WWW.DISS.SELUK.RU

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА
(Авторефераты, диссертации, методички, учебные программы, монографии)

 

На правах рукописи

МОГИЛЕНКО

Денис Александрович

РЕГУЛЯЦИЯ ЭКСПРЕССИИ ГЕНА

АПОЛИПОПРОТЕИНА A-I ЧЕЛОВЕКА

ПРИ ДЕЙСТВИИ ФАКТОРА НЕКРОЗА ОПУХОЛИ АЛЬФА

03.01.04 – Биохимия

АВТОРЕФЕРАТ

диссертации на соискание ученой степени кандидата биологических наук

Санкт-Петербург 2010 г.

Работа выполнена в Отделе биохимии Учреждения Российской академии медицинских наук Научно-исследовательский институт экспериментальной медицины СевероЗападного отделения РАМН, Санкт-Петербург

Научный руководитель: доктор биологических наук, профессор Андрей Петрович Перевозчиков

Официальные оппоненты: доктор биологических наук, профессор Владимир Николаевич Кокряков доктор биологических наук, Ирина Владимировна Гужова Ведущее научное учреждение: Санкт-Петербургский Государственный Университет

Защита состоится «28» октября 2010 года в 1300 часов на заседании Диссертационного совета Д 001.022.03 в Учреждении Российской академии медицинских наук Научноисследовательский институт экспериментальной медицины Северо-Западного отделения РАМН по адресу: 197376, Санкт-Петербург, Каменноостровский проспект, дом 69/71.

С диссертацией можно ознакомиться в библиотеке Учреждения Российской академии медицинских наук Научно-исследовательский институт экспериментальной медицины Северо-Западного отделения РАМН по адресу: 197376, Санкт-Петербург, улица Академика Павлова, дом 12.

Автореферат разослан «_» сентября 2010 г.

Ученый секретарь диссертационного совета, доктор биологических наук, профессор Пучкова Л. В.

ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность проблемы. В фундаментальных медико-биохимических исследованиях было установлено, что высокий уровень аполипопротеина А-I (ApoA-I) в плазме крови коррелирует с низким риском развития атеросклероза и ишемической болезни сердца. ApoA-I человека входит в состав липопротеинов высокой плотности (ЛПВП), участвует в обратном транспорте холестерола из периферических тканей в печень, обладает антиоксидантными и противовоспалительными свойствами и, по-видимому, может выступать в роли сигнальной молекулы. Известно, что главными местами экспрессии гена apoA-I и синтеза белка ApoA-I у человека являются гепатоциты печени и энтероциты тощей кишки. Экспрессия гена apoA-I обнаружена также в плаценте, сердце, хрящевой ткани и в клетках желточного мешка зародышей млекопитающих. Вместе с тем, регуляция экспрессии гена apoA-I в клетках, отличных от энтероцитов и гепатоцитов, недостаточно охарактеризована.





В настоящее время все больше внимания вызывает представление об атеросклерозе как о процессе хронического воспаления (Hansson and Libby, 2006). Одним из ключевых факторов, участвующих в процессе воспаления при развитии атеросклеротических повреждений сосудов, является фактор некроза опухоли альфа (TNF) (Canault et al., 2008). TNF угнетает транскрипцию и снижают секрецию apoA-I в гепатоцитах человека (Song et al., 1998; Haas et al., 2003), а также приводит к уменьшению как содержания ApoA-I в составе ЛПВП, так и уровня ЛПВП в плазме крови (Khovidhunkit et al., 2004; Esteve et al., 2005).Тем не менее, молекулярные механизмы регуляции экспрессии гена apoA-I при действии провоспалительных цитокинов все еще недостаточно изучены. Интересным и важным является изучение регуляции экспрессии гена apoA-I при действии провоспалительных цитокинов, таких как TNF, в гепатоцитах и клетках моноцитарно-макрофагального ряда.

Цели работы. Целью диссертационной работы является изучение тканеспецифической регуляции экспрессии гена apoA-I человека при действии TNF в клетках HepG2 и THP-1, а также выяснение роли сигнальных путей JNK, p38, MEK1/2, NFB и ядерных рецепторов HNF4, PPAR, PPAR и LXRs в этом процессе.

Задачи исследования.

1. Изучить регуляцию экспрессии гена apoA-I в клетках гепатомы человека HepG2 при действии TNF.

2. Исследовать возможность экспрессии гена apoA-I в клетках моноцитарно-макрофагального ряда человека THP-1 и её регуляции 3. Изучить роль сигнальных путей JNK, p38, MEK1/2 и NFB, а также ядерных рецепторов HNF4, PPAR, PPAR и LXRs в регуляции экспрессии гена apoA-I в клетках HepG2 и THP-1.

Научная новизна полученных результатов. Впервые показано участие ядерного рецептора PPAR в регуляции экспрессии гена apoA-I в клетках гепатомы человека (HepG2). Установлена роль ядерных рецепторов HNF4, PPAR, PPAR и LXRs в TNF-зависимом подавлении экспрессии гена apoA-I в клетках HepG2.

Впервые показано, что ген apoA-I экспрессируется в культивируемых человеческих клетках моноцитарно-макрофагального ряда – THP-1, в моноцитах и макрофагах, полученных из периферической крови человека, в перитониальных макрофагах мыши, причём экспрессия этого гена стимулируется при добавлении к клеткам провоспалительного цитокина TNF.

Показано участие сигнальных путей JNK, p38, MEK1/2, NFB и ядерных рецепторов PPAR и LXRs в TNF-зависимой стимуляции экспрессии гена apoA-I в клетках THP-1.





Практическое значение результатов исследования. Полученные результаты расширяют наши представления о тканеспецифической регуляции экспрессии гена apoA-I, а также указывают на механизмы регуляции экспрессии этого гена при действии на клетки провоспалительного цитокина TNF. Предложена гипотеза о противовоспалительной роли эндогенно-синтезированного ApoA-I в клетках моноцитарно-макрофагального ряда.

Результаты, полученные в этой работе, дополняют представления о роли TNF и ApoA-I в развитии нарушений липидного обмена и могут быть использованы при разработке методов тканеспецифической регуляции экспрессии гена apoA-I с целью терапии атеросклероза.

Основные положения, выносимые на защиту:

• Показана роль сигнальных путей JNK, p38, MEK1/2 и NFB в угнетении экспрессии гена apoA-I в клетках HepG2 при действии • Показана экспрессия гена apoA-I в клетках моноцитарномакрофагального ряда THP-1 и установлена TNF-зависимая активация транскрипции этого гена.

• Установлено, что сигнальные пути JNK, p38, MEK1/2 и NFB принимают участие в активации экспрессии гена apoA-I в клетках THPпри действии TNF.

• Выяснено участие ядерных рецепторов HNF4, PPAR, PPAR и LXRs в TNF-зависимом подавлении экспрессии гена apoA-I в клетках HepG2, а также установлено, что PPAR и LXRs участвуют в активации транскрипции гена apoA-I в клетках THP-1 при действии Апробация работы. Основные результаты диссертационной работы докладывались в виде устных и стендовых сообщений на следующих конференциях:16-ая Международная конференция «СПИД, рак и общественное здоровье», 28 мая – 1 июня, 2007 г., Санкт-Петербург, Россия;

17-ая Международная конференция «СПИД, рак и общественное здоровье», 26 – 30 мая, 2008 г., Санкт-Петербург, Россия; XIII Всероссийский форум «Дни иммунологии в Санкт-Петербурге», 8-11 июня 2009 г., СанктПетербург, Россия; Международная научная конференция студентов, аспирантов и молодых учёных «Ломоносов-2009», 13-18 апреля, 2009 г., Москва, Россия; 34th FEBS Congress, 4-9 июля, 2009 г., Prague, Czech Republic; International Conference “Modern Microscopy Techniques in Biology and Medicine”, 9-10 November 2009, St. Petersburg, Russia.

