибридизации с разработанными зондами были проанализированы неидентифицированные штаммы анаэробных термофильных микроорганизмов, морфологически сходных с Thermoanaerobacter. Полученние ПЦР-продукта с использованием бактериальным праймеров показало, что все исследуемые штаммы относятся к бактериям. Метод гибридизации с олигонуклеотидными зондами позволил не только отнести ряд штаммов к роду Thermoanaerobacter, но и установить принадлежность штаммов к той или иной из трех групп (табл. 2).

Таблица 2. Идентификация анаэробных термофильных бактерий путем гибридизации с олигонуклеотидными зондами на роды Thermoanaerobacter и Caldanaerobacter Примечание. «+», положительная реакция; «-», отсутствие положительной реакции; "н.о.", не определяли.

Было показано, что два организма, способных к гидролизу агарозы, относятся к первой группе рода Thermoanaerobacter, а один - к третьей группе этого рода (ныне род Caldanaerobacter). Способность к гидролизу агарозы – свойство, впервые обнаруженное у термофильных анаэробов.

Все известные до сих пор виды рода Thermoanaerobacter являлись нейтрофилами с минимальным рН роста 4.7. Мы обнаружили, что к роду Thermoanaerobacter относятся два анаэробных ацидофильных штамма, которые способны расти при рН 3.8 (штамм 518, выделенный из глубоководных гидротерм, и штамм 711, полученный из гидротерм Камчатки). Два штамма (518 и 107), выделенные из гидротерм Восточно-Тихоокеанского поднятия, оказались представителями 1-ой группы рода Thermoanaerobacter. Ранее представителей родов Thermoanaerobacter и Caldanaerobacter не обнаруживали в глубоководных гидротермах; единственным исключением является Caldanaerobacter subterraneus subsp. pacificus. Этот же организм отличался способностью к анаэробному росту с СО, сопряженному с образованием водорода из воды (Sokolova et al., 2001). Такой же тип метаболизма свойственен и штамму 2707, который был идентифицирован нами как представитель рода Caldanaerobacter.

2.1.3. Детекция представителей Thermoanaerobacter и Caldanaerobacter в накопительных культурах и природных образцах Присутствие представителей родов Thermoanaerobacter и Caldanaerobacter в накопительных культурах железовосстанавливающих, СО-окисляющих и ацидофильных органотрофных термофильных прокариот было исследовано с олигонуклеотидными зондами, приведенными выше (табл. 3).

Таблица 3. Детекция бактерий р. Thermoanaerobacter и Caldanaerobacter в анаэробных накопительных культурах, полученных в различных условия Обозначение Источник Фенотипические особенности ПЦР с Гибридизация с Во всех исследованных накопительных культурах присутствовали бактерии.

Однако при гибридизации с зондом Tab 827, общим для родов Thermoanaerobacter и Caldanaerobacter, положительный сигнал был получен лишь с ПЦР-продуктом из одной железовосстанавливающей накопительной культуры (К44). Таким образом, в остальных термофильных накопительных культурах исследуемые процессы осуществляют иные, чем Thermoanaerobacter и Caldoanaerobacter организмы, что делает перспективным их последующее выделение и характеристику.

Метод гибридизации с зондами на роды Thermoanaerobacter-Caldoanaerobacter был использован для обнаружения представителей этих родов в образцах из гидротермальных источников кальдеры Узон и Долины Гейзеров на Камчатке.

Продукт амплификацииДНК, выделенной из этих проб, с бактериальными праймерами был получен в 13 образцах из 20 проанализированных. При анализе продукта ПЦР методом гибридизации со специфическими олигонуклеотидными зондами, описанными выше, положительные сигналы с зондом на ThermoanaerbacterCaldanaerobacter были получены в трёх образцах. В этих же образцах детектировались представители первой группы рода Thermoanaerobacter (табл. 4).

Таблица 4. Детекция бактерий родов Thermoanaerobacter и Caldanaerobacter в пробах из наземных горячих источников Обозначение Характеристики Гибридизация с зондами природного места отбора пробы Примечание: н.д. - нет данных (гибридизация не проводилась).

Таким образом, представители рода Thermoanaerobacter были обнаружены в природных пробах с рН от 5.0 до 6.7 и температурой от 63 до 74 °С, что соответствует физиологическим характеристикам рода. Все детектированные микроорганизмы относились к I группе рода Thermoanaerobacter, что свидетельствует о ее широкой распространенности в наземных горячих источниках.

2.2. Характеристика представителей родов Thermoanaerobacter и Caldanaerobacter, обладающих новыми свойствами У идентифицированных нами методом гибридизации с олигонуклеотидными зондами представителей группы Thermoanaerobacter - Caldanaerobacter был выявлен ряд новых свойств: способность к гидролизу агарозы, рост на СО с образованием Н2.