Публикации. По материалам диссертации опубликовано 10 печатных работ, из них 4 статьи в рецензируемых журналах из списка ВАК РФ.

Личный вклад автора в проведении исследования. Соискателем были проведены: анализ литературы по теме исследования, планирование экспериментов, получение основной части результатов, написание статей и подготовка докладов на конференциях. Выделение РНК и клеточных белков, реакции обратной транскрипции и Real Time RT-PCR, иммунопреципитация хроматина, иммуноцитохимия, Вестерн-блоттинг, конструирование генетических конструкций, люциферазный тест и выделение ядерных белков выполнены соискателем. Культивирование клеточных линий HepG2 и THP- выполнено совместно с к.б.н. Э.Б. Диже и А.С. Трулевым. Эксперименты по проточной цитофлуорометрии выполнены совместно с к.б.н. И.В.

Кудрявцевым. Задержка белков в геле выполнена совместно с к.б.н. С.В.

Орловым.

Внедрение результатов работы. Научные результаты и практические рекомендации могут быть внедрены в научный и учебный процесс Отдела биохимии НИИ экспериментальной медицины СЗО РАМН (Россия, 197376, ул. Ак. Павлова, 12), Кафедры эмбриологии и Кафедры цитологии и гистологии Биолого-почвенного факультета Санкт-Петербургского Государственного Университета (Россия, 199034, Санкт-Петербург, Университетская наб., 7-9).

Cтруктура диссертации. Диссертация построена по традиционной схеме и содержит разделы «Введение», «Обзор литературы», «Материалы и методы», «Результаты исследования», «Обсуждение результатов», «Выводы» и «Список цитируемой литературы», включающий 271 наименование, из них источника на русском языке и 268 наименований на английском языке.

Диссертация изложена на 106 страницах. Результаты представлены в таблице и иллюстрированы 24 рисунками.

МАТЕРИАЛЫ И МЕТОДЫ

Материалы. Ингибиторы MAP-киназ были получены из «Biomol» SB203580 (ингибитор p38 MAP); SP600125 (ингибитор JNK1/2/3); U0126 (ингибитор MEK1/2) и ингибитор NFB (QNZ). Ингибитор Src-киназы PP2 был получен из «Biomol». Синтетические лиганды PPAR были получены из «Sigma»: WY-14643 (агонист) и MK886 (антагонист).

Синтетический агонист LXRs (TO901317) был получен из «Biomol». Синтетический агонист PPAR (GW1929) и синтетический антагонист PPAR (GW9662) были получены из “Sigma”. Рекомбинантный TNF человека был получен из “Sigma”. В данной работе использовались следующие антитела: мышиные моноклональные антитела против актина человека (“Abcam”, ab3280), мышиные моноклональные антитела против ApoA-I человека (“AbD Serotec”, 0650-0050), кроличьи поликлональные антитела против HNF человека (“Santa Cruz Biotechnology”, sc-8987), кроличьи поликлональные антитела против PPAR человека (“Santa Cruz Biotechnology”, sc-7196), кроличьи поликлональные антитела против LXR человека (“Abcam”, ab56237), мышиные моноклональные антитела против PPAR человека (“Abcam”, ab2779), козьи антитела против IgG мыши (FITC) (“Abcam”, ab6669-1), козьи антитела против IgG мыши (HRP) и козьи антитела против IgG кролика (HRP) (“Sigma”). pCMVL представляет собой вектор экспрессии бактериального генарепортера lacZ под контролем промотора ранних генов цитомегаловируса человека (CMV), и был получен ранее (Perevozchikov et al., 1997). pCMVHNF4, вектор экспрессии транскрипционного фактора человека HNF4, был любезно предоставлен Dr. Fukamizu (University of Tsukuba, Japan). pCMVHNF4D, вектор экспрессии доминантно-негативного мутанта транскрипционного фактора человека HNF4, был любезно предоставлен Dr. Leff (Wayne State University School of Medicine, USA). pAPOA-I(-2498/+173)-Luc, pAPOA-I(Luc, pAPOA-I(-256/+173)-Luc и pAPOA-I(-256/+72)-Luc, плазмиды, содержащие ген-репортер люциферазы светлячка под контролем делеционных вариантов 5’регуляторного участка гена apoA-I человека (-2498…+173), (-2498…+72), (-256…+173) и (-256…+72) относительно точки инициации транскрипции (+1) соответственно, были сконструированы с использованием методов генетической инженерии и описаны ранее (Лапиков и др., 2008).

Экспериментальная часть.

Клеточные культуры и трансфекция. Клеточная линия гепатомы человека HepG2 была получена из Банка клеточных культур Института Цитологии Российской академии наук и культивировалась в среде DMEM c добавлением 10% телячьей эмбриональной сыворотки (FCS) (“Биолот»), в атмосфере 5% CO2 при 37C. В экспериментах с TNF клетки высевались в 24-луночные планшеты с плотностью 1x104 клеток на см2 и культивировались 24 ч в среде DMEM. После этого ростовую среду меняли, клетки переводили в DMEM без FCS и дополнительно инкубировали 24 ч. Ингибиторы сигнальных протеинкиназ и синтетические лиганды ядерных рецепторов добавляли за 1 ч до внесения TNF в культуральную среду. Синтетические лиганды ядерных рецепторов добавляли к клеткам в следующих концентрациях: WY-14643 10 мкM, MK886 10 мкM, TO901317 5 мкM, GW1929 10 мкM, GW1929 10 мкM. Использовали следующие концентрации ингибиторов: SB203580 – 25 мкM, SP600125 – 10 мкM, U0126 – 10 мкM, QNZ – 10 нМ, PP2 – 10 мкМ. Трансфекцию клеток генетическими конструкциями осуществляли методом кальций-фосфатной преципитации, как описано ранее (Graham, van der Eb, 1973). Во всех экспериментах использовали по 3 мкг плазмидной ДНК, 0.5 мкг плазмиды pCMVL (для контроля эффективности трансфекции) и 1 мкг ДНК спермы лосося (размер фрагментов ДНК 200-400 п.о.) на лунку 24-луночного планшета.

Ингибиторы, синтетические лиганды и/или TNF добавляли к клеткам через 24 ч после трансфекции и культивировали 24 ч. Клеточная линия моноцитарной лейкемии человека THP-1 была получена из Банка клеточных культур Института Цитологии Российской академии наук и культивировалась в среде RPMI-1640 c 10% FCS (“Биолот»), в атмосфере 5% CO2 при 37C. Дифференцировку клеток THP-1 в макрофаги проводили, добавляя к клеткам форболовый эфир (phorbol 12-myristate 13-acetate - PMA) (50 нг/мл), как описано ранее (Tedla et al., 2004). Мононуклеары периферической крови человека получали, используя метод разделения клеток в градиенте Percoll-Hypaque, как описано (Bennett and Breit, 1994).

Животные. Мыши C57B/6 были получены из питомнока “Рапполово” (Россия). Все эксперименты с животными были одобрены комитетом по этичному обращению с животными НИИ экспериментальной медицины РАМН и выполнялись в соответствии с требованиями, изложенными в “Guide for the Care and Use of Laboratory Animals”. (1996) Institute of Laboratory Animal Research, Commission on Life Sciences, National Research Council. National Academy Press Washington, D.C. USA. Для получения перитониальных макрофагов использовали мышей возрастом 2 месяца и весом 16-20 г. Мышиные перитониальные макрофаги получали методом перитониального лаважа, переносили в 24луночные планшеты (1106 клеток на лунку) в RPMI c 10% FCS и инкубировали в атмосфере 5% CO2 при 37C.