Микроорганизмы, обладающие этими свойствами были исследованы нами детально.

2.2.1. Характеристика представителей родов Thermoanaerobacter и Caldoanaerobacter с агаролитической активностью Путем гибридизации с олигонуклеотидными зондами агаролитические штаммы В5 и К14 были идентифицированы как представители первой группы рода Thermoanaerobacter. Анализ последовательности генов 16S рРНК показал, что штамм В5 относится к виду Thermoanaerobacter wiegelii (99.8 % сходства), а штамм К наиболее близок к Thermoanaerobacter sulfurophilus (99.6% % сходства).

Принадлежность штамма К67 к роду Caldanaerobacter, установленная на основании гибридизации с группоспецифичными зондами, была подтверждена анализом последовательности гена 16S рРНК, показавшим 95.1- 96.3 % сходства с представителями рода Caldanaerobacter, что позволило отнести изолята K67 к новому виду этого рода.

В настоящее время род Caldoanaerobacter представлен четырьмя подвидами одного вида – Caldoanaerobacter subterraneus (Fardeau et al., 2004). Бактерии вида C.

subterraneus выделены из подземных местообитаний или из глубоководных гидротерм. Штамм К67 является первым представителем рода Cadlanaerobacter, выделенным из наземных гидротерм (из пробы цианобактериального мата источника Термофильный кальдеры Узон).

Ряд фенотипических признаков штамма К67 является общим для рода Caldoanaerobacter (табл. 5). Однако от подвидов C. subterraneus его отличает более низкий температурный оптимум и максимум роста, иной спектр используемых субстратов и одновременное образование водорода, этанола и лактата при брожении глюкозы. Процент ДНК-ДНК гибридизации штамма К67 с С. subterraneous subsp.

tencongensis составлял 51+0.5 %, а с типовым штаммом C.subterraneus subsp.

subterraneus (DSM 13054T) - 21+0.5 %, что подтверждает принадлежность штамма К67 к новому виду. Положение штамма К67 на филогенетическом дереве показано на рис.3.

Caldoanaerobacter жгутиков мин./опт./макс мин./опт./макс мин/опт/макс ДНК, мол.% 2.2.2. Описание нового вида Caldanaerobacter uzonensis К67Т Caldanaerobacter uzonensis (uzo.nen’sis N.L. masc adj. uzonensis, выделенный из Кальдеры Узон, Камчатка).

Клетки представлены палочками размером 0.3-0.5 х 2 -15 мкм, одиночными или в парах. Рост происходит в интервале температур 50-76 °С с оптимумом при 62-70 °С и в диапазоне рН 4.8-8.0 с оптимумом при 6.8. Строгий анаэроб, органогетеротроф, способен расти на различных сахарах, полисахаридах и пептидах. Использует лактозу, арабинозу, глюкозу, сахарозу, галактозу, ксилозу, декстрин, пируват, декстрозу, трегалозу, пептон, фруктозу, сорбит, крахмал. Слабый рост наблюдается на пектине, целлюлозе (фильтровальная бумага). Не растет на рамнозе, казеине, цистеине, рибозе, ксилане (рис. 4). Тиосульфат стимулирует рост, восстанавливаясь в сероводород. В процессе брожения на пептоне происходит восстановление слабокристаллического оксида Fe(III).Элементная сера, сульфат, сульфит, нитрат не восстанавливаются и на рост не влияют. Основными продуктами метаболизма при брожении на глюкозе являются ацетат, лактат, Н2, СО2, этанол.

цианобактериального мата источника Термофильный Кальдеры Узон, Камчатка.

2.2.3 Способность штаммов рода Caldanaerobacter к росту на СО Штамм 2707 был идентифицирован как представитель рода Caldanaerobacter.

Это второй член этого рода, помимо Caldanaerobacter subterraneus subsp. pacificus (Sokolova et al., 2001; Fardeau et al., 2004), способный к росту на СО с образованием водорода. Анализ последовательности гена 16S рРНК подтвердил принадлежность штамма 2707 к роду Caldoanaerobacter. Высокий уровень сходства последовательности 16S рРНК (98.6 %) и высокий уровень ДНК-ДНК гибридизации (80±0.5%) с С. subterraneus ssp. subterraneus позволяет отнести штамм 2707 к виду С.

subterraneus. Таким образом, способность к анаэробному росту с СО характерна для ряда штаммов этого вида.