-галактозидазный и люциферазный тесты. -галактозидазный тест проводили стандартным способом, используя в качестве субстрата ферментативной реакции oгалактозидазы нитрофенил--D-галактопиранозид. Относительную активность рассчитывали как отношение оптической плотности D420 за 1 ч на 1 мг тотального белка в клеточных лизатах.. Относительную активность люциферазы (RLU) измеряли на люминометре 20/20n (“Turner BioSystems”), используя Luciferase Assay System (“Promega”) в соответствии с рекомендациями изготовителя. За единицу активности люциферазы (RLU) принимали свечение в течение 1 мин на 1 мг тотального белка в клеточных лизатах.

Относительную активность люциферазы (RLA) выражали в процентах, принимая за 100% величину RLU в необработанных контрольных клетках. Концентрацию белка измеряли по методу Брэдфорд.

Обратная транскрипция. Тотальную РНК из культивируемых клеток выделяли с использованием RNA STAT-60 реагента (“Tel-Test”) в соответствии с инструкциями изготовителя. После обработки ДНКазой I, свободной от РНКаз (“Roche Applied Science”) (30 мин при 37C, далее реакцию останавливали добавлением EDTA в конечной концентрации 2 мM 15 мин при 70C для инактивации ДНКазы), концентрация тотальной РНК и ее чистота определялись при помощи спектрофотометра Avaspec-2048 (“Avantes”).

2 мкг тотальной РНК использовали для проведения реакции обратной транскрипции, используя как праймер oligo-dT (“Invitrogen”) и обратную транскриптазу M-MLV (“Promega”), для получения одноцепочечной кДНК (15 мин при 70C с праймером dT16, мин на льду, 60 мин при 42C в реакционной смеси, содержащей 0.5 мM дНТФ, 0.3 мM MgCl2, 75 мM KCl, 10 мM DTT, и 8 единиц/мкл обратной транскриптазы, и затем 15 мин при 70C для инактивации обратной транскриптазы).

Полимеразная цепная реакция в реальном времени – Real Time PCR. Праймеры и зонды для PCR подбирали с использованием программы “Primer3” (Rozen, Skaletsky, 2000). Для Real Time PCR использовали следующие праймеры и зонды к указанным генам человека и мыши (все последовательности написаны в ориентации 5’-3’):

Человек: GAPDH (AAGGGCATCCTGGGCTAC, GTGGAGGAGTGGGTGTCG, CY5actin

TGAGCACCAGGTGGTCTCTGAC-RTQ2), (AGCCTTCCTTCCTGGGC,

CGGATGTCCACGTCACACT, Cy5-TGGAGTCCTGTGGCATCCACGA-RTQ2), apoA-I

(CCTTGGGAAAACAGCTAAACC, CAGCTTGCTGAAGGTGGAG, FAMAGCTCCTTGACAACTGGGACAGCGT-BHQ1), LXR (TCACCTTCCTCAAGGATTTCA,

TCGAAGATGGGGTTGATGA, ROX-TAACCGGGAAGACTTTGCCAAAGCA-RTQ2),

LXR (CAGCAAGGACGACTTCCA, CCGCGAGAACTCGAAGAT, R6GAGGCCTGCAGGTGGAGTTCATCAAC-RTQ1), PPAR (TCACAAGTGCCTTTCTGTCG,

TCTTGGCATTCGTCCAAAA, ROX-GGATGTCACACAACGCGATTCG-RTQ2),

HNF4 (CGTGCTGCTCCTAGGCAA, GTCAAGGATGCGTATGGACAC, R6GGAGCTGGCGGAGATGAGCCG-RTQ1), PPAR (TGACAGCGACTTGGCAAT,

TGGGCTTCACATTCAGCA, R6G-TATTCTCAGTGGAGACCGCCCAGGT-RTQ1), Мышь:

CCTCCTCCTTGGGCCAACAGCT-RTQ1), (CTGGCACCACACCTTCTACA,

CTTTTCACGGTTGGCCTTAG, ROX-GCACCCTGTGCTGCTCACCG). Все варианты использованных праймеров и зондов (кроме праймеров к apoA-I мыши и к -актину мыши) были подобраны таким образом, что они не были способны амплифицировать геномную ДНК (один из пары праймеров располагается на границе двух экзонов). Кроме того, в качестве отрицательного контроля использовались следующие варианты: а) без добавления в реакционную смесь обратной транскриптазы, б) без добавления матрицы для проверки загрязнения реакционной смеси молекулами ДНК. Для оптимизации мультиплексирования (анализа экспрессии четырех различных генов в одной пробирке) были подобраны условия, при которых происходило скорейшее нарастание амплификации продуктов PCR (значения Ct). Для проведения реакции RealTime-PCR использовали следующие значения: 95C 300 c, затем 40 циклов при 95C 25 с и 60C 45 с в случае TaqMan и 95C 300 с, затем 40 циклов при 95C 30 с, 60C 20 с и 72C 30 с в случае SyberGreen. Использовали наборы для проведения TaqMan и Syber Green RealTime-PCR производства компании «Синтол» (каталожные номера R-412 и R-402).

Реакционная смесь (25мкл) содержала 0.25 мM дНТФ, 2.5 мM MgCl2, 0.05 единиц/мкл Taq - полимеразы («Синтол»), 0.25 pmol/мкл каждого из праймеров, 0.125 pmol/мкл зонда.

Реакцию проводили с использованием амплификатора ANK32 производства компании «Синтол». Число циклов (значения Ct), необходимое для достижения порогового уровня флуоресценции, превышающего 10 стандартных отклонений от уровня фруктуаций фоновой флуоресценции, определяли при помощи программного обеспечения ANK («Синтол»). Относительные значения количеств кДНК (в процентах от контрольного образца) рассчитывали по формуле (2Ct контроль-Ct образец) x 100. Рассчитанные количества кДНК каждого из генов нормировали по уровню экспрессии гена «домашнего хозяйства», кодирующего глицеральдегид-3-фосфатдегидрогеназу (gapdh) или бета-актин, и представляли как относительный уровень экспрессии гена, принимая за 100% уровень экспрессии в контрольных клетках.

Иммунопреципитация хроматина (ChIP). Иммунопреципитацию хроматина проводили, как описано ранее (Martens et al., 2005). Фрагментацию хроматина проводили обработкой лизированных клеток HepG2 ультразвуком при 0C, используя генератор ультразвука УЗДН-1 (4 раза по 20 с при силе тока 0.3A, частота звуковых колебаний 44 кГц), получая, в результате фрагменты хроматина длинной 200-300 п. о. Оценку количества фрагментов ДНК, соответствующих гепацитарному энхансеру гена apoA-I, в связанной с антителами и несвязанной фракциях хроматина проводили методом RealTime PCR с помощью праймеров и зонда, специфичных к данному участку гена apoA-I: HRE-c (5-hre-c:

GCTTGCTGTTTGCCCACT, 3-hre-c: GGTCCTGGCAATGTGGAA, h-hre-c: FAMCCCAGGGACAGAGCTGATCCTTG-BHQ1). В качестве отрицательного контроля использовали преципитацию неспецифическими IgG человека. Количества преципитированного хроматина, содержащие последовательность гепацитарного энхансера гена apoA-I нормировали по общему содержанию такой последовательности в образце хроматина Иммуноферментный анализ (ELISA). Человеческий АpoA-I в культуральных средах определяли методом иммуноферментного анализа с использованием поликлональных антител кролика против человеческого ApoA-I и вторых антител козы против кроличьих IgG, сконъюгированных с пероксидазой хрена. Поликлональные кроличьи антитела против человеческого ApoA-I были описаны ранее (McVicar et al., 1984), было установлено, что эти антитела не связывают белки FCS.

Вестерн-блоттинг. Клетки трижды отмывали PBS, затем лизировали в буфере RIPA- (50 мМ Tris-HCl, 150 мМ NaCl, 1% NP-40, 1 мМ EDTA, 0.1% SDS and 0.01% NaN3, 1 мМ PMSF, pH 7.4). SDS-элетрофорез белков проводили в 7% или 12% полиакриламидном геле. Вестерн-блоттинг проводили, как описано (Kim et al., 2009), используя систему детекции Enhansed Chemoluminiscent (ECL).