2.3 Характеристика агаразной активности штаммов Thermoanaerobacter и Caldanaerobacter Штаммы К67 и В5 хорошо росли на среде с агарозой (от 0,3 до 2% ) как единственным субстратом роста. Однако наилучший рост наблюдался при добавлении от 1 г/л до 3г/л галактозы. Агаролитическую активность измеряли при различных концентрациях агарозы в среде, с внесением дополнительного субстрата и без него. Наибольшая активность наблюдалась при выращивании на 0.6% агарозе в присутствии 3 г/л галактозы. Из трех агаролитических штаммов (К67, К14 и В5) наиболее активным агаролитиком оказался штамм T. wiegelii В5. В процессе его роста агаролитическая активность была детектирована как в супернатанте, так и в осадке неразложившейся агарозы. Через 2-3 дня культивирования агаролитическая активность в супернатанте достигала 0.12-0.17 ед/мл; в осадке она обычно не превышала 18–20% от активности в супернатанте. Для выделения агаразы использовали культуральную жидкость штамма В5. Для выделения активного белка был использован препаративный электрофорез. После фильтрования и концентрирования был получен раствор фермента с суммарной активностью 18.8 ед.

при содержании белка 50 мкг (удельная активность 376 ед/мг).

Характеристика термостабильной агаразы. Молекулярная масса агаразы Thermoanaerobacter B5 была определена с помощью электрофореза в денатурирующих условиях и составила около 67 кДа. Изоточка фермента оказалась равна 4.2. Ферментативная активность проявлялась в диапазоне рН от 3.5 до 7.0 с максимумом при рН 5.2 (рис. 5). Ферментативная активность наблюдалась в интервале температуры от 50 до 80oC с максимумом при 70oC (рис.

6). При инкубации при 90oC в течение 60 мин агаразная активность не уменьшалась.

Таким образом, нами была выделена первая термостабильная агараза, продуцируемая анаэробной термофильной бактерией Thermoanaerobacter wiegelii штамм В5.

обуславливающего Анаэробное окисление СО с образованием водорода известно для нескольких мезофильных бактерий; наиболее изучена среди них фототрофная альфапротеобактерия Rhodospirillum rubrum (Kerby et al., 1995). Первым термофильным Carboxydothermus hydrogenoformans (Svetlichny et al., 1991). Из клеток C.

hydrogenoformans были выделены и очищены три Ni-содержащие СО-дегидрогеназы.

СО-дегидрогеназа 1 оказалась частью ферментного комплекса, осуществляющего окисление СО с образованием Н2 и генерацией трансмембранного потенциала. СОдегидрогеназа 2 участвует в восстановлении НАДФ. СО-дегидрогеназа 3 входит в энзиматический комплекс, осущестляющий ассимиляционный синтез ацетил-КоА из C-1 единиц ( Svetlitchny et al., 2001; Dobbek et al., 2001; Sobo et al., 2002; Svetlitchny et al., 2003). При анализе полного генома Carboxydothermus hydrogenoformans помимо генов cooS1, cooS2, cooS3 обнаружено присутствие еще двух генов, кодирующих анаэробные СО-ДГ с неизвестным пока функциями (cooS4, cooS5), а также показано значительное сходство генных кластеров, включающих ген cooS1 C.

hydrogenoformans и ген cooS R. rubrum (у R. rubrum этот генный кластер получил название кластера coo). Оба эти генных кластера содержат, помимо генов cooS, ген cooF ферредоксин-подобного переносчика электронов и гены мембраносвязанной гидрогеназы, состоящей из нескольких субъединиц, включая ген каталитической единицы cooH.

карбоксидотрофии играет энзиматический комплекс, кодируемый генным кластером соо, мы решили проверить его присутствие у способных к этому процессу представителей рода Caldanaerobacter, а также у других гидрогеногенных карбоксидотрофов, имеющихся в коллекции лаборатории. Для этого нами были разработаны пары праймеров cooS-I_160F - cooS-I_1804R на основе консенсусной последовательности нуклеотидов генов СО- дегидрогеназ cooS R. rubrum и cooS1 C.

hydrogenoformans, пара праймеров cooH_35F - cooH_963R на основе консенсусной последовательности нуклеотидов генов гидрогеназы cooH этих организмов, а также для выявления возможного присутствия этих генов в составе единых генных кластеров, пара праймеров cooH_963F - cooS-I_160R, из которых один отжигался бы на гене СО-ДГ, а другой - на гене гидрогеназы cooH (табл. 6).

Таблица 6. Праймеры, использовавшиеся для ПЦР-амплификации coo генов Названия Нуклеотидные последовательности, 5’- Мишень cooS-I_160F CCYTGTCGYATCGATCCMTTTGGC cooS-I_1804R AATAACCGCCCASCAARTCYTTSGC cooH_35F ATGTGGCCCTKGAAGAGCCGATGTA cooH_963R CCAGTTCATATARGTKGGWACSCGC cooH 963F GCGSGTWCCMACYTATATGAACTGG cooS-I_160R GCCAAAKGGATCGATRCGACARGG cooF_475F ATGCTGGTRGATTMCGAAAGYTATCG cooS-I_1304R GCAATRCCYTGAATGTTRCCGTTAA cooS-II_140F GCTGCCGSCACTGCCTGCARGGC cooS-II_1840R GGAGCTTWTCGGCCGCKGWYTCGGG cooS-III_267F YGGMGCTTCYGCSTGGACCATTG cooS-III_1723R TTACCGCTCATRGCTTCMGGRGCYG cooS-IV_167F GGATMGACCCYTTYGGRGAAGGA cooS-IV_864R GGTACARCAWATCCCRGCAASATTG cooS-V_142F CAGCTYTGCWSTAAYGGTCCTTGCGTC cooS-V_1663R cooS-II_1226R TGAGAGCATTGATGATGGCTTCCG cooS-III_1256R CCAGCTACAACTTTATGTTTAACC Кроме того, на основании анализа нуклеотидных последовательностей генов cooS2, cooS3, cooS4 и cooS5 СО-ДГ Carboxydothermus hydrogenoformans и генов родственных им СО-ДГ других организмов были разработаны пары праймеров для поиска подобных генов у гидрогеногенных карбоксидотрофов (табл. 6).

Полученные на первом этапе результаты показаны на рис. 7, из которого видно, что у представителей рода Caldanaerobacter выявить гены СО-ДГ не удалось.

В то же время гены СО-ДГ типа cooS1 выявились у гидрогеногенных карбоксидотрофов Thermolithobacter carboxydivorans и Thermosinus carboxydivorans.

На основании вновь определённых нуклеотидных последовательностей нами были разработана ещё одна пара праймеров на генный субкластер cooF - cooS1. Все полученные результаты представлены в таблице 7.

Таким образом, наши результаты показали своеобразие генетических детерминант гидрогеногенной карбоксидотрофии у представителей рода Caldanaerobacter на фоне единства их организации у ряда других филогенетически разнообразных термофилов. В дальнейшем анализ полного генома С. subterraneus subsp. pacificus подтвердил иную, чем у Carboxydothermus, организацию генного кластера, ответственного за процесс гидрогеногенной карбоксидотрофии у представителей род Caldanaerobacter.

Таблица. 7. Детекция генов, обуславливающих способность к анаэробному окислению СО с образованием водорода у коллекционных штаммов термофильных представителей Firmicutes hydrogenofomans ferrireducens pacificum tengcongensis yonseiensis Carboxydothermus hydrogenofoman

ЗАКЛЮЧЕНИЕ

Примененный нами метод гибридизации с олигонуклеотидными зондами позволил не только отнести ряд штаммов к группе ThermoanaerobacterCaldanaerobacter, но и дифференцировать штаммы по принадлежности к родам или одной из двух групп внутри рода Thermoanaerobacter. Полученные результаты расширяют представления о распространении и физиологических свойствах исследуемой группы термофильных прокариот. Впервые нами были обнаружены представители рода Thermoanaerobacter в глубоководных гидротермах ВосточноТихоокеанского поднятия. Обнаружено, что к роду Thermoanaerobacter, ранее включавшему только нейтрофилов, относятся два ацидофильных штамма, способных расти при рН 3.5.

Установлено, что три штамма, относящиеся к родам Thermoanaerobacter и Caldanaerobacter, способны к гидролизу агарозы (свойство, впервые обнаруженное у термофильных анаэробов). Ранее микроорганизмы с агаролитической активностью выделяли из морских местообитаний, где источником агара как субстрата для них служили морские красные водоросли. Наши данные указывают на то, что агаролитические прокариоты могут населять также наземные горячие источники, где субстратами для них могут являться полисахариды цианобактерий, образующих цианобактериальные маты (Герасименко и др., 1983; Намсараев и др., 2006).

Агаролитическая активность бактерий родов Thermoanaerobacter и Caldanaerobacter охарактеризована на примере штамма В5, идентифицированного нами как Thermoanaerobacter wiegelii. Фермент отличается высокой удельной активностью, высоким температурным оптимумом и может быть использован в препаративной молекулярной биологии.

Реклассифицированный французскими исследователями род Caldanaerobacter до настоящего времени содержал только один вид. В данной работе описана анаэробная термофильная бактерия (штамм К67), выделенная из горячего источника Камчатки, представляющая второй вид рода Caldanaerobacter - Caldanaerobacter uzonensis, sp nov.