Иммуноцитохимия. Для иммуноцитохимического анализа экспрессии ApoA-I макрофаги THP-1 культивировали на пластиковых покровных стеклах (Tissue Culture Coverslips mm, “Sarstedt”), а все манипуляции с моноцитами THP-1 проводили в суспензии. Клетки THP-1 фиксировали в 4% параформальдегиде на PBS в течение 20 мин при +4С, трижды отмывали PBS. Для детекции внутриклеточного ApoА-I клетки пермеабилизировали добавлением 0.1% TritonX-100, 1% BSA на PBS в течение 10 мин при +22С; в случае определения ApoА-I, связанного с наружной поверхностью клеточной мембраны, пермеабилизацию не проводили. Далее препараты блокировали в течение 40 мин при +22С в блокирующем буфере (1% BSA, 0.02% Tween-20, 1 мкг/мл неспецифических IgG человека на PBS). Клетки обрабатывали мышиными моноклональными антителами против ApoА-I человека в разведении 1:250 в 1% BSA, 0.02% Tween-20 на PBS при +37С, 2 ч. После двукратной отмывки блокирующем буфером добавляли козьи поликлональные антитела меченые FITC против IgG мыши (Abcam, ab6669-1) в разведении 1:1000 в 1% BSA, 0.02% Tween-20 на PBS при +22С 1 ч, трижды отмывали блокирующем буфером, один раз PBS и заключали в среду Vectashield (Vector Labs, USA), содержащую 4,6diamidino-2-phenylindole (DAPI). В качестве контроля специфичности иммунного окрашивания использовали клетки, которые не обрабатывали антителами против ApoА-I, но обрабатывали антителами, мечеными FITC. Клетки анализировали методом лазерной сканирующей конфокальной микроскопии при помощи Leika TCS SPE LCSM.

Проточная цитофлуорометрия. Моноциты и макрофаги THP-1 культивировали в 24луночных планшетах, как описано выше. Анализ клеток проводили при помощи проточного цитофлуориметра Epic Altra (Beckman Coulter, USA) и полученные результаты анализировали с использованием программного обеспечения Expo32 (Beckman Coulter, USA).

Получение ядерных экстрактов, гель-ретардация и супер-шифт в геле. Ядерные экстракты из культивируемых клеток получали, как описано (Andrews and Faller, 1991).

Концентрацию белка в ядерных экстрактах определяли по методу Бредфорд. В экспериментах по гель-ретардации использовали синтетические двуцепочечные олигонуклеотиды: HRE-A: 5'-CATGAACCCTTGACCCCTGCCCTG-3' и 3'-CTTGGGAACTGGGGACGGGACTGT-5'; HRE-C: 5'CTTGAGCTGATCCTTGAACTCTTAAG-3' и 3'-CTCGACTAGGAACTTGAGAATTCTAGОлигонуклеотиды метили [32P]dCTP или [32P]dGTP посредством ДНК-полимеразы фага Т4 (обменная реакция по 3’-концу), или посредством фрагмента Кленова ДНКполимеразы I (достройка выступающих 5'-концов), а также [32P]ATP посредством полинуклеотидкиназы фага Т4, согласно (Kadonaga et al., 1987). Ретардацию выполняли, как описано (Kadonaga et al., 1987). Для проведения экспериментов по супер-сдвигу в геле к белкам ядерных экстрактов перед добавлением меченых олигонуклеотидов добавляли указанные антитела (2 мкг в 10 мкл) и инкубировали 1 ч при 4С. Пробы разделяли электрофорезом в 5% неденатурирующем полиакриламидном геле. Гель, приготовленный на трис-боратном буфере, фиксировали в 10% этаноле + 10% уксусной кислоте в течение 15 мин, высушивали и радиоавтографировали.

Статистический анализ. Результаты представляли как среднее значение ± стандартная ошибка среднего значения. Статистический анализ различий между сравниваемыми группами выполняли с использованием проверки по непарному t-критерию Стьюдента, либо по критерию Даннета в случаях множественного сравнения с контрольной группой.

Все статистические анализы выполняли с использованием программы Statistica 5.0, “StatSoft, Inc., США”.

СОДЕРЖАНИЕ РАБОТЫ

1. TNF угнетает активность 5’-регуляторной области гена apoA-I человека в клетках HepG Ранее было показано, что TNF угнетает экспрессию гена apoA-I в клетках HepG2 (Song et al., 1998; Haas et al., 2003). Чтобы определить район, отвечающий за угнетающее действие TNF на транскрипцию гена apoA-I человека, мы использовали набор делеционных вариантов 5’-регуляторной области гена apoA-I человека (Рис. 1). TNF угнетает активность всех использованных нами генетических конструкций, в том числе, негативно регулирует активность плазмиды, содержащей 5’-регуляторную область гена apoA-I человека с координатами -256…+72 п.о. относительно точки инициации транскрипции (pAPOA-I(-256/+72)-Luc), т. е. лишенной всех регуляторных участков, за исключением собственно промотора и гепацитарного энхансера (Рис. 1).

2. NFB и МАР-киназы участвуют в TNF-зависимом угнетении транскрипции гена apoA-I и секреции белка ApoA-I в клетках HepG Известно, что в ходе воспаления TNF активирует внутриклеточные сигнальные пути NFB и MAP-киназ (Basak and Hoffmann, 2008; Moon et al., 2004), что приводит к изменению уровней экспрессии различных генов в гепатоцитах (Wullaert et al., 2006). Результаты Real Time RT-PCR показывают, что TNF через 24 ч угнетает экспрессию гена apoA-I в клетках HepG2 на 30 ± 3.7% по сравнению с уровнем экспрессии этого гена в контрольных клетках (без добавления TNF). Ингибирование NFB, JNK и p38 приводит к отмене угнетающего эффекта TNF на экспрессию гена apoA-I в клетках HepG2 (Рис. 2). Ингибирование MEK1/2 приводит к усилению экспрессии гена apoA-I, но не влияет на степень подавления транскрипции apoA-I при действии TNF (Рис. 2). Секреция ApoA-I клетками HepG2 через 24 ч после добавления TNF достоверно уменьшается на 36.6 ± 2.7% относительно уровня секреции этого белка контрольными клетками. Добавление ингибитора киназ MEK1/2 приводит к увеличению секреции ApoA-I, в то время как ингибиторы киназ JNK, p38 и фактора транскрипции NFB в разной степени уменьшают секрецию этого белка клетками HepG2 (Рис. 2 б). Угнетение секреции ApoA-I клетками HepG2 при действии TNF блокируется при добавлении ингибиторов JNK и p38, но не отменяется при добавлении ингибиторов MEK1/2 и NF-B (Рис. 2 б).

Рисунок 1. Влияние TNF на 5’-регуляторную область гена apoA-I человека (люциферазный тест): активности плазмид, содержащих делеционные варианты 5’-регуляторной области гена apoA-I человека в клетках HepG2:

LUC – ген люциферазы светлячка, HE – гепацитарный энхансер гена apoA-I человека, черные прямоугольники – I экзон гена apoA-I человека, стрелка – каноническая точка инициации транскрипции (ТИТ) гена apoA-I человека; цифры указывают координаты относительно ТИТ гена apoA-I человека (+1). RLA – условные единицы активности люциферазы. Представлены результаты пяти независимых экспериментов как среднее значение среднего.

3. Ядерный рецептор HNF4 участвует в угнетении экспрессии гена apoA-I человека в клетках HepG2 при действии TNF 5’-регуляторная область гена apoA-I человека содержит хорошо охарактеризованные сайты связывания для фактора транскрипции HNF (Harnish et al., 1994). Для определения роли HNF4 в подавлении экспрессии гена apoA-I при действии TNF мы провели котрансфекцию клеток HepG генетической конструкцией, содержащей 5’-регуляторную область гена apoA-I человека, и векторами экспрессии гена HNF4 либо доминантнонегативной формы гена HNF4. Добавление TNF приводит к подавлению активности генетической конструкции, содержащей 5’-регуляторную область гена apoA-I человека, в 4.9 ± 1.4 раза. Уровень подавления при действии TNF не уменьшается в присутствии избытка HNF4 (в 6.2 ± 0.4 раза), и возрастает в присутствии избытка доминантно-негативной формы HNF4 (в 9.7 ± 0.3 раза).

Рисунок 2. Регуляция транскрипции эндогенного гена apoA-I и секреции белка ApoA-I при действии TNF в клетках HepG2: роль протеинкиназных каскадов MAP и фактора транскрипции NFB: a – Real Time RT-PCR: значения по оси Y обозначают относительный уровень транскрипции (100% в контрольных клетках HepG2); б – анализ содержания белка apoA-I в культуральной среде методом ELISA после добавления к клеткам HepG2 TNF: Контроль – клетки HepG2 без добавления ингибиторов; значения по оси Y обозначают уровень белка apoA-I (нг/мл) в культуральной среде, приведенные к 1 мг клеточного белка.

Белые столбики – клетки без добавления TNF, черные – клетки, к которым добавляли TNF. Результаты представлены как среднее значение ± стандартная ошибка среднего. Статистический анализ различий между группами (с и без добавлением TNF) выполняли с использованием проверки по непарному tкритерию Стьюдента (n=6, * p 0.05, ** p 0.01) и по критерию Даннета (n=6, # p 0.05).

4. Ядерные рецепторы PPAR и LXRs участвуют в регуляции экспрессии гена apoA-I человека и секреции ApoA-I в клетках HepG при действии TNF Известно, что в регуляции экспрессии гена apoA-I человека в клетках печени важную роль играют ядерные рецепторы PPAR (Martin et al., 2001) и LXRs (Huuskonen et al., 2006), взаимодействующие с гепацитарным энхансером этого гена. Мы показали, что добавление к клеткам HepG2 синтетического агониста PPAR WY-14643 приводит к увеличению, а добавление антагониста PPAR MK886 или агониста LXRs TO901317 – к уменьшению уровня экспрессии эндогенного гена apoA-I. Одновременно с этим, добавление к клеткам HepG2 MK886 и TO901317 приводит к отмене угнетающего действия TNF на экспрессию эндогенного гена apoA-I.

Добавление синтетических лигандов PPAR (WY-14643 или MK886) и LXRs (TO901317) в ростовую среду клеток HepG2 приводит к уменьшению секреции ApoA-I, и отменяет дальнейшее подавление секреции ApoA-I при действии TNF. Действие синтетических лигандов PPAR и LXRs на TNFзависимую регуляцию транскрипции гена apoA-I подтверждено при трансфекции клеток HepG2 генетическими конструкциями, содержащими делеционные варианты 5’-регуляторной области гена apoA-I.

5. PPAR подавляет экспрессию гена apoA-I и секрецию белка ApoA-I в клетках HepG2 и принимает участие в TNF-зависимой регуляции экспрессии этого гена Приведенные на Рис. 6 результаты свидетельствуют о регуляции экспрессии гена apoA-I, а также секреции белка ApoA-I со стороны PPAR. Обработка клеток HepG2 агонистом PPAR (GW1929) приводит к достоверному уменьшению экспрессии гена apoA-I, а также секреции белка ApoA-I в культуральную среду (Рис. 3).

Рисунок 3. Роль PPAR в регуляции экспрессии эндогенного гена apoA-I и секреции белка ApoA-I при действии TNF в клетках HepG2: a – Real Time RTPCR: значения по оси Y обозначают относительный уровень транскрипции (100% в контрольных клетках HepG2); б – анализ содержания белка ApoA-I в культуральной среде методом ELISA. Результаты представлены как среднее значение ± стандартная ошибка среднего. Статистический анализ различий между группами (с и без добавлением TNF) выполняли с использованием проверки по непарному t-критерию Стьюдента (n=12, * p 0.05) и по критерию Даннета (отличие от контрольных клеток, к которым не добавляли синтетические лиганды, ингибиторы и TNF) (n=12, # p 0.05).

Обработка клеток HepG2 антагонистом PPAR (GW9662) не влияет на экспрессию гена apoA-I, а также содержание белка ApoA-I в культуральной среде. Добавление к клеткам HepG2 одновременно агониста и антагониста PPAR также не влияет на транскрипцию гена apoA-I и содержание белка ApoA-I в культуральной среде. Эти результаты показывают специфический PPAR-зависимый характер действия GW1929 и GW9662 на экспрессию гена apoA-I в клетках HepG2. Интересно, что агонист PPAR отменяет подавление экспрессии гена apoA-I при действии TNF, но не TNF-зависимое угнетение секреции белка ApoA-I в клетках HepG2, в то время как антагонист PPAR не влияет на TNF-зависимое подавление экспрессии гена и секреции белка ApoA-I (Рис. 3).

6. TNF уменьшает количество PPAR и увеличивает количество LXR, связанных с гепацитарным энхансером гена apoA-I в клетках HepG Добавление TNF к клеткам HepG2 приводит к примерно двукратному уменьшению количества PPAR, связанного с гепацитарным энхансером гена apoA-I. В то же время, количество LXR, связанного с гепацитарным энхансером гена apoA-I, возрастает в 3 раза после добавления TNF к клеткам. Наши результаты говорят о том, что PPAR способен взаимодействовать с гепацитарным энхансером гена apoA-I в клетках HepG2.

В то же время, обработка клеток HepG2 TNF не приводит к изменению уровня PPAR, связанного с гепацитарным энхансером гена apoA-I.

7. Эндогенный ген apoA-I экспрессируется в моноцитах и макрофагах, полученных из мононуклеаров периферической крови человека, и в клетках моноцитарно-макрофагальной линии человека THP- Как показано на Рис. 4, мРНК apoA-I обнаруживается в моноцитах и макрофагах, полученных из периферической крови человека, а также в моноцитах и макрофагах, полученных при дифференцировке клеток THP- под действием форболового эфира (PMA), в то время как в фибробластах кожи человека VH-10 экспрессия гена apoA-I не обнаружена (не показано на рисунке).

Уровень экспрессии гена apoA-I в клетках моноцитарномакрофагального ряда увеличивается при дифференцировке моноцитов, полученных из периферической крови человека, в макрофаги, а также при дифференцировке моноцитов THP-1 в макрофаги (Рис. 4 а). Относительное содержание мРНК apoA-I в клетках моноцитарно-макрофагального ряда указано в Таблице 1. Результаты количественной Real Time RT-PCR показывают, что перитониальные макрофаги мыши тоже экспрессируют ген apoA-I, причем уровень мРНК этого гена составляет 0.0010±0.0003% от уровня мРНК apoA-I в печени мыши. Рис. 5 показывает влияние TNF на уровень экспрессии гена apoA-I в моноцитах и макрофагах человека.

Уровень активации экспрессии гена apoA-I в клетках THP-1 зависит от концентрации TNF (Рис. 5 а). Временная динамика экспрессии гена apoA-I в ответ на обработку моноцитов THP-1 TNF (10 нг/мл) показана на Рис. 5 б.

Эндогенно синтезированный белок АpoA-I обнаружен в клеточных лизатах моноцитарно-макрофагальной линии клеток человека THP-1, но не в лизатах фибробластов человека VH-10 (Рис. 6). Обработка клеток THP-1 TNF ( нг/мл, 24 ч) приводит к увеличению содержания белка apoA-I в моноцитах THP-1, но не влияет на его синтез в макрофагах THP-1 (Рис. 5 6).