Способность к анаэробному использованию СО с образованием водорода свойственна многим термофильным прокариотам (Sokolova et al., 2002, 2004 a,b, 2005, 2006, 2007). Мы установили, что способный как к росту на СО, так и к органотрофному росту штамм 2707, выделенный из гидротерм Камчатки, относится к роду Caldanaerobacter. Таким образом, это второй представитель этого рода, способный к анаэробному росту на СО с продукцией водорода.

Анализ функциональных генов, обуславливающих способность к росту на СО с образованием водорода у ряда анаэробных филогенетически разнообразных представителей Firmicutes позволил установить ключевую роль в этом процессе генного кластера, кодирующего ферментный комплекс СО-дегидрогеназы и гидрогеназы. Разработанный нами метод может быть применен для экологических исследований природных образцов и накопительных культур. Кластирование генов специализированной гидрогеназы и CO-дегидрогеназы может рассматриваться как специфический признак и геномный маркер филогенетически разнообразных гидрогеногенных карбоксидотрофов.

ВЫВОДЫ

1. Показано, что род Thermoanaerobacter может быть разделен на три филогенетические подгруппы, одна из которых была впоследствии реклассифицирована как новый род Caldanaerobacter.

2. Разработан метод идентификации и детекции представителей родов Thermoanaerobacter и Caldanaerobacter., основанный на ДНК-ДНК гибридизации на мембранах с помощью высокоспецифичных олигонуклеотидных зондов.

3. Установлено присутствие бактерий рода Thermoanaerobacter в глубоководных гидротермах Восточно- Тихоокеанского поднятия.

4. Среди идентифицированных представителей родов Thermoanaerobacter и Caldanaerobacter обнаружены штаммы, обладаюшие новыми для этих родов свойствами - способностью к гидролизу агарозы (Thermoanaerobacter и Caldanaerobacter) и ацидотолерантностью (Thermoanaerobacter), что расширяет представления о физиологии этих родов.

5. Впервые выделены термофильные агаролитические бактерии.Они идентифицированы как представители родов Thermoanaerobacter и Caldanaerobacter.

Описан новый вид Caldanaerobacter uzonensis, являющийся вторым видом этого рода.

6. Охарактеризована агаролитическая активность штаммов Thermoanaerobacter и Caldanaerobacter – первых продуцентов термостабильной агаразы.

7. Установлено, что некоторым представителям рода Caldanaerobacter свойственна способность к анаэробному использованию СО с образованием водорода.

8. Показано своеобразие генетических детерминант гидрогеногенной карбоксидотрофии у представителей рода Caldanaerobacter на фоне единства их организации у ряда других филогенетически разнообразных термофилов.

1. Субботина И.В., Черных Н.A., Лебединский А.В., Кубланов И.В., Бонч-Осмоловская E.A..

Олигонуклеотидные зонды для детекции представителей рода Thermoanaerobacter. Микробиология.

2003.Т. 72. С. 374-382.

2. Банникова Г.А., Субботина И.В., Лопатин С.В., Варламов В.В., Бонч-Осмоловская Е.А..

Агаролитические термофильные бактерии р. Thermoanaerobacter и Caldanaerobacter и характеристика термостабильной агаразы из Thermoanaerobacter wiegelii B5. Прикл. биохим.

микробиол., 2008. Т. 44. С. 404-409.

3. Kozina I., Hodges M., Lee K., Wagner I., Wiegel J., Slobodkin A., Tourova T., BonchOsmolovskaya E., Sokolova T. Isolation of Caldanaerobacter strains from terrestrial hot springs and description of Caldanaerobacter uzonensis sp. nov. Int. J. Syst. Evol. Microbiol., in press 4. Kublanov I.V., Prokofeva M.I., Subbotina I.V., Tourova T.P., Bonch-Osmolovskaya E.A.

Anaerobic thermophilic, moderately acidophilic bacteria from Kamchatka hot springs. Book of abstracts «The 4th International Congress on Extremophiles» September 22-26, 2002, Naples, Italy.

5. Subbotina I.V., Chernyh N.A., Lebedinskii A.V., Kublanov I.V., Bonch-Osmolovskaya E.A.

Oligonucleotide probes for the detection and identification of the members of the genus Thermoanaerobacter. Book of abstracts «The 4th International Congress on Extremophiles» September 22-26, 2002, Naples, Italy.

6. Субботина И.В., Черных Н.А., Лебединский А.В., Бонч-Осмоловская Е.А.

Олигонуклеотидные зонды для детекции представителей рода Thermoanaerobacter. Тезисы стендовых сообщений XV международной зимней научной школы «» 10-14 февраля 2003 г.Москва, 2003, стр.

7. Kublanov I.V., Prokofeva M.I., Subbotina I.V., Turova T.P., Bonch-Osmolovskaya E.A.

Moderately acidophilic, thermophilic, anaerobic bacteria from Kamchatka hot springs.//Book of abstracts «Ist FEMS Congress of European Microbiologists», June 29- July 3, 2003. Slovenia, 2003.- P.

180.

8. Subbotina I.V., Chernyh N.A., Lebedinskii A.V., Kublanov I.V., Bonch-Osmolovskaya E.A.

Detection of members of the genus Thermoanaerobacter using oligonucleotide probes.// Book of abstracts «Ist FEMS Congress of European Microbiologists», June 29- July 3, 2003. Slovenia, 2003.- P. 181.

9. Lebedinsky A.V., Subbotina I.V., Chernyh N.A., Sokolova T.G., Robb F.T., Bonch-Osmolovskaya E.A. Molecular markers of hydrogenogenic carboxydotrophy.// 10th International Symposium on Microbial Ecology, Cancun, Mexico, August 22 - 27 2004. Abstracts, p. 258.

10. Lebedinsky A., Subbotina I., Chernyh N., Sokolova T., Robb F., Bonch-Osmolovskaya E. Is the metabolism of diverse hydrogenogenic carboxydotrophs determined by specific-type carbon monoxide dehydrogenases and hydrogenases?//Book of abstracts «The Vth International Congress on Extremophiles», September 12-23, 2004.- P. 54.

11. Slepova T.V., Subbotina I.V., Chernyh N.A., Tourova T.P., Kostrikina N.A., Sokolova T.G.

Carboxydocella sporoforma sp. nov., a novel anaerobic, thermophilic, CO-utilizing hydrogenogenic bacterium from a Kamchatka hot spring.// Book of abstracts «The Vth International Congress on Extremophiles», September 12-23, 2004.-P. 113.

12. Lebedinsky A.V., Subbotina I.V., Slepova T.V., Chernyh N.A., Sokolova T.G., Occurrence of coo-Type Gene Clusters in Phylogenetically Diverse Thermophilic CO-Oxidizing H2-Producing Prokaryotes.// Thermophiles 2005, 8th Int. Conf. on Thermophiles Research, Gold Coast, Australia, September 18-22, 2005, Program and Abstracts, Griffith University, P46, pp. 125-126.



 
Похожие работы:

«Вагун Илья Владимирович Продукционный процесс и фиторемедиационный потенциал сортов рапса на загрязненных тяжелыми металлами почвах Специальность 03.01.05 – физиология и биохимия растений Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2011 Работа выполнена на кафедре физиологии растений Российского государственного аграрного университета – МСХА имени К.А. Тимирязева Научные руководители: доктор биологических наук, профессор Кошкин...»

«ЗОЛОТАРЁВ Дмитрий Александрович ХОРТОБИОНТНЫЕ ПОЛУЖЕСТКОКРЫЛЫЕ (INSECTA: HEMIPTERA=HETEROPTERA) АНТРОПОГЕННО ТРАНСФОРМИРОВАННЫХ ТЕРРИТОРИЙ (на примере г. Кемерово) Специальность 03.00.08 Зоология Автореферат диссертации на соискание учёной степени кандидата биологических наук Томск 2005 Работа выполнена на кафедре зоологии и экологии ГОУ ВПО Кемеровский государственный университет. Научный руководитель : кандидат биологических наук, доцент Н. И. Еремеева Официальные оппоненты...»

«СИЛАНТЬЕВА МАРИНА МИХАЙЛОВНА ФЛОРА АЛТАЙСКОГО КРАЯ: АНАЛИЗ И ИСТОРИЯ ФОРМИРОВАНИЯ 03.00.05 – “Ботаника” АВТОРЕФЕРАТ диссертации на соискание ученой степени доктора биологических наук Новосибирск – 2008 Работа выполнена в Алтайском государственном университете Научный консультант : доктор биологических наук, чл.-корр. РАН Камелин Рудольф Владимирович Официальные оппоненты : доктор биологических наук, профессор Ревушкин Александр Сергеевич доктор биологических наук, профессор...»

«Иванищева Елизавета Александровна ЛАНДШАФТНО-БИОЛОГИЧЕСКОЕ ОБОСНОВАНИЕ ЭКОЛОГИЧЕСКОГО КАРКАСА СЕВЕРО-ЗАПАДА ВОЛОГОДСКОЙ ОБЛАСТИ 03.02.08. – экология (биология) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Владимир – 2013 Работа выполнена в лаборатории моделирования экосистем Федерального государственного бюджетного учреждения науки Институт физико-химических и биологических проблем почвоведения Российской академии наук Научный руководитель...»