Рисунок 4. Экспрессия эндогенного гена apoA-I в моноцитах и макрофагах человека: a – транскрипция гена apoA-I в клетках THP-1 и моноцитах периферической крови человека, Real Time RT-PCR: значения по оси Y указывают относительный уровень мРНК apoA-I (100% в моноцитах THP-1); 3 сут. и 7 сут. – макрофаги THP-1 через 3 и 7 суток с начала дифференцировки, соответственно;

МПК моноциты и макрофаги – моноциты и макрофаги, полученные из мононуклеаров перефирической крови человека; б – уровень активации транскрипции гена apoA-I при действии TNF (10 нг/мл), где 1 соответствует уровню транскрипции гена apoA-I без добавления TNF. Результаты представлены как среднее значение ± стандартная ошибка среднего.

Статистический анализ различий между группами выполняли с использованием проверки по критерию Даннета (n=6, #p 0.05; ##p 0.01).

Анализ содержания белка apoA-I в культуральной среде методом иммуноблоттинга демонстрирует крайне низкий уровень его секреции моноцитами THP-1 и практически полное отсутствие секреции белка ApoA-I макрофагами THP-1 (Рис. 6). В то же время, обработка клеток THP-1 TNF (10 нг/мл, 24 ч) приводит к значительному увеличению секреции белка ApoA-I (Рис. 6).

Непрямая иммунофлуоресциентная конфокальная микроскопия показывает, что белок ApoA-I локализуется на клеточной мембране и в виде внутриклеточных включений в макрофагах THP-1. Распределение макрофагов THP-1 по содержанию белка ApoA-I показывает наличие двух популяций клеток через 3 суток с начала дифференцировки: содержащих и не содержащих ApoA-I (Рис. 6). Обработка клеток THP-1 TNF (10 нг/мл, 24 ч) приводит к увеличению содержания внутриклеточного белка ApoA-I в моноцитах THP-1, но не в макрофагах THP-1 (Рис. 6).

Рисунок 5. Экспрессия эндогенного гена apoA-I в моноцитах и макрофагах человека при действии TNF: а – влияние различных концентраций TNF на уровень транскрипции гена apoA-I в моноцитах THP-1 через 24 ч после добавления TNF; б – к моноцитам THP-1 был добавлен TNF (10 нг/мл) или равный объем культуральной среды с BSA (10 нг/мл), после чего клетки инкубировали указанное время и измеряли уровень мРНК apoA-I. Real Time RTPCR: значения по оси Y указывают относительный уровень мРНК apoA-I (100% в моноцитах THP-1). Результаты представлены как среднее значение ± стандартная ошибка среднего. Статистический анализ различий между группами выполняли с использованием проверки по критерию Даннета (n=6, #p 0.05; ##p 0.01).

Известно, что ApoA-I взаимодействует с АТФ-зависимым кассетным транспортером ABCA1 на внешних мембранах макрофагов, осуществляя механизм обратного транспорта холестерола из этих клеток (Oram, 2003), а также запускает внутриклеточный сигналинг, влияющий, в том числе, на воспалительные функции макрофагов (Seetharam et al., 2006; Nofer et al., 2006; Diederich et al., 2001; Murphy et al., 2008; Rye and Barter, 2008).

Возможно, что эндогенно синтезированный белок ApoA-I, локализованный на плазматической мембране макрофагов, может взаимодействовать с ABCA1 на поверхности этих клеток. Эндогенно синтезированный белок ApoA-I, секреция которого моноцитами-макрофагами стимулируется TNF, может выступать в роли своеобразного «буфера», препятствующего развитию субпорогового воспаления на ранних стадиях воспалительного процесса, и может играть защитную роль на начальных стадиях развития атеросклеротических повреждений сосудов.

Таблица 1. Относительное содержание мРНК apoА-I в клетках HepG2, клетках THP-1 и моноцитах/макрофагах, полученных из мононуклеаров периферической крови человека.

Содержание мРНК apoА-I нормировано по уровню мРНК GAPDH, за 100% принято содержание мРНК apoА-I в клетках HepG2. Макрофаги 3 сутки и 7 сутки – 3 и суток с начала дифференцировки клеток THP-1 или моноцитов периферической крови в макрофаги, МПК – мононуклеары периферической крови человека.

Значения представлены как среднее ± стандартная ошибка среднего для независимых экспериментов.

8. Роль NFB, MAP-киназного сигнального каскада и ядерных рецепторов PPAR и LXRs в TNF-зависимой активации экспрессии гена apoA-I в моноцитах и макрофагах THP- Ингибирование сигнальных путей NFB, p38 или JNK в моноцитах THP- приводит к увеличению уровня экспрессии гена apoA-I приблизительно в раза, в то время как ингибирование MEK1/2 увеличивает экспрессию этого гена в 4 раза. Ингибирование JNK или MEK1/2 отменяет увеличение экспрессии гена apoA-I в ответ на добавление к моноцитам THP-1 TNF, в то время как ингибирование NFB или p38 практически не влияет на уровень TNF-зависимой активации экспрессии этого гена (Рис. 7).

Дифференцировка клеток THP-1 в макрофаги приводит к отмене активации экспрессии гена apoA-I при ингибировании сигнальных путей NFB, p38, JNK или MEK1/2 (Рис. 7). Добавление TNF (10 нг/мл, 24 ч) к макрофагам THP-1 (3 суток с начала дифференцировки) приводит к активации экспрессии гена apoA-I на 44.5 ± 9.6% по сравнению с контрольными клетками (Рис. 7).

Рисунок 6. Продукция, секреция и локализация эндогенно синтезированного белка ApoА-I в моноцитах и макрофагах THP-1: а – анализ содержания белка ApoA-I в клетках THP-1; б – анализ секреции белка ApoA-I в культуральную среду (эквивалент 250 мкл среды) клетками THP-1 за 24 ч в присутствии и без TNF; в – анализ влияния TNF (10 нг/мл, 24 ч) на содержание внутриклеточного и связанного с мембраной AпоА-I в моноцитах и макрофагах THP-1 методом проточной цитофлуорометрии. Указан процент клеток положительных по содержанию белка ApoA-I. M – арифметическая медиана распределения.

Использовали моноклональные антитела против ApoА-I человека; было установлено, что эти антитела дают только две полосы при Вестерн-блоте, соответствующие по молекулярной массе про-белку и зрелому ApoA-I человека и не связывают в использованных концентрациях другие внутриклеточные белки или белки FCS. Эксперименты повторяли три раза, результат воспроизводился в каждом эксперименте. На рисунке представлены результаты одного эксперимента.

Рисунок 7. Регуляция экспрессии гена apoА-I в моноцитах (а, в) и макрофагах через 3 суток с начала дифференцировки (б, д) THP-1 при действии TNF:

роль MAP-киназных каскадов, фактора транскрипции NFB и ядерных рецепторов PPAR и LXRs, Real Time RT-PCR; значения по оси Y соответствуют относительному уровню транскрипции гена apoА-I (100% в контрольных клетках);

контроль – клетки THP-1 без добавления ингибиторов или синтетических лигандов; Заштрихованные столбики – клетки, к которым не добавляли TNF, черные столбики – клетки, к которым добавляли TNF. Значения представлены как среднее ± стандартная ошибка среднего для 6 независимых экспериментов.

Статистический анализ различий между группами сравнения (с или без TNF) проводили с использованием непарного t-критерия Стьюдента (*p 0.05, **p 0.01, ***p 0.001). Статистический анализ различий между уровнями транскрипции гена apoА-I в контрольных клетках и клетках, к которым добавляли ингибиторы или синтетические лиганды, проводили с использованием критерия Даннета (#p 0.05, ##p 0.01).

Ингибирование сигнальных путей NFB, p38 или JNK в макрофагах THP- приводит к отмене TNF-зависимой активации экспрессии гена apoA-I (Рис.

7). Добавление к клеткам синтетического антагониста PPAR (MK886) или агониста LXRs (TO901317) приводит к увеличению экспрессии гена apoA-I как в моноцитах, так и в макрофагах THP-1 (Рис. 7). В то же время, добавление агониста PPAR (WY-14643) не влияет на уровень экспрессии гена apoA-I в клетках THP-1, однако отменяет TNF-зависимую активацию экспрессии этого гена, как в моноцитах, так и в макрофагах (Рис. 7).