«Горобцова Ольга Николаевна Экологическая оценка уровня загрязнения почв и растительности 3,4-бенз(а)пиреном в зоне влияния Новочеркасской ГРЭС 03.00. 27 – почвоведение 03.00.16 - экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону 2007 2 Работа выполнена на кафедре агроэкологии и физиологии растений Донского государственного аграрного университета Научный руководитель : доктор биологических наук, профессор Назаренко Ольга...»

«ИЛЬИЧЕВА Екатерина Юрьевна МЕХАНИЗМЫ ВЛИЯНИЯ ИОНОВ СЕРЕБРА НА МЕТАБОЛИЗМ МЕДИ МЛЕКОПИТАЮЩИХ 03.01.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Санкт-Петербург, 2014 Работа выполнена в Федеральном государственном бюджетном учреждении Научно-исследовательский институт экспериментальной медицины СевероЗападного отделения Российской академии медицинских наук Научный руководитель : Доктор биологических наук, профессор Цымбаленко...»

«САДЕКОВА ОЛЬГА НИКОЛАЕВНА Генетические маркеры привычного невынашивания беременности I триместра 14.01.01 - Акушерство и гинекология 03.01.04 – Биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата медицинских наук Москва 2012 Работа выполнена на кафедре биохимии и молекулярной медицины Факультета фундаментальной медицины ФГБОУ ВПО Московский государственный университет имени М.В.Ломоносова Научные руководители: ООО Клиника на Петровке доктор медицинских...»

«ПОДОСОКОРСКАЯ ОЛЬГА АНДРЕЕВНА НОВЫЕ АНАЭРОБНЫЕ ТЕРМОФИЛЬНЫЕ ЦЕЛЛЮЛОЛИТИЧЕСКИЕ МИКРООРГАНИЗМЫ Специальность 03.02.03 – микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва – 2013 Работа выполнена в Федеральном государственном бюджетном учреждении науки Институт микробиологии им. С.Н. Виноградского Российской академии наук (ИНМИ РАН) Научный руководитель : Бонч-Осмоловская Елизавета Александровна доктор биологических наук...»

«Димитриев Юрий Олегович СОВРЕМЕННОЕ ЭКОЛОГИЧЕСКОЕ СОСТОЯНИЕ ФЛОРЫ УРБАНИЗИРОВАННЫХ ТЕРРИТОРИЙ ЛЕСОСТЕПНОЙ ЗОНЫ (НА ПРИМЕРЕ ГОРОДА УЛЬЯНОВСКА) 03.02.01 – Ботаника 03.02.08 – Экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Сыктывкар – 2011 2 Работа выполнена на кафедре ботаники ГОУ ВПО Ульяновский государственный педагогический университет имени И.Н. Ульянова Научный руководитель : кандидат биологических наук, доцент Масленников Андрей...»

«Левицкая Наталья Николаевна Критерии и индикаторы для оценки состояния лесов Московской области Специальность 03.02.08 – Экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва – 2012 Диссертационная работа выполнена в Федеральном государственном бюджетном учреждении науки Центр по проблемам экологии и продуктивности лесов РАН Научный руководитель : Черненькова Татьяна Владимировна, доктор биологических наук, ведущий научный сотрудник...»

«КАШЕВАРОВ Глеб Сергеевич СТРУКТУРА И ПРОСТРАНСТВЕННО-ВРЕМЕННАЯ ИЗМЕНЧИВОСТЬ ДРИФТА БЕСПОЗВОНОЧНЫХ РЕК МЁША, КАЗАНКА И НОКСА (РЕСПУБЛИКА ТАТАРСТАН) Специальность 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Казань – 2013 Работа выполнена на кафедре биоресурсов и аквакультуры (ранее кафедра зоологии позвоночных) Института фундаментальной медицины и биологии ФГАОУ ВПО Казанский (Приволжский) федеральный университет Научный...»

«Смирнов Иван Алексеевич Модельные ассоциации на основе базидиальных грибов и фототрофных микроорганизмов Специальность 03.00.24 – микология Автореферат диссертации на соискание ученой степени кандидата биологических наук Москва 2010 Диссертационная работа выполнена на кафедре микологии и альгологии биологического факультета Московского государственного университета имени М.В.Ломоносова Научный...»

«САВИНОВ Иван Алексеевич Система и эволюция порядка Celastrales на основе данных сравнительной морфологии 03.02.01 – Ботаника Автореферат диссертации на соискание ученой степени доктора биологических наук Санкт-Петербург - 2011 2 Работа выполнена в Учреждении Российской академии наук Главный ботанический сад им. Н.В. Цицина РАН и в ГОУ ВПО Московский государственный университет прикладной биотехнологии Официальные оппоненты : доктор биологических наук, профессор,...»