Добавление к моноцитам или макрофагам THP-1 TO90131 также отменяет увеличение экспрессии гена apoA-I в ответ на TNF (Рис. 7). Обработка клеток THP-1 MK886 приводит к уменьшению TNF-зависимой активации экспрессии гена apoA-I в несколько раз в моноцитах THP-1 (Рис. 7).

9. Влияние TNF на связывание ядерных рецепторов PPAR и LXR с гепацитарным энхансером гена apoA-I человека в моноцитах и макрофагах THP- Иммунопреципитация хроматина моноцитов и макрофагов THP-1 с использованием антител к PPAR и LXR показывает, что уровень PPAR, связанного с гепацитарным энхансером гена apoA-I, не изменяется при дифференцировке клеток THP-1 в макрофаги. В то же время, уровень LXR, связанного с гепацитарным энхансером гена apoA-I при дифференцировке клеток THP-1 в макрофаги, увеличивается приблизительно в 1.8 раза по сравнению с моноцитами THP-1. Добавление к клеткам TNF (10 нг/мл) не влияет на уровень PPAR, связанного с гепацитарным энхансером гена apoA-I в моноцитах THP-1, но уменьшает уровень PPAR, ассоциированного с гепацитарным энхансером в макрофагах THP-1, приблизительно в 2 раза через 24 ч. Уровень LXR, связанного с гепацитарным энхансером гена apoA-I, увеличивается примерно в 1.5 раза в моноцитах и уменьшается приблизительно в 1.3 раза в макрофагах через 24 после воздействия TNF на клетки THP-1.

Методами задержки ДHK-белковых комплексов в геле (EMSA) и «суперсдвига» ДHK-белковых комплексов показано, что PPAR связывается с сайтом HRE-A, а LXR взаимодействуетс сайтом HRE-C в составе гепацитарного энхансера гена apoA-I в клетках THP-1.

ЗАКЛЮЧЕНИЕ

Установлено, что сигнальные пути NFB, JNK и p38, но не MEK1/ участвуют в механизме подавления экспрессии эндогенного гена apoA-I в клетках HepG2 при действии TNF. TNF-зависимое угнетение транскрипции гена apoA-I опосредовано PPAR и LXR, в том числе за счет уменьшения уровня положительного (PPAR) и увеличения уровня отрицательного (LXR) регуляторов транскрипции гена apoA-I, связанных с HRE гепацитарного энхансера гена apoA-I в клетках HepG2. В данной впервые показано, что PPAR является отрицательным лиганд-зависимым регулятором транскрипции гена и секреции белка ApoA-I в клетках HepG2.

Отмена TNF-зависимого подавления транскрипции гена apoA-I при активации PPAR опосредована гепацитарным энхансером гена apoA-I. В нашей работе впервые показана транскрипция эндогенного гена apoA-I и синтез белка ApoA-I клетками моноцитарно-макрофагального ряда.

Представленные данные свидетельствуют о том, что обработка моноцитов и макрофагов THP-1 TNF приводит не только к увеличению транскрипции гена apoA-I, но также и к индукции секреции белка ApoA-I. TNF-зависимая активация экспрессии гена apoA-I контролируется сигнальными путями JNK и MEK1/2 в моноцитах. В то же время, в макрофагах ингибирование любого из JNK, p38 или NFB сигнальных путей ведет к ослаблению или отмене активации экспрессии гена apoA-I в этих клетках. В моноцитах и макрофагах THP-1 LXRs лиганд-зависимым образом активируют экспрессию гена apoA-I, в то время как PPAR отрицательно регулирует транскрипцию гена apoA-I, и оба указанных ядерных рецептора связываются с гепацитарным энхансером гена apoA-I в моноцитах и макрофагах THP-1. LXRs и PPAR участвуют в механизме активации экспрессии гена apoA-I, опосредованной TNF в клетках моноцитарно-макрофагального ряда.

ВЫВОДЫ

1. MAP-киназные каскады JNK и p38, но не MEK1/2 принимают участие в TNF-зависимом подавлении экспрессии гена apoA-I в клетках HepG2.

Фактор транскрипции NFB и ядерные рецепторы LXRs, PPAR и PPAR, но не HNF4 вовлечены в TNF-зависимое подавление экспрессии гена apoA-I в клетках HepG2.

2. Впервые показано, что экспрессия гена apoA-I происходит в клетках моноцитарно-макрофагального ряда человека на уровне образования мРНК и белка ApoA-I.

3. Дифференцировка моноцитов в макрофаги сопровождается прогрессивным увеличением экспрессии гена ApoA-I.

4. TNF значительно активирует экспрессию гена apoA-I в клетках моноцитарно-макрофагального ряда.

MAP-киназные каскады JNK и MEK1/2, но не p38, а также ядерные рецепторы LXRs и PPAR, но не фактор транскрипции NFB участвуют в TNF-зависимой активации экспрессии гена apoA-I в моноцитах THP-1.

MAP-киназные каскады JNK, p38, а также ядерные рецепторы LXRs и PPAR и фактор транскрипции NFB участвуют в TNF-зависимой активации экспрессии гена apoA-I в макрофагах THP-1.

СПИСОК РАБОТ, ОПУБЛИКОВАННЫХ ПО ТЕМЕ ДИССЕРТАЦИИ

1. Orlov S. V., Mogilenko D. A., Shavva V. S. Dizhe E. B., Ignatovich I. A., Perevozchikov A. P. (2010) Effect of TNF on activities of different promoters of human Apolipoprotein A-I gene. Biochem Biophys Res Commun. V.398(2), P.224-230.

2. Mogilenko D. A., Dizhe E. B., Shavva V. S., Lapikov I. A., Orlov S. V., Perevozchikov A. P. (2009) Role of the nuclear receptors HNF, PPAR, and LXRs in the TNFmediated inhibition of human Apolipoprotein A-I gene expression in HepG2 cells.

Biochemistry. V.48(50), P.11950-11960.

3. Лапиков И. А., Могиленко Д. А., Диже Э. Б., Игнатович И. А., Орлов С. В., Перевозчиков А. П. Ap1-подобные цис-элементы в 5'-регулторной области гена аполипопротеина A-I человека. (2008) Мол. Биол. T.42, № 2, С. 295-305.

4. Акифьев Б. Н., Диже Э. Б., Ефремов А. М., Могиленко Д. А., Олейникова Г. Н., Лапиков И. А., Жданова О. Ю., Кидготко О. В., Орлов С. В., Перевозчиков А. П., Перенос гена аполипопротеина A-I человека мышам методом гидродинамических инъекций: факторы, влияющие на эффективность и продолжительность экспрессии гена в печени животного. (2004) Мол. Биол. T.38, C.1076-1084.

5. Mogilenko D. A., Orlov S. V., Trulioff A. S., Nagumanov V. K., Perevozchikov A. P. (2009) Evidence for expression of human apolipoprotein A-I gene in monocyte/macrophage cells.

FEBS Journal, V. 276, Suppl.1, P.378.

6. Могиленко Д. А. Регуляция экспрессии гена аполипопротеина A-I человека в клетках моноцитарно-макрофагального ряда при действии фактора некроза опухоли альфа.

(2009) Сборник тезисов Международной научной конференции студентов, аспирантов и молодых учёных «Ломоносов-2009». 13-18 апреля, 2009 г., Москва, Россия, C.188Могиленко Д. А., Орлов С. В., Трулев А. С., Кудрявцев И. В., Перевозчиков А. П.

(2009) Экспрессия гена аполипопротеина A-I человека в клетках THP-1. Медицинская иммунология, Т.11, №4-5, С.325-326.

8. Mogilenko D., Orlov S., Trulioff A., Perevozchikov A. Expressoin and localization of apolipoprotein A-I in human macrophages and monocytes. (2009)

Abstract

book of International Conference “Modern Microscopy Techniques in Biology and Medicine”, 9- November 2009, St. Petersburg, Russia, P.21-22.

9. Могиленко Д. А., Орлов С. В., Диже Э. Б., Чернова А. А., Нагуманов В. К., Перевозчиков А. П. (2008) Дифференциальная регуляция экспрессии гена аполипопротеина A-I человека в гепатоцитах и макрофагах при действии TNF.

Русский журнал «СПИД, рак и общественное здоровье», Т.12, №2, С.26.

10. Могиленко Д. А., Орлов С. В., Диже Э. Б., Виленская Е. Г., Перевозчиков А. П.

Влияние TNF на дифференциальную активность альтернативных промоторов гена аполипопротеина A-I человека. (2007) Русский журнал «СПИД, рак общественное здоровье», Т.11, №1, С88-89.

Denis Mogilenko Dissertation Thesis: “Regulation of Human Apolipoprotein A-I Gene Expression under the Impact of Tumor Necrosis Factor ”.

Apolipoprotein A-I (ApoA-I) is the main structural and functional protein component of human high-density lipoproteins. The expression of the apolipoprotein A-I gene (apoA-I) in hepatocytes is repressed by proinflammatory cytokines such as IL-1 and TNF. In this work, it has been demonstrated that treatment of human hepatoma HepG2 cells with chemical inhibitors for JNK, p38 protein kinases, and NFB transcription factor abolishes the TNF-mediated inhibition of human apoA-I gene expression in HepG2 cells. In addition, we have shown that TNF decreases secretion of apoA-I protein by HepG2 cells, and this effect depends on JNK and p38, but not on NFB and MEK1/2 signaling pathways. The inhibitory effect of TNF has been found to be mediated by the hepatic enhancer of the apoA-I gene. The decrease in the level of human apoA-I gene expression under the impact of TNF appears to be partly mediated by the inhibition PPAR gene expression. Treatment of HepG2 cells with PPAR antagonist (MK886) or LXRs agonist (TO901317) abolishes the TNF-mediated downregulation of apoA-I gene expression.

Treatment of HepG2 cells with PPAR and LXRs synthetic agonists also blocks the inhibition of apoA-I protein secretion in HepG2 cells under the impact of TNF. A chromatin immunoprecipitation assay demonstrates that TNF leads to a 2-fold decrease in the level of PPAR binding with the apoA-I gene hepatic enhancer. At the same time, the level of LXR binding with the apoA-I gene hepatic enhancer is increased 3-fold under the impact of TNF.

These results suggest that nuclear receptors PPAR, and LXRs are involved in the TNFmediated downregulation of human apoA-I gene expression and apoA-I protein secretion in HepG2 cells. We have shown that activation of nuclear receptor PPAR leads to inhibition of apoA-I gene expression and protein secretion in HepG2 cells. Treatment of HepG2 cells with PPAR agonist (GW1929) abolishes the TNF-mediated decrease in the level of apoA-I gene expression but does not block TNF-mediated inhibition of ApoA-I protein secretion in HepG cells. We have shown for the first time the moderate expression of endogenous apoA-I gene in human peripheral blood mononuclear monocytes (PBM) and PBM-derived macrophages as well as in the human monocyte-macrophage cell line THP-1. The expression of apoA-I gene has been increasing in course of monocyte-macrophage cell differentiation. Endogenous ApoA-I is localized in intracellular vesicles and on outer side of plasma membrane of THP-1 cells. THP- macrophages are separated into two populations concerning the ApoA-I protein level – ApoA-I rich and ApoA-I poor cells. TNF increases apoA-I gene expression and stimulates ApoA-I protein secretion in THP-1 cells. TNF-mediated activation of apoA-I gene expression depends on JNK and MEK1/2 signaling pathways in THP-1 monocytes, whereas inhibition of NFB, JNK, or p38 blocks TNF-dependent activation of apoA-I gene expression in THP- macrophages. Treatment of THP-1 cells by synthetic ligands of PPAR and LXRs interferes with TNF-mediated activation of apoA-I gene in THP-1 cells. At the same time, TNF differently regulates the levels of PPAR and LXR binding with the apoA-I gene hepatic enhancer in THP-1 cells. Obtained results elucidate the tissue-specific mechanism of the TNFmediated regulation of apoA-I gene expression in hepatocytes and monocyte-macrophage cells and suggest the possibility that macrophage endogenous synthesized ApoA-I may be involved in control of inflammation and atherosclerotic lesions formation.



 
Похожие работы:

«ЭБЕЛЬ Александр Леонович ФЛОРА СЕВЕРО-ЗАПАДНОЙ ЧАСТИ АЛТАЕ-САЯНСКОЙ ПРОВИНЦИИ: СОСТАВ, СТРУКТУРА, ПРОИСХОЖДЕНИЕ, АНТРОПОГЕННАЯ ТРАНСФОРМАЦИЯ 03.02.01 – Ботаника Автореферат диссертации на соискание ученой степени доктора биологических наук Томск 2011 Работа выполнена на кафедре ботаники ФГБОУ ВПО Национальный исследовательский Томский государственный университет Научный консультант : доктор биологических наук, профессор Ревушкин Александр Сергеевич Официальные оппоненты :...»

«ЧЕРЕПКОВА Оксана Анатольевна ШАПЕРОНОПОДОБНАЯ АКТИВНОСТЬ ФАКТОРА ИНГИБИРОВАНИЯ МИГРАЦИИ МАКРОФАГОВ Специальность 03.00.04 – биохимия АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Москва 2006 Работа выполнена в лаборатории молекулярной организации биологических структур Института биохимии им. А.Н. Баха РАН Научный руководитель : доктор биологических наук Б.Я. Гурвиц Официальные оппоненты : доктор биологических наук, профессор С.С. Шишкин...»

«ЯРЛЫЧЕНКО СВЕТЛАНА АЛЕКСАНДРОВНА КОМПОСТИРОВАНИЕ ОРГАНИЧЕСКОЙ ФРАКЦИИ ТВЕРДЫХ БЫТОВЫХ ОТХОДОВ С ИСПОЛЬЗОВАНИЕМ БАКТЕРИАЛЬНЫХ ДОБАВОК 03.00.07-03 – Микробиология АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук КАЗАНЬ – 2008 Работа выполнена на кафедре прикладной экологии факультета экологии и географии Государственного образовательного учреждения высшего профессионального образования Казанский государственный университет им. В.И....»

«Зотов Александр Александрович ПРЕИМАГИНАЛЬНЫЕ СТАДИИ ДОЛГОНОСИКОВ ПОДСЕМЕЙСТВА LIXINAE (COLEOPTERA, CURCULIONIDAE): ЭКОЛОГИЯ И МОРФОЛОГИЯ 03.02.08 – экология (биологические наук и) АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Ростов-на-Дону - 2013 2 Работа выполнена в отделе аридной экологии ФГБУН Институт аридных зон Южного научного Центра РАН доктор биологических наук, Научный руководитель : Арзанов Юрий Генрихович Замотайлов Александр...»

«Зиннер Надежда Сергеевна БИОЛОГИЧЕСКИЕ ОСОБЕННОСТИ HEDYSARUM ALPINUM L. И HEDYSARUM THEINUM KRASNOB. ПРИ ИНТРОДУКЦИИ В УСЛОВИЯХ ЛЕСНОЙ ЗОНЫ ЗАПАДНОЙ СИБИРИ Специальность 03.02.01 – Ботаника АВТОРЕФЕРАТ диссертации на соискание ученой степени кандидата биологических наук Томск 2011 Работа выполнена в Федеральном государственном бюджетном образовательном учреждении Национальный исследовательский Томский государственный университет на кафедре агрономии и в Сибирском ботаническом...»






 
© 2013 www.diss.seluk.ru - «Бесплатная электронная библиотека - Авторефераты, Диссертации, Монографии, Методички, учебные программы»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.