«Мошарова Ирина Викторовна ЭКОЛОГИЯ БАКТЕРИЙ, ТРАНСФОРМИРУЮЩИХ ПОЛИХЛОРИРОВАННЫЕ БИФЕНИЛЫ, И ИХ МЕСТО В СОСТАВЕ МОРСКОГО ГЕТЕРОТРОФНОГО БАКТЕРИОПЛАНКТОНА Специальность 03.00.16 - Экология Специальность 03.00.18 – Гидробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва - 2 Работа выполнена в Институте Глобального Климата и Экологии Росгидромета и...»

«Бытотова Светлана Васильевна ЭНДЕМИКИ ФЛОРЫ РЕСПУБЛИКИ ХАКАСИЯ: СИСТЕМАТИКА, ПРОИСХОЖДЕНИЕ, БИОЛОГИЯ 03. 00. 05. – Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск – 2007 Работа выполнена на кафедре ботаники ГОУ ВПО Томский государственный университет Научный руководитель : доктор биологических наук, профессор Гуреева Ирина Ивановна Официальные оппоненты : доктор биологических наук Тимошок Елена Евгеньевна лаборатория динамики и...»

«Потапенко Наталья Христофоровна АДАПТАЦИОННАЯ ИЗМЕНЧИВОСТЬ ШЕЛКОВИЦЫ В УСЛОВИЯХ КЛИМАТИЧЕСКОГО СТРЕССА (НА ПРИМЕРЕ НИЖЕГОРОДСКОГО ПОВОЛЖЬЯ) Специальность: 03.02.08 – экология АВТОРЕФЕРАТ диссертации на соискание учёной степени кандидата биологических наук Нижний Новгород 2011 Работа выполнена на базе Ботанического сада Государственного образовательного учреждения высшего профессионального образования Нижегородский государственный университет им. Н.И. Лобачевского Научный...»

«МАТВЕЕВА Анжелика Рафиковна СЕКРЕТИРУЕМЫЕ ПРОТЕАЗЫ НЕКОТОРЫХ МИЦЕЛИАЛЬНЫХ ГРИБОВ: ВЫДЕЛЕНИЕ, ОЧИСТКА И ХАРАКТЕРИСТИКА ФИЗИКО-ХИМИЧЕСКИХ И ФУНКЦИОНАЛЬНЫХ СВОЙСТВ 03.00.24-микология 03.00.04-биохимия АВТОРЕФЕРАТ на соискание ученой степени кандидата биологических наук Москва 2008 Работа выполнена на кафедре микологии и альгологии биологического факультета и в отделе функциональной биохимии...»

«Качалов Иван Юрьевич ЛАНДШАФТНО-ЭКОЛОГИЧЕСКИЕ ЗАКОНОМЕРНОСТИ ФИТОРАЗНООБРАЗИЯ ЛУГОВ В БАССЕЙНЕ НИЖНЕГО ТЕЧЕНИЯ Р. ВЯТКА Специальность 03.00.16 – экология Автореферат диссертации на соискание ученой степени кандидата биологических наук Казань – 2006 Работа выполнена на кафедре общей экологии государственного образовательного учреждения высшего профессионального образования Казанский государственный университет имени В. И. Ульянова-Ленина Научный руководитель : доктор...»

«ВОЙКИНА АННА ВЛАДИМИРОВНА НАКОПЛЕНИЕ ПЕСТИЦИДОВ В КОМПОНЕНТАХ ЭКОСИСТЕМ ТАГАНРОГСКОГО И ЯСЕНСКОГО ЗАЛИВОВ АЗОВСКОГО МОРЯ И ИХ АДДИТИВНОЕ ВОЗДЕЙСТВИЕ НА ГИДРОБИОНТОВ 03.02.08 — экология (биологические наук и) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону - 2013 2 Работа выполнена в ФГУП Азовский научно-исследовательский институт рыбного хозяйства (АзНИИРХ), г. Ростов-на-Дону и на кафедре экологии и природопользования Южного...»

«верситет на кафедре зоологии Научный консультант доктор биологических наук, профессор Рахимов Ильгизар Ильясович Официальные оппоненты : доктор биологических наук, профессор Шураков Аркадий Иванович доктор биологических наук, профессор Маматов Анвар Фаризунович Молодовский Анатолий Васильевич доктор биологических наук, профессор ВОДОПЛАВАЮЩИЕ ПТИЦЫ...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.